Alkane-degrading bacteria and their applications

Abstract

The present invention relates to the field of biotechnology, and particularly to alkane-degrading bacteria and their applications. The present invention constructs a recombinant strain capable of degrading alkanes, and realizes the effect of restoring the degradation rate under high temperature, high osmotic pressure, and acidic conditions by adding GSH. Further, a mixed bacterial system composed of glutathione-synthesizing bacterium GSH-10 and engineering yeast SAH03 for degrading hexadecane is constructed to help the hydrocarbon-degrading strain restore the degradation rate under stress conditions.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to alkane-degrading bacteria and their applications. Background Art

[0002] In the treatment of oil pollution, biodegradation technology has the advantages of being economical, efficient, and free of secondary pollution, and has currently become a research hotspot for the treatment of oil pollution, especially marine oil pollution.

[0003] Alkanes are the main components of petroleum and are also one of the main pollutants in various petrochemical wastewaters. At present, although many studies on the microbial degradation of petroleum hydrocarbons have been carried out at home and abroad, and various degrading bacteria have been isolated from soil and the ocean to enable the biodegradation of alkanes, generally, the environmental conditions of oil-polluted areas are relatively harsh, and ordinary microorganisms are difficult to exhibit good physiological activities under high-temperature, high-salt, or acidic conditions. Summary of the Invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide alkane-degrading bacteria and their applications, and to improve their degradation rates under stress conditions.

[0005] The present invention provides a fusion gene, which comprises an alkM gene and a rubA gene; wherein:

[0006] The alkM gene has a nucleic acid sequence as shown in SEQ ID NO:1;

[0007] The rubA gene has a nucleic acid sequence as shown in SEQ ID NO:2.

[0008] The present invention fuses the alkane hydroxylase gene alkM with its coenzyme gene rubA, and the obtained recombinant strain can degrade alkanes. The fusion gene sequentially comprises an alkM gene, a linker, and a rubA gene from the 5'-end to the 3'-end, wherein the linker can be replaced by other sequences. In some specific embodiments, the fusion gene has a nucleic acid sequence as shown in SEQ ID NO:3, or a sequence having 90% sequence homology thereto. The nucleic acid sequence as shown in SEQ ID NO:3 is more suitable for the expression in yeast and can obtain higher alkane-degrading activity.

[0009] The present invention also provides an expression unit, which comprises a promoter and the fusion gene as described above.

[0010] In the present invention, the expression unit further comprises a ura promoter, a ura auxotrophic tag, an amp promoter, an amp resistance gene, an Ori replicon, and an ARS / CEN element.

[0011] The present invention also provides a plasmid vector, which comprises a backbone vector and the fusion gene as described above.

[0012] In the present invention, the backbone vector is an expression vector or a backbone vector for amplifying / preserving the fusion gene. In some specific embodiments, the backbone vector is pRS416.

[0013] Furthermore, the present invention also provides a recombinant strain, whose genome integrates the fusion gene as described above, or which is transformed or transfected with the plasmid vector as described above.

[0014] In the present invention, the host of the recombinant strain is used for amplifying or preserving the plasmid vector or the fusion gene, or for expressing the fusion gene. In some specific embodiments, the host of the recombinant strain is Saccharomyces cerevisiae. More specifically, the Saccharomyces cerevisiae is Saccharomyces cerevisiae BY4741.

[0015] Even further, the present invention also provides the application of the fusion gene, plasmid vector or recombinant strain as described above in degrading alkanes. The alkane described in the present invention is hexadecane.

[0016] The present invention also provides a product for degrading alkanes, which comprises the recombinant strain as described above.

[0017] GSH is a tripeptide composed of three amino acids - glutamic acid, cysteine and glycine, with a γ-amide bond and a thiol group, and exists in Saccharomyces cerevisiae in the form of thiol reduction and disulfide oxidation. The cysteine residue of GSH has redox activity and participates in various life activities of the body, helping cells resist oxidative damage by scavenging free radicals. In the product for degrading alkanes described in the present invention, GSH is also included.

