MicroRNAs as molecular markers for non-invasive prenatal screening of neural tube defects and their application

By detecting hsa-miR-223, hsa-miR-187 and hsa-let-7d miRNAs in the blood of pregnant women, the problem of non-invasive diagnosis of neural tube defects in early pregnancy has been solved, efficient and accurate prenatal screening and diagnosis have been achieved, and the disability rate of neural tube defects has been reduced.

CN116716396BActive Publication Date: 2025-09-16SHENGJING HOSPITAL OF CHINA MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310763600.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-27
Publication Date
2025-09-16
Estimated Expiration
2043-06-27

AI Technical Summary

Technical Problem

Existing technologies make it difficult to accurately and non-invasively diagnose neural tube defects in early pregnancy. Ultrasound examinations rely on operational experience and maternal alpha-fetoprotein is easily affected by other factors. There is a lack of effective molecular markers for prenatal screening.

Method used

Three miRNAs, hsa-miR-223, hsa-miR-187 and hsa-let-7d, are used as molecular markers. High-throughput omics technology is used to detect blood samples from pregnant women. Combined with chips, kits, test strips and high-throughput sequencing platforms, early non-invasive diagnosis of neural tube defects can be achieved.

Benefits of technology

It provides a highly accurate and sensitive prenatal screening method for neural tube defects, which can detect fetal abnormalities at an early stage, reduce the disability rate, and improve the objectivity and reliability of diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116716396B_ABST
    Figure CN116716396B_ABST
Patent Text Reader

Abstract

The present invention discloses microRNAs as molecular markers for noninvasive prenatal screening of neural tube defects (NTDs) and their applications, belonging to the field of pharmaceutical biotechnology. The invention provides molecular markers for noninvasive prenatal diagnosis of NTDs and their applications. The molecular markers, composed of one or more miRNAs, hsa-miR-223, hsa-miR-187, and hsa-let-7d, can be used for prenatal screening of NTDs, providing new targets for treatment and possessing significant clinical significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceutical biotechnology, and specifically relates to microRNAs as molecular markers for non-invasive prenatal screening of neural tube defects and applications thereof. Background Art

[0002] Neural tube defects (NTDs), a common and major birth defect in my country, are congenital malformations caused by incomplete closure of the neural tube during embryonic development. They are associated with extremely high mortality and disability rates, primarily including anencephaly, encephalocele, and spina bifida. Although the incidence of NTDs has decreased with the widespread use of prenatal care and folic acid supplementation, as well as advances in prenatal correction and repair surgery, a series of postoperative complications still impose a multifaceted burden on the individual, their family, and society as a whole. Therefore, developing early, noninvasive diagnostic methods for neural tube defects, enabling effective diagnosis before severe structural abnormalities or irreversible damage develop in the fetus, and enabling early intervention, is crucial for reducing the disability rate associated with these defects and improving population quality.

[0003] Currently, clinical prenatal diagnosis of NTDs primarily relies on mid-pregnancy fetal ultrasound examinations combined with maternal serum alpha-fetoprotein levels. However, ultrasound examinations can only detect NTDs after the defect has formed, and their diagnostic accuracy is highly dependent on the operator's experience and the quality of the equipment. Maternal alpha-fetoprotein levels are also susceptible to other diseases and factors. Therefore, exploring objective and accurate methods for the early diagnosis of NTDs is extremely important and provides a basis for early consultation and treatment. Maternal serum testing is a non-invasive prenatal diagnostic method that is easily accepted by pregnant women and suitable for large-scale prenatal screening. Therefore, many scholars at home and abroad are committed to the discovery of new diagnostic markers, but to date, there are no diagnostic molecular markers for early-pregnancy neural tube defects that have been clinically applied.

