A photoelectrochemical biosensor and its construction method and application in distinguishing and detecting influenza and novel coronavirus

Abstract

The present invention discloses a photoelectrochemical biosensor and its construction method and application in distinguishing and detecting influenza and novel coronavirus. The present invention uses the specific recognition of the aptamer and the analyte HA / RBD in the Co / NC@CdS-TDN-Apts magnetic conjugate to make the aptamer leave the Co / NC@CdS-TDN-Apts. At this time, the exposed cantilever end of the TDN on the magnetic conjugate can bind to the Ag2S-tDNA1 / CuO@PMo 12 The new magnetic conjugate is formed by hybridization with DNA on tDNA2, and the magnetic conjugate is used to modify the MITO electrode to produce a photoelectrochemical biosensor. The photoelectrochemical biosensor of the present invention has the advantages of high sensitivity, good selectivity, simple operation, rapid analysis, and ease of operation. It can detect relatively low concentrations of HA / RBD and has good application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of functional biomaterials and biosensor technologies, and in particular relates to a photoelectrochemical biosensor, a construction method thereof, and its application in building a system for detecting influenza and the new coronavirus. Background Art

[0002] To differentiate between influenza viruses and SARS-CoV-2, a variety of identification methods are currently available, including nucleic acid analysis (RT-PCR, isothermal nucleic acid amplification, CRISPR / Cas technology), antibodies, and chest imaging (X-rays, computed tomography). However, these methods all have limitations, including time-consuming, costly, and difficult to perform. Furthermore, specific target identification limits their suitability for large-scale clinical diagnosis. Furthermore, the signal output modes of aptamer-assisted diagnostic strategies for SARS-CoV-2 are "signal-enhancing" and "signal-reducing," making false positive or false negative signals unavoidable in the presence of influenza virus. Summary of the Invention

[0003] The purpose of the present invention is to provide a photoelectrochemical biosensor with good specificity, high sensitivity, fast detection speed, accurate and reliable results, and low cost, as well as a construction method and application in building a system for detecting influenza and new coronaviruses.

[0004] The method for constructing the photoelectrochemical biosensor provided by the present invention comprises the following steps:

[0005] 1) The capture unit Co / NC@CdS-TDN-Apts magnetic conjugate was prepared using the magnetic porous optoelectronic material Co / NC@CdS, tetrahedral DNA (TDN), HA aptamer and RBD aptamer;

[0006] 2) Preparation of signal unit Ag2S-tDNA1;

[0007] 3) Preparation of signal unit CuO@PMo 12 -tDNA2;

[0008] 4) After the capture unit Co / NC@CdS-TDN-Apts magnetic conjugate is incubated with the analyte, the signal unit Ag2S-tDNA1 and CuO@PMo are added. 12 -tDNA2 incubation to obtain an incubated magnetic conjugate, and the incubated magnetic conjugate is used to modify the MITO electrode to obtain a photoelectrochemical biosensor.

[0009] Preferably, in step 1), the preparation of the capture unit Co / NC@CdS-TDN-Apts magnetic conjugate includes fixing tetrahedral DNA (TDN) on the surface of Co / NC@CdS through a Cd-S bond to obtain Co / NC@CdS-TDN, and then the cantilever end of TDN on Co / NC@CdS-TDN is combined with the HA aptamer and the RBD aptamer through base complementary pairing to obtain the Co / NC@CdS-TDN-Apts magnetic conjugate.

[0010] Further preferably, the Co / NC@CdS is prepared by a continuous ion layer adsorption and reaction method of magnetic cobalt nanoparticles / nitrogen-doped porous carbon material Co / NC in a cadmium ion and sulfur ion solution; the Co / NC is obtained by calcining a cobalt-based zeolite imidazolate framework ZIF-67. The specific process is: ZIF-67 is heated to 300~350℃ at a rate of 5℃ / min under N2 atmosphere and maintained for 30~120 min, and then heated to 510~800℃ and maintained for 2~10 h to obtain Co / NC.

[0011] More preferably, the ZIF-67 is prepared by reacting a cobalt nitrate hexahydrate solution and a 2-methylimidazole solution at room temperature.

[0012] Further preferably, in order to block nonspecific binding, the Co / NC@CdS-TDN is first dispersed in a 1 × TAE buffer solution of 1 mM 6-mercapto-1-hexanol (MCH) and incubated at room temperature for 0.5 to 2 h. After incubation, the cantilever end of the TDN on the Co / NC@CdS-TDN binds to the HA aptamer and the RBD aptamer through base complementary pairing to obtain a Co / NC@CdS-TDN-Apts magnetic conjugate.

[0013] More preferably, the aptamers of HA and RBD are heated at 89-98°C for 5-12 min to expand their sequences, cooled to room temperature, and then mixed with the incubated Co / NC@CdS-TDN conjugate in a 30-40°C water bath for 30-120 min to allow the cantilever end of TDN to hybridize with the aptamers of HA and RBD to obtain the Co / NC@CdS-TDN-Apts magnetic conjugate.

