An autonomous dynamic regulation method for improving the production performance of 2'-fucosyllactose

Abstract

The present invention discloses an autonomous dynamic regulation method for improving the production performance of 2'-fucosyllactose, belonging to the technical field of bioengineering. By expressing an expression cassette for autonomously and dynamically regulating citrate synthase GltA and freely expressing genes related to the 2'-fucosyllactose synthesis pathway, the present invention successfully constructs an engineering strain with high-yield production of 2'-fucosyllactose. In addition, this method has a simple design and can regulate the carbon flux by inhibiting cell growth during the stationary phase. By constructing an engineering strain for 2'-fucosyllactose production and introducing the autonomous dynamic regulation method, after 72 h of fermentation, the yield and production intensity of 2'-fucosyllactose reach 31.3 g / L and 0.43 g / L / h respectively. It has a good application prospect and the potential for industrial application.

Description

Technical Field

[0001] The present invention relates to an autonomous dynamic regulation method for improving the production performance of 2'-fucosyllactose, belonging to the technical field of bioengineering. Background Art

[0002] 2'-Fucosyllactose (2’-FL), as an important component of human milk oligosaccharides, has been widely used in the addition of infant formula milk powder and plays a role in regulating the intestinal flora and immune system. Due to the advantages of being green, sustainable, and having mild conditions, microbial fermentation is widely used in the production of compounds such as chemicals, functional nutraceuticals, and biofuels.

[0003] Therefore, microbial metabolic engineering based on systems biology and synthetic biology methods has become an important means for constructing 2'-fucosyllactose cell factories, which significantly improves the synthesis efficiency of target products through rational design of metabolic pathways, global optimization of metabolic networks, and dynamic reconstruction of regulatory networks. Traditional metabolic engineering strategies mainly include overexpression of rate-limiting enzymes, knockout of competing pathways, alteration of the catalytic properties of key enzymes, and regulation of cofactor content. Although these methods can significantly increase the product yield and production intensity, they are prone to causing imbalances in metabolic pathways and metabolic networks, ultimately leading to a decrease in product synthesis efficiency. Currently, the research on microbial synthesis of 2'-fucosyllactose mainly focuses on the static regulation of local pathways, and there is no relevant research on globally modular and dynamically regulating the 2'-fucosyllactose synthesis metabolic network. Summary of the Invention

[0004] The present invention uses CRISPRi technology to analyze the carbon flux competition between 2'-fucosyllactose synthesis and cell growth; by developing an autonomous dynamic function system, it realizes the simultaneous regulation of the 2'-fucosyllactose synthesis pathway and the cell growth pathway, which will enrich and develop the theory and practice of the design and construction of dynamic regulatory elements, and provide new ideas for dynamically balancing complex microbial metabolic networks ( Figure 2 )

[0005] The first object of the present invention is to provide a genetically engineered bacterium, which expresses an expression cassette for dynamically regulating the expression of citrate synthase GltA and freely expresses genes related to the 2’-fucosyllactose synthesis pathway; the expression cassette contains dCas9 regulated by a stationary-phase promoter and sgRNA regulated by a constitutive promoter; the genes related to the 2'-fucosyllactose synthesis pathway include the gene encoding phosphomannomutase ManB manB , the gene encoding mannosyl-1-phosphate guanylyltransferase ManC manC , the gene encoding GDP-mannose 4,6-dehydratase Gmd gmd, the gene encoding GDP-L-fucose synthase WcaG wcaG and the gene encoding fucosyltransferase FutC futC .

[0006] In one embodiment of the present invention, the nucleotide sequence of the gene encoding citrate synthase gltA is shown as SEQ ID NO.1.

[0007] In one embodiment of the present invention, the nucleotide sequence of the gene encoding phosphomannomutase manB is shown as SEQ ID NO.2.

[0008] In one embodiment of the present invention, the nucleotide sequence of the gene encoding mannose-1-phosphate guanylyltransferase manC is shown as SEQ ID NO.3.

[0009] In one embodiment of the present invention, the nucleotide sequence of the gene encoding GDP-mannose 4,6-dehydratase gmd is shown as SEQ ID NO.4.

[0010] In one embodiment of the present invention, the nucleotide sequence of the gene encoding GDP-L-fucose synthase wcaG is shown as SEQ ID NO.5.