[0018] In some embodiments, the source of GSH is: exogenously added GSH, endogenously produced GSH, or a mixture of strains capable of producing GSH.

[0019] In some specific embodiments, the product for degrading alkanes described in the present invention comprises the recombinant strain as described above and GSH.

[0020] In some other specific embodiments, the product for degrading alkanes described in the present invention comprises the recombinant strain as described above and the GSH-producing strain GSH-10.

[0021] The preparation method of the product for degrading alkanes described in the present invention includes culturing the recombinant strain as described above and separating the bacterial cells. In some embodiments, the preparation method further includes the step of mixing with a protective agent to make bacterial powder.

[0022] Even further, the present invention also provides a method for degrading alkanes, which includes degrading with the product as described above.

[0023] In some embodiments, the method for degrading alkanes specifically comprises inoculating the recombinant strain as described above into the material to be treated for cultivation.

[0024] In other embodiments, the method for degrading alkanes specifically comprises inoculating the recombinant strain as described above into the material to be treated, adding GSH, and then culturing. The final concentration of the GSH is 0.5 nM.

[0025] In other embodiments, the method for degrading alkanes specifically comprises inoculating the recombinant strain as described above and the GSH-producing strain GSH-10 into the material to be treated for cultivation.

[0026] In the method as described above, the cultivation is carried out under conditions containing a carbon source and a nitrogen source. In some specific embodiments, the carbon source and the nitrogen source are from MS medium.

[0027] The present invention constructs a recombinant strain capable of degrading alkanes, and realizes the effect of restoring the degradation rate under high temperature, high osmotic pressure, and acidic conditions by adding GSH. Further, a mixed bacterial system composed of the glutathione-synthesizing bacterium GSH-10 and the engineered yeast SAH03 for degrading hexadecane is constructed to help the hydrocarbon-degrading strain restore the degradation rate under stress conditions. Brief Description of the Drawings

[0028] Figure 1 Showing the effect of SAH03 on degrading n-hexadecane, wherein, (a) is the growth curve; (b) is the degradation rate at 96 h;

[0029] Figure 2 Showing the effect of glutathione on the engineered yeast under high temperature conditions, (a) showing the growth curve; (b) showing the degradation rate at 96 h;

[0030] Figure 3 Showing the effect of glutathione on the engineered yeast under high osmotic pressure conditions, (a) showing the growth curve; (b) showing the degradation rate at 96 h;

[0031] Figure 4 Showing the effect of glutathione on the engineered yeast under acidic conditions, (a) showing the growth curve; (b) showing the degradation rate at 96 h;

[0032] Figure 5 Showing the effect of GSH-10 on SAH03 under normal conditions, (a) showing the growth curve; (b) showing the degradation rate at 96 h;

[0033] Figure 6 Showing the effect of GSH-10 on SAH03 under high temperature conditions, (a) showing the growth curve; (b) showing the degradation rate at 96 h;

[0034] Figure 7Show the effect of GSH-10 on SAH03 under hyperosmotic conditions. (a) shows the growth curve; (b) shows the degradation rate at 96 h.

[0035] Figure 8 Show the effect of GSH-10 on SAH03 under acidic conditions. (a) shows the growth curve; (b) shows the degradation rate at 96 h. Detailed implementation manners

[0036] The present invention provides alkane-degrading bacteria and their applications. Those skilled in the art can draw on the content of this article and appropriately modify the process parameters to achieve. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate alterations and combinations to the methods and applications in this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0037] The test materials used in the present invention are all ordinary commercially available products and can be purchased in the market.