[0014] The magnetic cobalt nanoparticle / nitrogen-doped porous carbon material Co / NC of the present invention has good magnetism and can be quickly adsorbed by a magnet; the Co / NC@CdS has good photoelectric properties and shows obvious anode photocurrent.

[0015] Preferably, in step 1), the preparation of tetrahedral DNA (TDN) comprises the following steps: heating equimolar amounts of four DNA single strands S1, S2, S3, and S4 at 89-98°C for 5-12 min, and then rapidly cooling to 0-4°C to obtain tetrahedral DNA (TDN).

[0016] Preferably, in step 2), the signal unit Ag2S-tDNA1 is prepared by incubating an Ag2S dispersion with a tDNA1 (HA) solution at 0-4°C for 8-16 hours.

[0017] Preferably, in step 3), the signal unit CuO@PMo 12 -tDNA2 by CuO@PMo 12 The dispersion and tDNA2 (RBD) solution were incubated at 0-4°C for 8-16 h.

[0018] More preferably, the CuO@PMo 12 Preparation: CuO was ultrasonically dispersed in methanol and mixed with PMo 12 The methanol solution was mixed and stirred at room temperature for 12-24 h to obtain CuO@PMo 12 .

[0019] More preferably, the signal unit Ag2S-tDNA1 and the signal unit CuO@PMo 12 -tDNA2 were respectively blocked with 1 mM MCH at their non-specific active sites before being used in step 4).

[0020] Preferably, in step 4), the MITO electrode is a magnetic indium tin oxide electrode.

[0021] Further preferably, the MITO electrode is a magnetic indium tin oxide electrode, that is, a circular magnetic sheet with a diameter of 3 mm is attached to the back of the indium tin oxide electrode to form a working electrode with magnetic adsorption ability.

[0022] The photoelectrochemical biosensor was constructed according to the above construction method.

[0023] The photoelectrochemical biosensor is used in distinguishing and detecting influenza and the new coronavirus and / or in building a system for detecting influenza and the new coronavirus.

[0024] The photoelectrochemical biosensor provided by the present invention is used in a system for detecting influenza and the novel coronavirus. The current-time method is used, with a potential set to -0.1 V. The photoelectrochemical biosensor is used as the working electrode, a calomel electrode as the reference electrode, a platinum column electrode as the counter electrode, and Tris-HCl (0.1 M, pH 7.4) as the detection buffer. The prepared photoelectrochemical biosensor's photocurrent response to HA / RBD is used to establish a quantitative relationship between the photocurrent response and HA / RBD. Based on this quantitative relationship, the HA / RBD content in the sample is determined.

[0025] The present invention utilizes the magnetic porous photoelectric material Co / NC@CdS to introduce tetrahedral DNA (TDN) onto the Co / NC@CdS surface via Cd-S bonds. The TDN's cantilevered end then binds to the aptamers of the two analytes, HA and RBD, through complementary base pairing, forming the magnetic conjugate Co / NC@CdS-TDN-Apts. When the analyte HA is present in the sample, the specific binding of HA with the aptamer causes the aptamer to detach from the magnetic conjugate. The exposed cantilevered end of the TDN on the magnetic conjugate is then able to hybridize with the DNA on the Ag2S-tDNA1, forming a new magnetic conjugate. The analyte HA induces the binding of Ag2S-tDNA1 to the magnetic conjugate, and the Ag2S enhances the photocurrent of the CdS, thereby increasing the photocurrent signal of the magnetic conjugate. Similarly, when the sample contains the analyte RBD, the specific binding of RBD and RBD aptamer causes the RBD aptamer to separate from the magnetic conjugate. At this time, the exposed cantilever end of TDN on the magnetic conjugate can bind to CuO@PMo 12 -DNA hybridization on tDNA2 forms a new magnetic conjugate. The analyte RBD induces CuO@PMo 12 -tDNA2 binds to the magnetic conjugate, CuO@PMo 12 It has a good polarity reversal effect on the photocurrent of CdS, thereby reversing the polarity of the photocurrent of the magnetic conjugate. The signal change of the photocurrent is related to the concentration of the analyte, thereby realizing the detection of HA / RBD. When there is no analyte HA and RBD in the sample, the photocurrent signal of Co / NC@CdS-TDN-Apts remains unchanged. When HA and RBD are present in the sample at the same time, the constructed photoelectrochemical biosensor still shows a significant polarity reversal photocurrent, and the presence of influenza virus will not interfere with the diagnosis of the new coronavirus.

