Molecular marker primers, kit and application for identifying rubber tree Yunyan 3003

Abstract

The present invention discloses a molecular marker primer, a kit, and an application for identifying the rubber tree Yunyan 3003. The molecular marker primer includes an upstream primer and a downstream primer, the upstream primer is shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer is shown in SEQ ID NO: 2 in the sequence listing. The kit includes the molecular marker primer. Applications include: using the molecular marker primer to identify the rubber tree Yunyan 3003. The sequencing results of the marker are used to distinguish varieties, such as the presence of one or more base differences, or substitutions, insertions, deletions, or duplications between different sequences, thereby achieving the identification of Yunyan 3003. The rubber trees RRIM600, Yunyan 3089, Reyan 106, RRIC52, RRII105, Reken 525, IAN873, and Reyan 917 can also be distinguished, and rubber tree varieties can be accurately identified.

Description

Technical Field

[0001] The present disclosure relates to the fields of molecular biology and genetic breeding, and in particular to a molecular marker primer, a kit and an application thereof for identifying the rubber tree Yunyan 3003. Background Art

[0002] The rubber tree is a typical perennial tropical rainforest tree native to the Amazon River basin in South America, including Brazil, Venezuela, and Guyana. It was later introduced to my country and is now primarily cultivated in Hainan, Yunnan, and Guangdong. Natural rubber is produced by coagulating and drying the latex released during tapping. In recent years, demand for natural rubber in my country has continued to grow, widening the gap between supply and demand.

[0003] Natural rubber has unique and excellent properties in the fields of weapons and equipment, aircraft tires, high-elastic shock absorption and high-altitude detection. The natural rubber tree industry has broad development prospects in the future.

[0004] Currently, traits are the primary focus of rubber tree variety identification, licensing, and breeding, and trait testing remains the industry standard for many plant variety-specific tests. However, trait expression is susceptible to environmental and human influences, and accurate identification requires several years. Rubber tree germplasm resources, important breeding materials, and varieties promoted and applied in production often exhibit the phenomenon of "same name, different species" and "same species, different names." This hinders rubber tree variety selection, licensing, rapid promotion, and intellectual property protection. In particular, uncertainty regarding rubber tree varieties in actual production severely restricts the healthy and sustainable development of the rubber industry. Impure or even incorrect rubber tree seedling varieties can severely impact the economic interests of rubber farmers.

[0005] Public content

[0006] In order to solve the problem of inaccurate identification of rubber tree Yunyan 3003, the present disclosure provides a molecular marker primer, kit and application for the identification of rubber tree Yunyan 3003. The technical solution is as follows:

[0007] On the one hand, the present disclosure provides a molecular marker primer for identifying rubber tree Yunyan 3003, the molecular marker primer comprising an upstream primer and a downstream primer, the upstream primer being shown as SEQ ID NO: 1 in the sequence listing, and the downstream primer being shown as SEQ ID NO: 2 in the sequence listing.

[0008] On the other hand, the present disclosure provides a kit for identifying rubber tree Yunyan 3003, which includes the above-mentioned molecular marker primers.

[0009] On the other hand, the present disclosure provides an application of molecular marker primers for identifying rubber tree Yunyan 3003, the application comprising: using the molecular marker primers to identify rubber tree Yunyan 3003, the molecular marker primers comprising an upstream primer and a downstream primer, the upstream primer being shown as SEQ ID NO: 1 in the sequence listing, and the downstream primer being shown as SEQ ID NO: 2 in the sequence listing.

[0010] Furthermore, the application also includes: the molecular marker primers can distinguish rubber trees RRIM600, Yunyan 3089, Reyan 106, RRIC52, RRII105, Reken 525, IAN873 and Reyan 917.

[0011] The beneficial effects brought about by the technical solution provided by the embodiments of the present disclosure are: the embodiments of the present invention provide molecular marker primers, kits and applications for the identification of rubber tree Yunyan 3003, and the molecular marker primers distinguish varieties through the sequencing results of amplification products, such as the presence of one or more base differences, or substitutions, or insertions, or deletions, or duplications between different sequences, thereby realizing the identification of rubber tree Yunyan 3003, and can distinguish rubber trees RRIM600, Yunyan 3089, Reyan 106, RRIC52, RRII105, Reken 525, IAN873 and Reyan 917, and the identification results are not affected by the environment and other human factors, thereby accurately identifying rubber tree varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0013] Figure 1 This is a sequence comparison diagram named a to g provided in Example 3 of the present disclosure. DETAILED DESCRIPTION

[0014] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be described in further detail below.