[0038] The nucleic acid sequences involved in the present invention are as follows:

[0039] alkM gene

[0040]

[0041] rubA gene

[0042] ATGAAAAAATATCAATGTATTGTTTGTGGTTGGATTTATGATGAAGCTGAAGGTTGGCCACAAGATGGTATTGCTGCTGGTACTAAATGGGAAGATATTCCTGATGATTGGACTTGTCCTGATTGTGGTGTTTCTAAAGCTGATTTTGAAATGGTTGAAATTTAA(SEQ ID NO:2)

[0043] Linker

[0044] GGTCGACGGATCCCCGGGTTAATTAAC(SEQ ID NO:4)

[0045] The present invention will be further described below in conjunction with embodiments:

[0046] Example 1 Construction of Recombinant Strain

[0047] Using Saccharomyces cerevisiae BY4741 as the degradation chassis, the alkane hydroxylase gene alkM was fused with its coenzyme gene rubA (SEQ ID NO:3), and introduced into the chassis using the pRS416 vector (the insertion site is the multiple cloning site region (MCS)), obtaining the recombinant strain SAH03, and its degradation rate after 96 h was measured and analyzed, as Figure 1 shown. SAH01 used as a control for SAH03 is an engineered yeast strain in which the alkM gene was introduced into Saccharomyces cerevisiae using the pRS416 vector.

[0048] Example 2 Effect of Degrading Alkanes

[0049] Select the yeast SAH03 constructed in Example 1 as the experimental object to explore the recovery effect of glutathione on its degradation rate under stress conditions, and help the hydrocarbon-degrading strain to recover the degradation rate under stress conditions.

[0050] 1. Degradation ability of SAH03 and SAH01

[0051] The substrate was 10 g / L n-hexadecane + SC medium, cultured at 30 °C for 96 hours, and the growth curve and degradation rate are as Figure 1 .

[0052] 2. Recovery effect of glutathione on the degradation ability of engineered degradation bacteria under different conditions

[0053] 2.1 High temperature condition

[0054] The experiment was divided into three groups:

[0055] Group 1 (denoted as 30°C): The substrate was 10 g / L n-hexadecane + SC medium, and it was cultured at 30°C for 96 hours.

[0056] Group 2 (denoted as 35°C): The substrate was 10 g / L n-hexadecane + SC medium, and it was cultured at 35°C for 96 hours.

[0057] Group 3 (denoted as 30°C + GSH): The substrate was 10 g / L n-hexadecane + 0.5 mM glutathione + SC medium, and it was cultured at 35°C for 96 hours.

[0058] The growth curve and degradation rate are as Figure 2 shown, as Figure 2 shown, compared with the degradation rate of 20.42% of the strain growing at 30°C, under high-temperature conditions, the degradation rate of the strain decreased to 17.69%. In the engineering Saccharomyces cerevisiae strain with exogenous addition of glutathione in the medium, the degradation rate recovered to 19.14%, which was 1.08 times higher than that of the strain without glutathione addition in the medium. This result indicates that giving the strain a high-temperature growth environment will reduce the degradation rate of the strain, while adding glutathione will help the strain recover its certain degradation ability.

[0059] 2.2 High osmotic pressure conditions

[0060] The experiment was divided into three groups:

[0061] Group 1 (denoted as 0% NaCl): The substrate was 10 g / L n-hexadecane + SC medium, and it was cultured at 30°C for 96 hours.

[0062] Group 2 (denoted as 5% NaCl): The substrate was 10 g / L n-hexadecane + 5% NaCl + SC medium, and it was cultured at 30°C for 96 hours.

[0063] Group 3 (denoted as 5% NaCl + GSH): The substrate was 10 g / L n-hexadecane + 5% NaCl + 0.5 mM glutathione + SC medium, and it was cultured at 30°C for 96 hours.

[0064] The growth curve and degradation rate are as Figure 3 shown, as Figure 3 shown, high osmotic pressure inhibited both the growth of the strain and its degradation ability. The degradation efficiency decreased from 20.42% to 5.04%, while the degradation rate of the engineered degrading bacteria with exogenous addition of glutathione was 10.91%, which was 1.69 times higher. This shows that under high osmotic pressure conditions, the degradation efficiency of the engineered degrading strain will be greatly inhibited, and glutathione has a strong ability to restore the degradation efficiency of the strain under high osmotic pressure conditions.