[0026] Compared with the existing technology, the advantages of the present invention are as follows: the present invention constructs a photoelectrochemical biosensor for distinguishing and detecting influenza and novel coronavirus. First, through the specific recognition between the aptamer and the analyte in Co / NC@CdS-TDN-Apts, the aptamer leaves the magnetic Co / NC@CdS-TDN-Apts. Second, using Ag2S-tDNA1 / CuO@PMo 12 The single-stranded DNA on the -tDNA2 hybridized with the cantilever end of the TDN, causing a change in the photocurrent signal of the magnetic Co / NC@CdS-TDN-Apts. The current-time method was used to measure the photoelectrochemical response of the sensor to different HA / RBD concentrations. Clearly, within a certain concentration range, the higher the HA / RBD concentration, the more pronounced the change in the photocurrent signal. Experimental results showed that the change in the photocurrent signal was linearly correlated with the HA / RBD concentration within a certain range, enabling the detection of HA / RBD. Its advantages are:

[0027] (1) High sensitivity. The photoelectrochemical biosensor of the present invention is used to distinguish and detect influenza and novel coronavirus, using Ag2S-tDNA1 (CuO@PMo 12 -tDNA2) on the photoelectric signal of Co / NC@CdS-TDN-Apts, and two linear equations were obtained: The linear correlation equation of the photocurrent response change to HA concentration is: y =58.1lg C HA +85.4, r =0.9954, the detection limit is 18fg / mL; the linear correlation equation of the photocurrent response change to RBD concentration is: y =163.2lg C RBD +770.1, r =0.9994, and the detection limit was 0.4 fg / mL, indicating that the sensor can achieve high-sensitivity detection of HA / RBD.

[0028] (2) High specificity. The present invention is a photoelectrochemical sensor constructed based on the specific recognition and binding between the analyte and the aptamer. Therefore, interfering substances in the analyte cannot bind to the aptamer and have no interference with the detection system. Other control substances such as carcinoembryonic antigen (CEA), vascular endothelial growth factor (VEGF), prostate-specific antigen (PSA), and mucin 1 (MUC1) also have no interference with the system.

[0029] (3) The results are accurate. The recovery rates are between 90% and 110%.

[0030] (4) Preparation and detection methods require little reagent and are low cost. The present invention can achieve highly sensitive detection of HA / RBD with only a small amount of materials and reagents.

[0031] Based on the signal enhancement and photocurrent polarity reversal strategies, the present invention constructs a photoelectrochemical biosensor for distinguishing and detecting influenza and the new coronavirus. It has the advantages of high sensitivity, good selectivity, simple operation, rapid analysis, and easy operation. It can achieve the detection of lower concentrations of HA / RBD and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The morphology and XRD phase characterization of Co / NC@CdS;

[0033] Figure 2 This is a synthetic diagram of tetrahedral DNA (TDN);

[0034] Figure 3 The morphology and XRD phase characterization diagram of Ag2S;

[0035] Figure 4 This is a feasibility experiment diagram of the sensor of the present invention;

[0036] Figure 5 The calibration curve of the photocurrent response change of the sensor of the present invention to different concentrations of HA is shown;

[0037] Figure 6 The calibration curve of the photocurrent response change of the sensor of the present invention to different concentrations of RBD is shown;

[0038] Figure 7 This is an experimental diagram showing the specificity of the sensor of the present invention for HA / RBD. DETAILED DESCRIPTION

[0039] As a preferred embodiment of the present invention, a method for constructing a photoelectrochemical biosensor comprises the following steps:

[0040] Step 1: Preparation of a capture unit Co / NC@CdS-TDN-Apts magnetic conjugate, comprising the following steps:

[0041] 1-1. Synthesis of magnetic cobalt nanoparticles / nitrogen-doped porous carbon material Co / NC: 1.0-6.0 g of cobalt nitrate hexahydrate and 3.5-9.8 g of 2-methylimidazole were dissolved in 50-250 mL of methanol, respectively. The two solutions were quickly mixed and vigorously stirred at room temperature for 2-12 h. After that, the mixture was collected by centrifugation and washed with ethanol to obtain a cobalt-based zeolite imidazolate framework ZIF-67. ZIF-67 was vacuum-dried at 60 °C and then heated to 300-350 °C at a rate of 5 °C / min under N2 atmosphere and maintained for 30-120 min. Then, the temperature was raised to 510-800 °C and maintained for 2-10 h to obtain magnetic cobalt nanoparticles / nitrogen-doped porous carbon material Co / NC.

[0042] 1-2. Preparation of Co / NC@CdS: 5~50 mg Co / NC was dispersed in 0.05~0.5 M cadmium ions (Cd 2+ ) methanol solution for 1-3 min, washed with methanol, and then dispersed in 0.05-0.5 M sulfide ion (S 2- ) in methanol / water (1:1, v / v) for 1-3 min and washed with methanol. After 3-10 cycles, Co / NC@CdS was obtained. Co / NC@CdS was washed with methanol and ultrapure water and then dispersed in 2-30 mL ultrapure water for later use.