[0011] In one embodiment of the present invention, the nucleotide sequence of the gene encoding fucosyltransferase futC is shown as SEQ ID NO.6.

[0012] In one embodiment of the present invention, the genetically engineered bacterium uses Escherichia coli as the host.

[0013] In one embodiment of the present invention, the genetically engineered bacterium co-expresses manB , manC , gmd , wcaG and futC .

[0014] In one embodiment of the present invention, the genetically engineered bacterium expresses the expression cassette for dynamically regulating the expression of citrate synthase GltA using the p-dCas9 plasmid as the vector.

[0015] In one embodiment of the present invention, the pJ01 vector is disclosed in the Chinese patent application text with the publication number CN 113929787 A.

[0016] In one embodiment of the present invention, the nucleotide sequence of the sgRNA is shown as SEQ ID NO.7.

[0017] In one embodiment of the present invention, an RBS is connected in front of the dCas9.

[0018] In one embodiment of the present invention, the stationary-phase promoter is selected from any one of pS60, pfic or pbolA.

[0019] In one embodiment of the present invention, the constitutive promoter is Pj23119.

[0020] In one embodiment of the present invention, the nucleotide sequence of the stationary-phase promoter pS60 is as shown in SEQ ID NO.8, the nucleotide sequence of pfic is as shown in SEQ ID NO.9, and the nucleotide sequence of pbolA is as shown in SEQ ID NO.10.

[0021] In one embodiment of the present invention, the nucleotide sequence of Pj23119 is as shown in SEQ ID NO.11.

[0022] In one embodiment of the present invention, the nucleotide sequence of the dCas9 is as shown in SEQ ID NO.12.

[0023] In one embodiment of the present invention, the nucleotide sequence of the RBS is as shown in SEQ ID NO.13.

[0024] The second object of the present invention is a method for producing 2'-fucosyllactose, which uses the above-mentioned genetically engineered bacteria for the fermentative production of 2'-fucosyllactose.

[0025] In one embodiment of the present invention, the fermentation medium includes the DM medium.

[0026] In one embodiment of the present invention, the DM medium includes a carbon source, 13.5 g / L potassium dihydrogen phosphate, 4.0 g / L ammonium phosphate, 1.7 g / L citric acid, 1.4 g / L magnesium sulfate heptahydrate, 10 mL / L trace metal element solution (10 g / L ferric chloride, 2.25 g / L zinc sulfate heptahydrate, 1.0 g / L copper sulfate pentahydrate, 0.35 g / L manganese sulfate monohydrate, 0.23 g / L sodium borate decahydrate, 0.11 g / L ammonium molybdate, 2.0 g / L calcium chloride dihydrate).

[0027] In one embodiment of the present invention, the carbon source includes 40 g / L glucose.

[0028] In one embodiment of the present invention, the fermentation conditions are 35 - 38 °C, 200 - 220 rpm, and the initial OD of the strain fermentation 600It is 0.04 - 0.1, and the fermentation lasts for 70 - 75 h;

[0029] Or the fermentation conditions are 35 - 38°C, 480 - 530 rpm, the inoculation amount is 5 - 10%, the liquid loading amount is 30 - 50%, the pH is 6.0 - 7.0, and the initial OD of the strain fermentation 600 is 0.04 - 0.3, the aeration rate is 1 - 2 vvm, and the fermentation lasts for 70 - 100 h.

[0030] The third object of the present invention is to provide the application of the above - mentioned genetically engineered bacterium, or the above - mentioned fermentation bacterium agent, or the above - mentioned method in the preparation of 2'-fucosyllactose or a product containing 2'-fucosyllactose.

[0031] The fourth object of the present invention is to provide the application of the above - mentioned genetically engineered bacterium or the above - mentioned method in the fields of biology, pharmacy, food, or chemical industry.

[0032] Beneficial effects:

[0033] By expressing the expression cassette for autonomously dynamically regulating citrate synthase GltA and freely expressing the genes related to the 2'-fucosyllactose synthesis pathway, the present invention successfully constructs a high - yield 2'-fucosyllactose - producing engineering strain. In addition, this method is simple in design and can regulate the carbon flow by inhibiting cell growth during the stationary phase. By constructing a 2'-fucosyllactose - producing engineering strain and introducing an autonomously dynamic regulation method, after 72 h of fermentation, the yield and production intensity of 2'-fucosyllactose reach 31.3 g / L and 0.43 g / L / h respectively. It has a good application prospect and the potential for industrial application. Description of the Drawings

[0034] Figure 1 : Construction of the autonomously dynamic regulation method.