[0065] 2.3 Acidic conditions

[0066] The experiment was divided into three groups:

[0067] Group 1 (denoted as Control): The substrate was 10 g / L n-hexadecane + SC medium, and cultured at 30 °C for 96 hours.

[0068] Group 2 (denoted as pH = 5): The substrate was 10 g / L n-hexadecane + SC medium, the pH value was adjusted to 5 with hydrochloric acid, and cultured at 30 °C for 96 hours.

[0069] Group 3 (denoted as pH = 5 + GSH): The substrate was 10 g / L n-hexadecane + 0.5 mM glutathione + SC medium, the pH value was adjusted to 5 with hydrochloric acid, and cultured at 30 °C for 96 hours.

[0070] The growth curves and degradation rates are as Figure 4 , as Figure 4 shown. Under acidic conditions, the degradation of n-hexadecane was inhibited, and the degradation rate of the engineered degrading bacteria decreased from 20.42% to 12.19%. After exogenous addition of glutathione, the degradation rate of the engineered yeast could be restored to 15.59%, which was 1.28 times higher than that of the strain grown in the medium without glutathione addition. This indicates that glutathione has a certain restorative effect on the degradation ability of the strain under acidic conditions.

[0071] Effect of mixed bacteria on alkane degradation in Example 3

[0072] A mixed bacteria system composed of glutathione-producing bacterium GSH-10 (the construction method refers to the invention patent with the application number 202110639162.X) and the yeast SAH03 constructed in Example 1 was constructed, and the degradation effect on alkanes was detected.

[0073] 1. Under normal conditions

[0074] The experiment was divided into three groups:

[0075] Group 1 (denoted as SAH03): The strain was SAH03, the substrate was 10 g / L n-hexadecane + SC medium, and cultured at 30 °C for 96 hours.

[0076] Group 2 (denoted as GSH-10): The strain was GSH-10, the substrate was 10 g / L n-hexadecane + SC medium, and cultured at 30 °C for 96 hours.

[0077] Group 3 (denoted as SAH03 + GSH-10): The strains were GSH-10 and SAH03, the substrate was 10 g / L n-hexadecane + SC medium, and cultured at 30 °C for 96 hours.

[0078] The results are as Figure 5As shown, the degradation rate of the mixed bacteria system (Group 3) increased from 20.42% of the single bacteria to 39.62%, which was 1.94 times higher.

[0079] 2. Under high temperature conditions

[0080] The experiment was divided into four groups:

[0081] Group 1 (denoted as SAH03 - 30°C): The strain was SAH03, the substrate was 10 g / L n - hexadecane + SC medium, and it was cultured at 30°C for 96 hours.

[0082] Group 2 (denoted as SAH03 - 35°C): The strain was SAH03, the substrate was 10 g / L n - hexadecane + SC medium, and it was cultured at 35°C for 96 hours.

[0083] Group 3 (denoted as GSH - 10 - 35°C): The strain was GSH - 10, the substrate was 10 g / L n - hexadecane + SC medium, and it was cultured at 35°C for 96 hours.

[0084] Group 4 (denoted as SAH03 + GSH - 10 - 35°C): The strains were GSH - 10 and SAH03, the substrate was 10 g / L n - hexadecane + SC medium, and it was cultured at 35°C for 96 hours.

[0085] As Figure 6 shown, under the condition of 35°C, the degradation rate of the engineered degradation bacterium SAH03 decreased by 2.43% to 17.69%. While the degradation rate of the strain after mixed - bacteria optimization could be restored to 20.94%, which was 1.18 times that of SAH03 single bacteria under the same conditions, and its degradation rate was almost completely restored. Therefore, GSH - 10 has a certain restorative effect on the degradation ability of SAH03 under high - temperature conditions.

[0086] 3. Under high - osmotic - pressure conditions

[0087] The experiment was divided into four groups:

[0088] Group 1 (denoted as SAH03 - 0% NaCl): The strain was SAH03, the substrate was 10 g / L n - hexadecane ++ SC medium, and it was cultured at 30°C for 96 hours.