[0015] Example 1

[0016] The present disclosure provides molecular marker primers for identifying rubber tree Yunyan 3003, comprising an upstream primer and a downstream primer, the upstream primer being shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer being shown in SEQ ID NO: 2 in the sequence listing. Specifically, the sequence of the upstream primer is: CAAGATTGGCT AAATCAACCAGGTC, and the sequence of the downstream primer is: TGTAATGGCTTTGTGAAAGAGC ATT.

[0017] Example 2

[0018] The present disclosure provides a kit for identifying rubber tree Yunyan 3003, which includes the molecular marker primers provided in Example 1.

[0019] Example 3

[0020] The present disclosure provides an application of a molecular marker primer for identifying the rubber tree Yunyan 3003, and the application comprises: using the molecular marker primer provided in Example 1 to identify the rubber tree Yunyan 3003.

[0021] Furthermore, the application also includes: this molecular marker primer can distinguish rubber trees RRIM600, Yunyan 3089, Reyan 106, RRIC52, RRII105, Reken 525, IAN873 and Reyan 917.

[0022] Specifically, 42 rubber tree varieties were used as samples to be tested, and the variety names are shown in Table 1.

[0023] Table 1 shows the names of the samples to be tested.

[0024]

[0025]

[0026] The DNA of the 42 test samples was extracted using a new plant genomic DNA extraction kit produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. The specific operation was carried out according to the instructions of the new plant genomic DNA extraction kit.

[0027] 42 samples to be tested were amplified using the labeled primers provided in Example 1 of the present invention. Specifically, the amplification system includes: 50 ng of DNA of the sample to be tested, 0.5 μL of 10 mM dNTP (deoxy-ribonucleoside triphosphate), 0.5 μL of upstream primer, 0.5 μL of downstream primer, 2.5 μL of Tap Buffer, 0.2 μL of Taq enzyme, and ddH2O was added to make up the amplification system to 20 μL. The amplification program includes: 95°C for 3 min; (95°C for 30 sec, 60°C for 30 sec) × 30 cycles; 72°C for 6 min. The amplified products were sequenced by second-generation high-throughput sequencing to obtain sequencing data. The sequencing data were aligned to the rubber tree reference genome (NCBI: PRJNA587314) using Bowtie2 software to obtain the sequencing results of each sample to be tested.

[0028] The sequencing results were analyzed using Microsoft Office Excel software, and a total of seven different sequence types were identified. These seven different sequence types were named a, b, c, d, e, f, and g, as shown in Table 2.

[0029] Table 2 shows the different sequences obtained by sequencing after amplification of 42 samples by molecular marker primers.

[0030]

[0031]

[0032] The software DNASTAR lasergene 11 was used to align 7 different sequence types. The alignment results are shown in the following table. Figure 1 As shown, in Figure 1 There are differences in 18 base positions among the 7 different sequences. Specifically, the differences in the sequences include: C / T at the 23rd base position, C / A at the 24th base position, an A inserted in sequence e at the 38th base position, G / A at the 45th base position, C / T at the 67th base position, G / A at the 69th base position, A / G at the 79th base position, T / G at the 83rd base position, C / T at the 87th base position, G / A at the 90th base position, C / G at the 103rd base position, A / G at the 124th base position, G / A at the 127th base position, G / T at the 128th base position, C / T at the 138th base position, T / A at the 149th base position, A / C at the 167th base position, G / A at the 168th base position, and A / T at the 169th base position.

[0033] Among the 42 test samples provided in this example, 9 test samples can be effectively distinguished using the primer pairs provided in this example. The different sequence combinations of the 9 test samples are shown in Table 3.

[0034] Table 3 shows the different sequence combinations of the 9 samples to be tested.

[0035] Serial number Name of the sample to be tested Sequence Combination 1 RRIM600 ae 2 Yunyan 3089 aeg 3 Thermal Research 106 ag 4 RRIC52 b 5 RRII105 cf 6 Reken 525 df 7 IAN873 dg 8 Yunyan 3003 efg 9 Hot Research 917 e.g.