[0043] 1-3. Preparation of Co / NC@CdS-TDN conjugate: Equimolar amounts of four DNA single strands S1, S2, S3, and S4 were heated at 89-98°C for 5-12 min and then rapidly cooled to 0-4°C to obtain tetrahedral DNA (TDN). 0.1-2 mL of TDN solution was then mixed with 0.1-2 mL of Co / NC@CdS dispersion at 0-4°C overnight and then washed three times with 1× TAE buffer to obtain Co / NC@CdS-TDN conjugate. To block nonspecific binding, the obtained Co / NC@CdS-TDN was dispersed in 1× TAE buffer containing 1 mM 6-mercapto-1-hexanol (MCH) and incubated at room temperature for 0.5-2 h. Finally, the mixture was magnetically separated and washed three times and then dispersed in 0.1-2 mL of 1× TAE buffer for later use.

[0044] 1-4. Preparation of Co / NC@CdS-TDN-Apts conjugates: Heat the aptamer solutions of HA and RBD at 89-98°C for 5-12 min to expand their sequences, cool to room temperature, and then mix with the Co / NC@CdS-TDN conjugate dispersion in a 30-40°C water bath for 30-120 min to allow the TDN cantilever to hybridize with the aptamers of HA and RBD. The conjugates are then washed three times with 1× TAE buffer to remove unhybridized aptamers. The resulting Co / NC@CdS-TDN-Apts conjugates are then dispersed in 0.1-2 mL of 1× TAE buffer for later use.

[0045] Step 2: preparing the signal unit Ag2S-tDNA1, comprising the following steps:

[0046] Preparation of Ag2S dispersion: Add 12-35 mL of a 15-30 mM aqueous solution of silver nitrate dropwise to 12-35 mL of a 20-60 mM aqueous solution of sodium thiosulfate. Rapidly add 1.2-8.6 mmol of cetyltrimethylammonium bromide to the solution while stirring. Heat in a 40-50°C oil bath for 20-60 min to ensure complete dissolution. Immediately inject 60-500 µL of 0.8-4.4 M nitric acid. Stir the reaction in a 40-50°C oil bath for 10-16 h. Cool naturally to room temperature. Collect the product by centrifugation, wash it 2-5 times with ultrapure water, and disperse it in 1-10 mL of ultrapure water to obtain an Ag2S dispersion.

[0047] 2-2. Mix 0.1-2 mL of Ag2S dispersion with 0.1-2 mL of 1 μM tDNA1 (HA) solution. Incubate with gentle shaking at 0-4°C for 8-16 h. Collect by centrifugation to obtain Ag2S-tDNA1 bioconjugate. Block nonspecific active sites of the obtained Ag2S-tDNA1 bioconjugate with 1 mM MCH. After washing, disperse in 0.1-2 mL of 1× TAE buffer solution and set aside.

[0048] Step 3: Preparation of signal unit CuO@PMo 12 -tDNA2, including the following steps:

[0049] 3-1. Synthesis of CuO: Dissolve 0.2-2 g of copper nitrate trihydrate and 0.4-2 g of polyvinylpyrrolidone in 20-200 mL of methanol with stirring to obtain a transparent blue solution. Then, add 20-200 mL of methanol solution containing 0.1-1.6 g of trimesic acid dropwise to the above solution to form a blue colloidal dispersion. Stir at room temperature for 5-30 min, then stop stirring and age at room temperature for 12-36 h to obtain a blue precipitate. Collect the precipitate by centrifugation, wash it 2-5 times with methanol, dry it in an oven at 60°C, and then heat it to 250-400°C in air at a rate of 1°C / min and hold it for 0.5-3 h to obtain CuO.

[0050] 3-2.CuO@PMo 12 Preparation: 0.01~1 g CuO was dispersed in 5~200 mL methanol, ultrasonicated for 20 min, and then mixed with 5~200 mL of methanol containing 0.01~1 g PMo 12 The mixture was mixed with methanol solution, stirred at room temperature for 12-24 h, and the product was collected by centrifugation to obtain CuO@PMo 12 , washed with methanol and ultrapure water, and finally dispersed in 5~200 mL of water for later use;

[0051] 3-3. Signal unit CuO@PMo 12 Preparation of tDNA2: 0.1~2 mL of 1 μM tDNA2 (RBD) solution was mixed with 0.1~2 mL of CuO@PMo 12 The dispersions were mixed, gently shaken and incubated at 0-4 °C for 8-16 h, and collected by centrifugation to obtain CuO@PMo 12 -tDNA2 bioconjugate, the obtained CuO@PMo 12 Block nonspecific active sites of the tDNA2 bioconjugate with 1 mM MCH, wash, and then disperse in 0.1–2 mL of 1 × TAE buffer for later use.

[0052] Step 4: Construction of photoelectrochemical biosensor:

[0053] 10~300 μL of Co / NC@CdS-TDN-Apts dispersion was incubated with the test substance at room temperature for 12~50 min, magnetic separation and washing were performed, and then 10~300 μL of Ag2S-tDNA1 dispersion and 10~300 μL of CuO@PMo were added. 12-tDNA2 dispersion was incubated for 12-50 min to obtain the incubated magnetic conjugate, which was then dispersed in 10-300 μL of ultrapure water. Finally, 4-12 μL of the obtained dispersion was dropped onto a clean MITO electrode to obtain a photoelectrochemical biosensor.