[0004] With the rapid development of various omics technologies in recent years, a series of new technologies have been integrated into high-throughput omics research. Omics technologies have played a significant role in the discovery of biomarkers for congenital malformations by detecting dynamic molecular changes in multiple systems, from single subcellular components to large-scale biological networks. The microRNA (miRNA) transcriptome is the sum of all miRNAs produced by cells at specific physiological or developmental stages. MiRNAs circulating in maternal blood offer the potential for early diagnosis of pregnancy-related diseases. High-throughput omics technologies can fully consider both maternal and fetal factors, screen key molecules with significant changes from a complex set of genes, and comprehensively analyze their patterns of change. This will facilitate the identification of molecular markers for early disease diagnosis and prognosis, and is a future trend in translating complex molecular markers into clinical applications. Summary of the Invention

[0005] In response to the above problems, the purpose of the invention is to provide molecular markers and their applications for the non-invasive prenatal diagnosis of NTDs fetuses. The molecular markers are composed of three miRNAs: hsa-miR-223, hsa-miR-187 and hsa-let-7d, which can be used for prenatal screening of neural tube defects and provide new targets for the treatment of neural tube defects.

[0006] In order to achieve the above objectives, the present invention provides the following technical solutions.

[0007] The present invention provides a use of a reagent for detecting the content of a molecular marker in the preparation of a product for prenatal screening, early warning, and diagnosis of NTDs fetuses, characterized in that the molecular marker is composed of one or more miRNAs selected from the group consisting of hsa-miR-223, hsa-miR-187, and hsa-let-7d.

[0008] Furthermore, the products include reagents, kits, chips, test strips, high-throughput sequencing platforms, polymerase chain reaction, nuclease protection analysis, in situ hybridization, nucleic acid microarrays, Northern blotting or chip detection related methods.

[0009] Furthermore, the product test sample is a blood sample from a pregnant woman.

[0010] Furthermore, the reagent for detecting the content of one or more of hsa-miR-223, hsa-miR-187 and hsa-let-7d is a reagent that specifically recognizes or amplifies one or more of hsa-miR-223, hsa-miR-187 and hsa-let-7d.

[0011] Furthermore, the reagent for detecting one or more of hsa-miR-223, hsa-miR-187 and hsa-let-7d is a specific probe or primer for one or more of hsa-miR-223, hsa-miR-187 and hsa-let-7d.

[0012] The present invention also provides a tool for prenatal screening, early warning and diagnosis of NTDs fetuses, which can detect the expression levels of the above-mentioned miRNAs.

[0013] Furthermore, the tool comprises one or more miRNAs capable of quantifying the non-invasive prenatal diagnosis molecular markers for NTDs, including hsa-miR-223, hsa-miR-187, and hsa-let-7d.

[0014] Furthermore, the tools for prenatal screening, early warning and diagnosis of NTDs fetuses include chips, kits, test strips and high-throughput sequencing platforms.

[0015] The present invention also provides a method for prenatal screening, early warning and diagnosis of neural tube defects, which comprises the following steps.

[0016] (1) Serum samples were obtained from subjects. Total RNA isolated from maternal serum was dephosphorylated and ligated with pCp-Cy3. Labeled RNA was purified and hybridized to a miRNA array containing 887 human mature miRNA probes according to Sanger miRBase release 14.0. The array was cleaned and scanned using an Agilent microarray scanner, and the intensity of each hybridization signal was extracted and evaluated. A preliminary screening of miRNA molecular markers was performed in the serum of pregnant women with NTD fetuses.

[0017] (2) The present invention further expanded the sample verification, namely, using real-time quantitative PCR to verify the expression of three hsa-miR-223, hsa-miR-187 and hsa-let-7d in maternal serum.

[0018] (3) The present invention uses ROC curve analysis to evaluate its clinical application value in diagnosing fetal NTDs, and prepares a tool for prenatal screening, early warning, and clinical diagnosis of fetuses with neural tube defects.

[0019] The PCR method described in the present invention is a known method, and is detected by using RT-PCR (reverse transcriptase-PCR) method and in situ RT-PCR method.

[0020] The primers and probes in the present invention are prepared by chemical synthesis, and are appropriately designed by referring to known information using a method known to those skilled in the art, and prepared by chemical synthesis.

[0021] The kit of the present invention may also include reagents for extracting nucleic acids, reagents for PCR, reagents for staining or developing, etc. For example, these reagents include but are not limited to: extraction solution, amplification solution, hybridization solution, color development solution, washing solution, etc.

[0022] The sample of the present invention comes from the blood of a pregnant woman.

[0023] The present invention provides a tool for prenatal screening, early warning and diagnosis of NTDs fetuses, which can detect the expression levels of the above-mentioned miRNAs.