[0036] As can be seen from Table 3, the above 9 samples to be tested have different sequence combinations. It can be seen that the primers provided in Example 1 of the present invention can amplify the sequence of Yunyan 3003, and the sequence combination is efg. According to different sequence combinations, the rubber trees RRIM600, Yunyan 3089, Reyan 106, RRIC52, RRII105, Reken 525, IAN873 and Reyan 917 can be distinguished.

[0037] Accuracy Analysis of Molecular Marker Primers for Identification of Rubber Trees

[0038] Three reproducibility experiments were used to perform accuracy analysis. In this embodiment, three independent experiments were performed using different personnel, different batches of reagents, and different laboratories, thereby simulating the identification of different batches of rubber trees. A high reproducibility rate means that the identification results of different laboratories can be accurately compared with each other.

[0039] A reproducibility experiment was conducted on nine rubber tree samples: Yunyan 3003, RRIM600, Yunyan 3089, Reyan 106, RRIC52, RRII105, Reken 525, IAN873, and Reyan 917. Each sample was repeated three times, and the sequence combination of each result was recorded. The specific results are shown in Table 4.

[0040] Table 4 shows the results of three repeated experiments.

[0041]

[0042]

[0043] As shown in Table 4, the sequence combinations of 3 repeated experiments are all the same.It can be seen from this that the accuracy rate of the molecular marker primer identification provided by the embodiment of the present invention is 100%.As can be seen, the embodiment of the present invention adopts the variety identification conclusion between different batches of different laboratories or same laboratory to have higher consistency, thereby need not adopt parallel experiment to reduce experimental error, and this provides great convenience for rubber tree variety identification.

[0044] The embodiments of the present invention provide molecular marker primers, a kit, and applications for identifying the rubber tree Yunyan 3003. The molecular marker primers, a kit, and applications are used to distinguish varieties by using the sequencing results of the markers. For example, if there are differences in one or more bases, or substitutions, insertions, deletions, or duplications, between different sequences, the identification of Yunyan 3003 is achieved. The rubber tree Yunyan 3003 is an important triploid. At the same time, the rubber trees RRIM600, Yunyan 3089, Reyan 106, RRIC52, RRII105, Reken 525, IAN873, and Reyan 917 can be distinguished. The identification results are not affected by the environment and other human factors, thereby accurately identifying the rubber tree varieties.

[0045] The above description is merely an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the scope of protection of the present disclosure.

Claims

1. A molecular marker primer for the identification of rubber tree Yunyan 3003, characterized in that, The molecular marker primers include an upstream primer and a downstream primer. The upstream primer is shown as SEQ ID NO: 1 in the sequence listing, and the downstream primer is shown as SEQ ID NO: 2 in the sequence listing.

2. A kit for identifying rubber tree Yunyan 3003, characterized in that, The kit comprises the molecular marker primer according to claim 1.

3. An application of a molecular marker primer for the identification of rubber tree Yunyan 3003, characterized in that, The application includes: using molecular marker primers for identifying rubber tree Yunyan 3003, using the molecular marker primers to amplify a sample to be tested to obtain an amplified product, the molecular marker primers including an upstream primer and a downstream primer, the upstream primer is shown in SEQ ID NO: 1 in the sequence listing, and the downstream primer is shown in SEQ ID NO: 2 in the sequence listing; The amplified product is sequenced by second-generation high-throughput sequencing to obtain sequencing data; The sequencing data was aligned to the rubber tree reference genome NCBI: PRJNA587314 to obtain the sequencing results of the sample to be tested; The sequencing results were analyzed to obtain 7 different sequence types as shown in SEQ ID NO: 3 to SEQ ID NO: 9 in the sequence listing; When the sequence type is shown in SEQ ID NO: 7 to SEQ ID NO: 9 in the sequence listing, the sample to be tested is identified as Hevea brasiliensis Yunyan 3003.

4. The use according to claim 3, characterized in that The application also includes: the molecular marker primer pairs are used to distinguish rubber trees RRIM600, Yunyan 3089, Reyan 106, RRIC52, RRII105, Reken 525, IAN873 and Reyan 917.

Images