[0054] The sequence of S1 is (5'-3'): ACATTCCTAAGTCTGAAACATTACAGCTTGC TA CACGAGAAGAGCCGCCATAGTATTTTTTTTTTTGTCCATTAACGCCC, as shown in SEQ ID NO: 1;

[0055] The sequence of S2 is (5'-3'): TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTA ATAGATGCGAGGGTCCAATACTTTTTTTTTTTGCGCCGAGGTGATG, as shown in Sequence 2;

[0056] The sequence of S3 is (5'-3'): TCAACTGCCTGGTGATAATACGACACTACGTGGGAATCTACTATGGCGGCTCTTC, as shown in Sequence 3;

[0057] The sequence of S4 is (5'-3'): SH-(CH2)6-TTCAGACTTAGGAATGTGCTTCCCACG

[0058] TAGT GTCGTTTGTATTGGACCCTCGCAT, as shown in SEQ ID NO: 4;

[0059] The sequence of the HA aptamer is (5'-3'): TACTGCACACGACACCGACTGTCAC CATCACCTCGGCGCA, as shown in Sequence 5;

[0060] The sequence of the RBD aptamer is (5'-3'): CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATGGACA, as shown in SEQ ID NO: 6;

[0061] The sequence of tDNA1 (HA) is (5'-3'): SH-(CH2)6-CATCACCTCGGCGCA, as shown in Sequence 7.

[0062] The sequence of tDNA2 (RBD) is (5'-3'): SH-(CH2)6-GGGCGTTAATGGACA, as shown in Sequence 8.

[0063] The present invention is further described in detail below with reference to specific embodiments.

[0064] Example 1 Preparation of capture unit Co / NC@CdS-TDN-Apts

[0065] Synthesis of magnetic Co / NC: 3.0 g of cobalt nitrate hexahydrate and 6.5 g of 2-methylimidazole were dissolved in 200 mL of methanol respectively. The two solutions were quickly mixed and vigorously stirred at room temperature for 3 h. After that, they were collected by centrifugation and washed with ethanol to obtain cobalt-based zeolite imidazolate framework ZIF-67, which was vacuum dried at 60 °C and then heated to 300 °C at a rate of 5 °C / min under N2 atmosphere and maintained for 30 min, and then heated to 550 °C and maintained for 7.5 h to obtain magnetic cobalt nanoparticles / nitrogen-doped porous carbon material (Co / NC).

[0066] Synthesis of Co / NC@CdS: Co / NC@CdS was prepared by the SILAR method. Briefly, 20 mg of Co / NC was dispersed in 0.1 M cadmium ions (Cd 2+ ) methanol solution for 2 min and washed with methanol, and then dispersed in 0.1 M sulfide ion (S 2- ) in methanol / water (1:1, v / v) for 2 min and washed with methanol. After 5 SILAR cycles, Co / NC@CdS was obtained, which was washed with methanol and ultrapure water, magnetically separated, and finally dispersed in 2 mL of ultrapure water to obtain Co / NC@CdS dispersion.

[0067] Preparation of Co / NC@CdS-TDN conjugates: Equimolar amounts of four DNA single strands (S1, S2, S3, and S4) were heated at 95°C for 10 minutes and then rapidly cooled to 4°C to synthesize tetrahedral DNA (TDN). 1 mL of the TDN solution was then mixed with 1 mL of the Co / NC@CdS dispersion at 4°C overnight and washed three times with 1× TAE buffer to obtain Co / NC@CdS-TDN. To block nonspecific binding, the resulting Co / NC@CdS-TDN was dispersed in 1× TAE buffer containing 1 mM MCH and incubated at room temperature for 1 hour. Finally, the resulting Co / NC@CdS-TDN was washed three times by magnetic separation and then dispersed in 1 mL of 1× TAE buffer to obtain the Co / NC@CdS-TDN dispersion.

[0068] Preparation of Co / NC@CdS-TDN-Apts conjugate: The aptamer solutions of HA and RBD were heated at 90°C for 10 min to unfold their sequences, cooled to room temperature, and then mixed with Co / NC@CdS-TDN dispersion in a 37°C water bath and kept for 120 min to allow the cantilever end of TDN to hybridize with the aptamer. The conjugate was then washed three times with 1× TAE buffer solution to remove unhybridized aptamer to obtain Co / NC@CdS-TDN-Apts conjugate. Finally, it was dispersed in 1 mL of 1× TAE buffer solution for later use.

[0069] The morphology and XRD phase characterization of Co / NC@CdS are shown in Figure 2. Figure 1 shown.

[0070] The synthesis diagram of tetrahedral DNA (TDN) is shown in Figure 2 .