[0089] Group 2 (denoted as SAH03 - 5% NaCl): The strain was SAH03, the substrate was 10 g / L n - hexadecane + 5% NaCl + SC medium, and it was cultured at 35°C for 96 hours.

[0090] Group 3 (denoted as GSH - 10 - 5% NaCl): The strain was GSH - 10, the substrate was 10 g / L n - hexadecane + 5% NaCl + SC medium, and it was cultured at 35°C for 96 hours.

[0091] Group 4 (denoted as SAH03+GSH-10-5% NaCl): The strains are GSH-10 and SAH03, the substrate is 10 g / L n-hexadecane + 5% NaCl + SC medium, and it is cultured at 35 °C for 96 hours.

[0092] As Figure 7 shown, under the condition of adding 5% NaCl externally, the degradation rate of the engineered degrading bacterium SAH03 decreased by 18.08% to 5.04%. While the degradation rate of the strain after mixed bacteria optimization can be restored to 17.04%, reaching 3.38 times that of SAH03 single bacterium under the same conditions. Under the condition of adding 5% NaCl externally, the mixed bacteria can restore 83.47% of the degradation rate of the engineered degrading strain. Therefore, under high osmotic pressure conditions, GSH-10 has a strong recovery effect on the engineered degrading bacterium.

[0093] 4. Under acidic conditions

[0094] The experiment was divided into four groups:

[0095] Group 1 (denoted as SAH03-pH = 6): The strain is SAH03, the substrate is 10 g / L n-hexadecane + + SC medium, and it is cultured at 30 °C for 96 hours.

[0096] Group 2 (denoted as SAH03-pH = 5): The strain is SAH03, the substrate is 10 g / L n-hexadecane + SC medium, the pH value is adjusted to 5 with hydrochloric acid, and it is cultured at 35 °C for 96 hours.

[0097] Group 3 (denoted as GSH-10-pH = 5): The strain is GSH-10, the substrate is 10 g / L n-hexadecane + SC medium, the pH value is adjusted to 5 with hydrochloric acid, and it is cultured at 35 °C for 96 hours.

[0098] Group 4 (denoted as SAH03+GSH-10-pH = 5): The strains are GSH-10 and SAH03, the substrate is 10 g / L n-hexadecane + SC medium, the pH value is adjusted to 5 with hydrochloric acid, and it is cultured at 35 °C for 96 hours.

[0099] As Figure 8 shown, under the condition of pH = 5, the degradation rate of the hydrocarbon-degrading bacterium SAH03 decreased by 8.23% to 12.19%. While the degradation rate of the strain after mixed bacteria optimization can be restored to 12.62, only 0.43% is restored. Therefore, under acidic conditions, the recovery effect of the mixed bacteria on the engineered degrading strain is weak.

[0100] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and retouches can be made, and these improvements and retouches should also be regarded as the protection scope of the present invention.

Claims

1. A fusion gene, the nucleic acid sequence of which is as shown in SEQ ID NO:

3.

2. A plasmid vector, which comprises a backbone vector and the fusion gene according to claim 1.

3. The plasmid vector according to claim 2, characterized in that the backbone vector is pRS416.

4. A recombinant strain, characterized in that its genome integrates the fusion gene according to claim 1, or it is transformed or transfected with the plasmid vector according to claim 2 or 3.

5. The recombinant strain according to claim 4, characterized in that its host is Saccharomyces cerevisiae.

6. A product for degrading alkanes, characterized in that it comprises the recombinant strain according to claim 4 or 5; the alkane is hexadecane.

7. The product according to claim 6, characterized in that it further comprises GSH.

8. The product according to claim 7, characterized in that the source of the GSH is: exogenously added GSH, endogenously produced GSH, or a mixture of strains capable of producing GSH.

9. A method for degrading alkanes, which comprises degrading with the product according to any one of claims 6 to 8; the alkane is n-hexadecane.

Images