[0024] The high-throughput sequencing platform in this invention is a specialized tool that analyzes disease-related abnormal genes by comparing gene expression profiles between disease patients and healthy controls. Therefore, identifying differentially expressed molecules associated with NTDs through high-throughput sequencing represents a novel application of this invention and is also within its scope.

[0025] In the present invention, prenatal screening, early warning and diagnosis of NTDs in the fetus include determining whether the fetus of the subject exhibits an NTDs phenotype and determining whether the fetus of the subject is at risk of developing NTDs.

[0026] Compared with the prior art, the present invention has the following beneficial effects.

[0027] The present invention discovered and confirmed for the first time that abnormal expression of hsa-miR-223, hsa-miR-187 and hsa-let-7d in the blood of pregnant women is closely correlated with the occurrence of NTDs in the fetus. The sample size for verification is large and the results are accurate.

[0028] The present invention provides miRNA markers related to non-invasive prenatal diagnosis of NTDs, provides miRNA prenatal diagnosis or risk monitoring services for fetuses, and sells diagnostic and prognostic consulting services to hospitals and clinics in a collaborative or independent manner.

[0029] The miRNA markers for non-invasive prenatal diagnosis of miRNAs provided by the present invention provide a new approach for prenatal screening, early warning and diagnosis of NTDs. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Cluster analysis and KEGG analysis of differentially expressed miRNAs with a fold difference greater than 1.5. (A) Heat map of cluster analysis of differentially expressed miRNAs between the NTDs group and the control group. (B) Bubble plot of KEGG functional enrichment analysis of differentially expressed miRNAs between the NTDs group and the control group.

[0031] Figure 2 Expression of hsa-miR-223, hsa-miR-187, and hsa-let-7d in the serum of pregnant women with fetuses with NTDs and normal fetuses.

[0032] Figure 3 ROC curve analysis results of hsa-miR-223, hsa-miR-187 and hsa-let-7d. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below with reference to the accompanying figures and examples. The following examples are intended to illustrate the present invention only and are not intended to limit its scope. Experimental methods not specified in the examples were generally performed under conventional conditions or according to the manufacturer's recommendations. Maternal peripheral blood samples were obtained from the Shengjing Birth Cohort sample library and were approved by the Ethics Committee of Shengjing Hospital Affiliated to China Medical University (Approval No.: 2017PS264K).

[0034] Example 1: The miRNA chip technology was used to screen differentially expressed miRNAs in the peripheral blood of pregnant women with NTDs and perform bioinformatics analysis.

[0035] 1. Separate serum.

[0036] Collect whole blood samples in a coagulant tube, gently invert and mix, use a 4°C low-temperature centrifuge, centrifuge at 1600×g for 10 minutes, collect the supernatant (serum) into a new EP tube, centrifuge at 16000×g for 10 minutes to remove cell debris, and divide the serum into multiple centrifuge tubes and freeze in a -80°C low-temperature refrigerator.

[0037] 2. miRNA chip detection and bioinformatics analysis.

[0038] Three age- and gestational-age-matched pregnant women with fetuses with NTDs and three pregnant women with healthy fetuses were enrolled. Serum was isolated and extracted, and total RNA isolated from maternal serum was dephosphorylated and ligated with pCp-Cy3. Labeled RNA was purified and hybridized to a miRNA array containing 887 human mature miRNA probes according to SangermiRBase release 14.0. The array was washed and scanned using an Agilent microarray scanner, and the intensity of each hybridized signal was extracted and evaluated. In-depth bioinformatics analysis was performed to identify miRNA markers for prenatal diagnosis in the serum of pregnant women with fetuses with NTDs.

[0039] 3. Differential miRNAs screened by miRNA chip.

[0040] In a miRNA array containing 887 human mature miRNA probes, 104 and 156 miRNAs were detected in the serum of NTDs and controls, respectively. Differentially expressed miRNAs were screened based on a fold change of at least 1.5 and p < 0.05. Twenty-one miRNAs were downregulated in NTDs, while seven were upregulated.

[0041] 4. Cluster analysis of differentially expressed miRNAs.

[0042] This project used a hierarchical clustering algorithm to perform cluster analysis on 28 miRNAs with a 1.5-fold difference in the miRNA chip results, and displayed the data in the form of a heat map, revealing significant differences in expression patterns between the NTDs group and the control group ( Figure 1 A).