[0071] Example 2 Signal Unit Ag2S-tDNA1 and CuO@PMo 12 Preparation of tDNA2

[0072] 1. Preparation of the signal unit Ag2S-tDNA1, comprising the following steps:

[0073] Synthesis of Ag2S: Silver nitrate aqueous solution (24 mM, 30 mL) was added dropwise to a 100 mL round-bottom flask containing sodium thiosulfate aqueous solution (43.2 mM, 30 mL). Cetyltrimethylammonium bromide (3.6 mmol) was quickly added under stirring and heated in a 45 °C oil bath for 30 min to ensure complete dissolution. Nitric acid (1.4 M, 120 µL) was then immediately injected into the flask and stirred in a 45 °C oil bath for 12.5 h. Finally, the round-bottom flask was removed and naturally cooled to room temperature. The product was collected by centrifugation, washed several times with ultrapure water, and dispersed in 5 mL of ultrapure water for later use.

[0074] The morphology and XRD phase characterization of Ag2S are shown in Figure 2. Figure 3 shown.

[0075] Preparation of the signal unit Ag2S-tDNA1: 1 mL of Ag2S dispersion was mixed with 1 mL of tDNA1 solution (1 μM) and incubated at 4°C with gentle shaking for 12 h. The obtained Ag2S-tDNA2 bioconjugate was collected by centrifugation and nonspecific active sites were blocked with 1 mM MCH. The bioconjugate was washed and finally dispersed in 1 mL of 1 × TAE buffer solution for later use.

[0076] 2. Signal unit CuO@PMo 12 -tDNA2 preparation, including the following steps:

[0077] Synthesis of CuO: 0.785 g of copper nitrate trihydrate and 1.2 g of polyvinylpyrrolidone were dissolved in 50 mL of methanol with stirring to yield a clear blue solution. A 50 mL methanol solution containing 0.43 g of trimesic acid was then added dropwise to the solution using a syringe to form a blue colloidal dispersion. After stirring at room temperature for 20 minutes, the mixture was allowed to age at room temperature for 24 hours. The resulting blue precipitate was collected by centrifugation, washed several times with methanol, and finally dried in an oven at 60°C. The resulting blue product was heated in air at a rate of 1°C / min to 300°C and held for 2 hours to yield CuO.

[0078] CuO@PMo 12 Synthesis: 0.1 g CuO was dispersed in 50 mL methanol and ultrasonicated for 20 min. 12 The mixture was mixed with 0.1 g methanol solution and stirred at room temperature for 16 h. The product was collected by centrifugation, washed with a large amount of methanol and ultrapure water, and finally dispersed in 50 mL of water for later use.

[0079] Signal unit CuO@PMo 12 Preparation of tDNA2: tDNA2 solution (1 μM, 1 mL) was mixed with CuO@PMo 12 The dispersion (1 mL) was mixed and gently shaken at 4 °C for 12 h to obtain CuO@PMo 12 The -tDNA2 bioconjugate was collected by centrifugation and nonspecific active sites were blocked with 1 mM MCH, washed and finally dispersed in 1 mL of 1 × TAE buffer solution for use.

[0080] Example 3 HA Detection

[0081] For HA detection, 30 μL of the Co / NC@CdS-TDN-Apts dispersion prepared in Example 1 was incubated with various concentrations of HA at room temperature for 15 minutes, followed by magnetic separation and cleaning. Then, 30 μL of the Ag2S-tDNA1 dispersion prepared in Example 2 was added and incubated for 15 minutes. The magnetic conjugate was then magnetically separated and cleaned and redispersed in 30 μL of ultrapure water. Finally, 10 μL of the resulting dispersion was dropped onto a clean MITO electrode to obtain a magnetic conjugate-modified MITO electrode for further photoelectrochemical detection.

[0082] Example 4 RBD Detection

[0083] For RBD determination, 30 μL of the Co / NC@CdS-TDN-Apts dispersion prepared in Example 1 was incubated with different concentrations of RBD at room temperature for 15 min, followed by magnetic separation and washing. Then, 30 μL of the CuO@PMo prepared in Example 2 was added. 12 The tDNA2 dispersion was incubated for 15 minutes. The magnetic conjugate was then cleaned by magnetic separation and redispersed in 30 μL of ultrapure water. Finally, 10 μL of the resulting dispersion was dropped onto a clean MITO electrode to obtain a magnetic conjugate-modified MITO electrode for further photoelectrochemical detection.

[0084] Example 5 RBD Identification

[0085] For RBD identification, 30 μL of the Co / NC@CdS-TDN-Apts dispersion prepared in Example 1 was incubated with the sample at room temperature for 15 min, followed by magnetic separation and washing. Then, 30 μL of the Ag2S-tDNA1 dispersion prepared in Example 2 and 30 μL of CuO@PMo were added. 12 The tDNA2 dispersion was incubated for 15 minutes. The magnetic conjugate was then cleaned by magnetic separation and redispersed in 30 μL of ultrapure water. Finally, 10 μL of the resulting dispersion was dropped onto a clean MITO electrode to create a photoelectrochemical biosensor for further photoelectrochemical detection.