[0035] Figure 2 : Production path of 2'-fucosyllactose.

[0036] Figure 3 : Change of 2'-fucosyllactose content in shake flasks.

[0037] Figure 4 : Change of 2'-fucosyllactose content in a 7.5 - L fermenter. Detailed Embodiments

[0038] The plasmid construction involved in the present invention is all carried out by classical molecular biological means.

[0039] (I) Culture Medium

[0040] Seed medium: LB medium, with components including 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0041] Fermentation medium: The components include standard fermentation medium (DM medium, 1 L): 13.5 g / L potassium dihydrogen phosphate, 4.0 g / L ammonium phosphate, 1.7 g / L citric acid, 1.4 g / L magnesium sulfate heptahydrate, 10 mL / L trace metal element solution (10 g / L ferric chloride, 2.25 g / L zinc sulfate heptahydrate, 1.0 g / L copper sulfate pentahydrate, 0.35 g / L manganese sulfate monohydrate, 0.23 g / L sodium borate decahydrate, 0.11 g / L ammonium molybdate, 2.0 g / L calcium chloride dihydrate, pH 6.8); add glucose at corresponding concentrations (40 g / L glucose for shake flask fermentation and 40 g / L glucose for fermentor fermentation). Autoclave glucose separately. Before adding to the fermentation medium, adjust to pH 7 with KOH and sterilize through a 0.22 µm membrane. Add antifoaming agent (Sigma 204) as needed.

[0042] (II) Fermentation production of 2'-fucosyllactose

[0043] (1) Shake flask fermentation

[0044] Inoculate the recombinant strain into 10 mL of seed medium and culture at 37 °C, 200 - 220 rpm for 12 - 18 h to obtain a seed culture. Inoculate the seed culture into a 250 mL shake flask containing 50 mL of DM medium at an inoculation amount of 2% (v / v). The pH is 6.8, the temperature is kept constant at 37 °C, 200 - 220 rpm, and the fermentation period is 72 h.

[0045] (2) Fermentation in a 7.5 L fermentor

[0046] Inoculate the recombinant strain into 10 mL of seed medium and culture at 37 °C, 200 rpm for 12 - 18 h to obtain a seed culture. Inoculate the seed culture into a fermentor containing 3.5 L of DM medium at an inoculation amount of 5% (v / v). The pH is 7.1, the pressure is 1 mpa, the temperature is kept constant at 37 °C, 550 - 650 rpm, the aeration rate is 1 vvm, and the fermentation period is 72 h.

[0047] (III) Determination of 2'-fucosyllactose content

[0048] Preparation of fermentation samples: Take the fermentation broth sample, centrifuge at 12000 rpm for 5 min, take the supernatant, dilute it, filter it through a 0.22 µm aqueous membrane, and use the filtrate for liquid chromatography analysis.

[0049] Determination of 2'-fucosyllactose content: Using a Shimadzu high-performance liquid chromatograph (equipped with a differential refractive index detector), the sample was analyzed using a Phenomenex Carbohydrate Analysis (Rezex ROA-organic acid H+ (8%)) chromatographic column. The mobile phase was H 2 SO 4 with a concentration of 0.005 M. The mobile phase was filtered through a 0.22 μm filter membrane, degassed by ultrasound, and the flow rate was 0.6 mL / min. The column temperature was 60°C; the injection volume was 10 μL.

[0050] Table 1 Primers involved in the following examples

[0051]

[0052] Example 1 Construction of an autonomous dynamic regulation method

[0053] For the specific method, refer to the literature Gao, C., Hou, J., Xu, P. et al. Programmable biomolecular switches for rewiring flux in Escherichia coli . Nat Commun 10, 3751(2019).

[0054] Using the engineering plasmid pJ01 as a template, the Pj23119 constitutive promoter was replaced with the stationary-phase pS60 promoter by whole plasmid PCR; the GFP fragment containing B0034RBS was inserted behind the pS60 promoter by single-fragment homologous recombination, and the expression of GFP was initiated using the pS60 promoter to obtain the pS60-GFP plasmid.