[0043] 5. Functional enrichment analysis of differentially expressed miRNA target genes.

[0044] KEGG pathway analysis revealed that the target genes of differentially expressed miRNAs were mainly involved in important biological processes that may be related to neurological diseases, such as Pathways of neurodegeneration and Transcriptional misregulation ( Figure 1 B).

[0045] Example 2 validates the diagnostic efficacy of hsa-miR-223, hsa-miR-187, and hsa-let-7d as molecular markers in a validation set.

[0046] 1. Include the research sample.

[0047] A total of 30 pregnant women with healthy fetuses and 30 pregnant women with NTDs fetuses were included in the validation set. Their clinical characteristics are shown in Table 1. Serum was isolated according to the method in Example 1.

[0048] Table 1. Clinical characteristics of pregnant women used for qRT-PCR testing.

[0049]

[0050] 2. Design and synthesis of miRNA primers and real-time quantitative PCR were used to detect the expression of miRNA (miR-223, miRNA-187 and let-7d).

[0051] MiRNA primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. based on the target gene sequences. U6 was selected as the housekeeping gene. RNA was extracted using the mirVana PARIS kit (Ambion) and reverse transcribed using the PrimeScript RT reagent kit (Takara). Real-time quantitative PCR was performed using the SYBR Premix Ex Taq kit (Takara), using U6 as an internal control. The expression of hsa-miR-223, hsa-miR-187, and hsa-let-7d was measured in the serum of 30 pregnant women with NTDs and 10 healthy controls. The primer sequences are as follows: hsa-miR-223 F chain is GTCAGTTGTCAAATACCCC, and R chain is GCTGTCAACGATACGCTACG; hsa-miR-187 F chain is GCTACAACACAGGACCCGGGC, and R chain is GCTGTCAACGATACGCTACG; hsa-let-7d F chain is GCAGAGGTAGTAGGTTGCATAGTT, and R chain is GCTGTCAACGATACGCTACG. The test results showed that the expression level of hsa-miR-223 in the serum of mothers of NTD fetuses was significantly decreased, while the expression levels of hsa-miR-187 and hsa-let-7d in the serum of mothers of NTD fetuses were significantly increased, with statistical differences compared with the normal pregnant group ( Figure 2 ).

[0052] 3. Draw the ROC curve.

[0053] ROC curve analysis showed that the areas under the ROC curves of hsa-miR-223, hsa-miR-187, and hsa-let-7d for the diagnosis of NTDs were 0.708, 0.688, and 0.728, respectively. p <0.05). The areas under the ROC curves of the three miRNAs combined to diagnose NTDs were 0.834, p <0.01. The results showed that hsa-miR-223, hsa-miR-187 and hsa-let-7d can be used as molecular markers for prenatal diagnosis of NTDs ( Figure 3 , Table 2).

[0054] Table 2. ROC analysis of the diagnostic ability of miRNAs in maternal serum for NTDs and control fetuses.

[0055]

[0056] AUC: area under the ROC curve; CI: confidence interval.

[0057] In summary, the present invention provides molecular markers for non-invasive prenatal diagnosis of NTDs and their applications, which can be used for prenatal screening of neural tube defects and provide new targets for the treatment of neural tube defects, which has great clinical significance.

Claims

1. Use of a reagent for detecting the expression of molecular markers in the preparation of a product for prenatal diagnosis of NTDs, characterized in that: The molecular markers are composed of three miRNAs: hsa-miR-223, hsa-miR-187 and hsa-let-7d; the reagents for detecting the three miRNAs: hsa-miR-223, hsa-miR-187 and hsa-let-7d are specific primers, and the primer sequences are as follows: the F chain of hsa-miR-223 is GTCAGTTGTCAAATACCCC, and the R chain is GCTGTCAACGATACGCTACG; the F chain of hsa-miR-187 is GCTACAACACAGGACCCGGGC, and the R chain is GCTGTCAACGATACGCTACG; the F chain of hsa-let-7d is GCAGAGGTAGTAGGTTGCATAGTT, and the R chain is GCTGTCAACGATACGCTACG.

2. The use according to claim 1, characterized in that The product is a test kit.

3. The use according to claim 1, characterized in that The product is a chip.