[0086] Example 6 Feasibility Experiment

[0087] According to the construction steps of Examples 1, 2, 3 and 4 above, four modified electrodes were prepared by adsorbing magnetic conjugates using MITO: bare MITO (a), Co / NC@CdS-TDN-Apts / MITO (b), Co / NC@CdS-TDN-tDNA1-Ag2S (c), Co / NC@CdS-TDN-tDNA2-CuO@PMo 12 (d) Detection of the photocurrent response of the four modified electrodes. The results are as follows Figure 4 , it can be seen that the presence of HA enhances the photocurrent signal of the magnetic conjugate, and the presence of RBD induces a reversal of the photocurrent polarity of the magnetic conjugate. These results demonstrate that the sensor has a good photoelectrochemical response to HA and RBD and can be applied to the detection of HA / RBD.

[0088] Example 7 Detection of HA

[0089] A MITO-modified electrode was constructed according to the steps of Examples 1, 2, and 3 above. This electrode was used as the working electrode, a calomel electrode as the reference electrode, a platinum column electrode as the counter electrode, and Tris-HCl (0.1 M, pH 7.4) as the detection buffer. Photoelectrochemical detection was performed using the current-time method at a potential of -0.1 V. The photocurrent response of the magnetic conjugate after homogeneous reaction recognition was measured by varying the HA concentration from 0.05 to 10,000 pg / mL. The results are shown in Figure 2. Figure 5 The photocurrent response change of the sensor to HA has a good linear relationship with its concentration. The linear correlation equation of the photocurrent response change to HA concentration is y=58.1lgC HA +85.4, r=0.9954, the linear range was 0.05~1000 pg / mL, and the detection limit was 18 fg / mL, indicating that the sensor achieved highly sensitive detection of HA.

[0090] Example 8 Detection of RBD

[0091] A MITO-modified electrode was constructed according to the steps of Examples 1, 2, and 4 above. This electrode was used as the working electrode, a calomel electrode as the reference electrode, a platinum column electrode as the counter electrode, and Tris-HCl (0.1 M, pH 7.4) as the detection buffer. Photoelectrochemical detection was performed using the current-time method at a potential of -0.1 V. The photocurrent response of the magnetic conjugate after homogeneous reaction recognition was measured by varying the RBD concentration (0.001 to 10,000 pg / mL). The results are shown in Figure 2. Figure 6 The photocurrent response change of the sensor to RBD has a good linear relationship with its concentration. The linear correlation equation of the photocurrent response change to RBD concentration is y=163.2lgC RBD +770.1, r=0.9994, the linear range was 0.001~1000 pg / mL, and the detection limit was 0.4 fg / mL, indicating that the sensor achieved highly sensitive detection of RBD.

[0092] Example 9 Specificity Detection

[0093] To verify the specificity of the sensor, MITO-modified electrodes were prepared according to the steps of Examples 1, 2, 3, and 4 above. The concentrations of the analytes and other proteins were the same. The abbreviations of the other antigens used are as follows: carcinoembryonic antigen (CEA), vascular endothelial growth factor (VEGF), prostate-specific antigen (PSA), and mucin 1 (MUC1).

[0094] According to the steps of Examples 1, 2 and 3 above, other proteins of the same concentration were used instead of HA for selective detection, and other proteins of the same concentration were mixed with HA for anti-interference detection. Figure 7As shown in Figure A, compared to HA, the introduction of other proteins did not cause a change in the photocurrent signal, remaining close to the blank signal, demonstrating that the device and method of the present invention exhibit good selectivity for HA detection. Furthermore, mixing other proteins with HA did not affect the photocurrent, demonstrating that the device and method of the present invention exhibit good anti-interference performance for the detection of the target HA.

[0095] According to the steps of Examples 1, 2, and 4 above, other proteins of the same concentration were used instead of RBD for selective detection, and other proteins of the same concentration were mixed with RBD for anti-interference detection. Figure 7 As shown in Figure B, compared to RBD, the introduction of other proteins did not cause a change in the polarity of the photocurrent signal, remaining close to the blank signal, demonstrating that the device and method of the present invention exhibit good selectivity for detecting RBD. Furthermore, mixing other proteins with RBD did not affect the polarity reversal of the photocurrent, demonstrating that the device and method of the present invention exhibit good anti-interference performance for detecting the target RBD.

[0096] Example 10 RBD Identification

[0097] In order to verify the sensor's ability to identify RBD, the sensor was constructed according to the steps of Examples 1, 2, 3, and 5 above and photoelectrochemical detection was performed with the same concentration of HA and RBD. Figure 7 As shown in Figure B, the binding of HA-induced Ag2S to the magnetic conjugate did not affect the polarity reversal of the RBD-induced photocurrent signal, proving that even in the presence of influenza virus, it would not affect the detection of the new coronavirus.

[0098] This invention designs a photoelectrochemical biosensor based on the specific binding of magnetic aptamers to analytes for the sensitive and selective detection of influenza virus protein HA and SARS-CoV-2 protein RBD. The method first uses a cobalt-based zeolite imidazolate framework (ZIF-67) with uniform size and large specific surface area as a precursor. This is then calcined under inert gas to form a magnetic cobalt nanoparticle / nitrogen-doped porous carbon material (Co / NC). The magnetic porous photoelectric material Co / NC@CdS is then synthesized using a continuous ion layer adsorption and reaction method. Self-assembled tetrahedral DNA (TDN) is then immobilized on the Co / NC@CdS via Cd-S bonds and bound to aptamers for the two analytes, HA and RBD. The self-assembled tetrahedral DNA (TDN) contains a thiol group and two cantilevers that can effectively capture the HA aptamer and the RBD aptamer, respectively, resulting in the capture unit Co / NC@CdS-TDN-Apts magnetic conjugate. Signal influencing factors are then introduced based on the specific binding of different aptamers to the analytes. The specific recognition between the aptamer and the analyte in Co / NC@CdS-TDN-Apts causes the aptamer to leave the Co / NC@CdS-TDN-Apts magnetic conjugate. 12 Single-stranded DNA on the tDNA2 (-tDNA2) hybridized with the cantilever end of the TDN, causing an increase in the photocurrent signal (polarity reversal) of the magnetic conjugate. Importantly, when HA and RBD coexisted, the magnetic conjugate also exhibited a significant cathodic photocurrent, indicating that the presence of HA did not affect RBD recognition. Therefore, the designed photoelectrochemical biosensor was able to sensitively and selectively detect HA and RBD. The proposed photoelectrochemical biosensor shows great potential for differential diagnosis of patients.

[0099] Of course, the above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Changes, modifications, additions, or substitutions made by those skilled in the art within the spirit and scope of the present invention should also fall within the scope of protection of the present invention.

Claims

1. A method for constructing a photoelectrochemical biosensor, comprising the following steps: 1) The capture unit Co / NC@CdS-TDN-Apts magnetic conjugate was prepared using the magnetic porous optoelectronic material Co / NC@CdS, tetrahedral DNA, HA aptamer and RBD aptamer; 2) Preparation of signal unit Ag2S-tDNA1; 3) Preparation of signal unit CuO@PMo 12 -tDNA2; 4) After the capture unit Co / NC@CdS-TDN-Apts magnetic conjugate is incubated with the analyte, the signal unit Ag2S-tDNA1 and CuO@PMo are added. 12 -tDNA2 incubation to obtain an incubated magnetic conjugate, and using the incubated magnetic conjugate to modify a magnetic indium tin oxide (MITO) electrode to obtain a photoelectrochemical biosensor; In step 1), the preparation of the capture unit Co / NC@CdS-TDN-Apts magnetic conjugate includes fixing tetrahedral DNA on the surface of Co / NC@CdS via Cd-S bonds to obtain Co / NC@CdS-TDN, and then binding the cantilever end of TDN on the Co / NC@CdS-TDN to the HA aptamer and the RBD aptamer through base complementary pairing to obtain the Co / NC@CdS-TDN-Apts magnetic conjugate; The Co / NC@CdS is prepared by a continuous ion layer adsorption and reaction method of magnetic cobalt nanoparticles / nitrogen-doped porous carbon material Co / NC in a cadmium ion and sulfur ion solution. The Co / NC is obtained by calcining a cobalt-based zeolite imidazolate framework ZIF-67. The specific process is as follows: ZIF-67 is heated to 300-350°C at a rate of 5°C / min under a nitrogen atmosphere and maintained for 30-120 minutes, and then heated to 510-800°C and maintained for 2-10 hours to obtain Co / NC. In step 2), the signal unit Ag2S-tDNA1 is prepared by incubating an Ag2S solution and a tDNA1 solution at 0-4°C for 8-16 hours; In step 3), the signal unit CuO@PMo 12 -tDNA2 by CuO@PMo 12 The solution and tDNA2 solution were incubated at 0-4°C for 8-16 h to prepare the CuO@PMo 12 Preparation: CuO was ultrasonically dispersed in methanol and mixed with PMo 12 The methanol solution was mixed and stirred at room temperature for 12-24 h to obtain CuO@PMo 12 ; The HA aptamer is an influenza A (H1N1) virus hemagglutinin protein aptamer; the RBD aptamer is a novel coronavirus spike protein receptor binding domain aptamer.

2. The construction method according to claim 1, characterized in that The ZIF-67 is prepared by reacting a cobalt nitrate hexahydrate solution and a 2-methylimidazole solution at room temperature.

3. The construction method according to claim 1, characterized in that The preparation of the tetrahedral DNA comprises the following steps: heating equimolar amounts of four DNA single strands S1, S2, S3, and S4 at 89-98° C. for 5-12 minutes, and then rapidly cooling to 0-4° C. to obtain the tetrahedral DNA.

4. A photoelectrochemical biosensor constructed according to the construction method according to any one of claims 1 to 3.

5. An application of the photoelectrochemical biosensor according to claim 4 in building a system for detecting influenza and novel coronavirus.

Images