[0055] Based on the commercial plasmid p-dCas9 (Addgene Plasmid #44249), the pTet promoter was replaced with the pSPP promoter (pS60, pfic, or pbolA) by whole plasmid PCR to initiate the expression of dCas9, obtaining a series of pSPP-p-dCas9 plasmids (pS60-p-dCas9, pfic-p-dCas9, pbolA-p-dCas9).

[0056] The pSPP-p-dCas9 plasmid was digested with XhoI alone to obtain a linearized vector. Then, using the commercial plasmid pTargetF (Addgene Plasmid #62226) as a template and F1 and F2 as primers, the sgRNA expression cassette of the Pj23119 constitutive promoter containing the homologous arms of the pSPP-p-dCas9 vector was amplified and inserted into the pSPP-p-dCas9 linearized vector by single-fragment one-step homologous recombination to obtain the plasmid p-dCas9-sgRNA. Further, the original N20 sequence of the plasmid p-dCas9-sgRNA was replaced by gltA the first 20 bp of the antisense strand (gtatccccgttgagggtgag) to obtain a series of p-dCas9-sgRNA gltA plasmids (pS60-p-dCas9-sgRNA gltA 、pfic-p-dCas9-sgRNA gltA 、pbolA-p-dCas9-sgRNA gltA ).

[0057] Similarly, the pSPP-p-dCas9 plasmid was digested with XhoI alone to obtain a linearized vector. Then, using the commercial plasmid pTargetF (Addgene Plasmid #62226) as a template and F1 and F2 as primers, the sgRNA expression cassette of the Pj23119 constitutive promoter containing the homologous arms of the pSPP-p-dCas9 vector was amplified and inserted into the pSPP-p-dCas9 linearized vector by single-fragment one-step homologous recombination to obtain the plasmid p-dCas9-sgRNA. Further, the original N20 sequence of the plasmid p-dCas9-sgRNA was replaced by gfp the first 20 bp of the antisense strand to obtain a series of p-dCas9-sgRNA gfp plasmids (pS60-p-dCas9-sgRNA gfp 、pfic-p-dCas9-sgRNA gfp 、pbolA-p-dCas9-sgRNA gfp ).

[0058] Using the pET28a plasmid as a vector, the vector was digested with NotI and XhoI, and the coding gene of the GFP protein was inserted by single-fragment homologous recombination to obtain the pET28a-GFP plasmid.

[0059] The obtained recombinant plasmid pSPP-GFP, the plasmid p-dCas9-sgRNA gfp and pET28a-GFP were respectively introduced into competent cellsE. coli In JM109, strains containing the pS60-GFP plasmid were obtained respectively. E. coli JM109 / pS60-GFP, which contains the plasmid p-dCas9-sgRNA gfp and the strain containing the pET28a-GFP plasmid E. coli JM109 / p-dCas9-sgRNA gfp / pET28a-GFP.

[0060] The strains E. coli JM109 / pS60-GFP and the strain E. coli JM109 / p-dCas9-sgRNA gfp / pET28a-GFP were respectively inoculated into LB medium and cultured at 37 °C and 200 rpm for 30 h. Bacterial liquid was collected every 5 h, and the GFP fluorescence value and OD value of the bacterial liquid were detected using a microplate reader. The results are as Figure 1 shown.

[0061] As Figure 1 shown in A, the GFP protein controlled by the stationary-phase promoter pS60 began to be gradually expressed after 12 h in the stationary phase, hardly expressed from 0 to 12 h, and the OD value of cell growth gradually increased to 1.2. As Figure 1 shown in B-C, the dCas9 protein controlled by the stationary-phase promoter pSPP began to be gradually expressed after the stationary phase, so it combined with sgRNA gfp to recognize the GFP gene on the pET28a-GFP plasmid for inhibition. Different stationary-phase promoters pS60, pfic, and pbolA controlled the expression of dCas9 with different intensities, thereby achieving different intensities of inhibition of GFP. The expression levels of GFP controlled by the stationary-phase promoters pS60, pfic, and pbolA were 0.08, 0.52, and 0.87 times that of the control group pET28a-GFP plasmid, respectively.

[0062] Example 2 Detection of the content of 2'-fucosyllactose in shake flasks

[0063] Using the Escherichia coli K12 genome as a template, fragments of ManB and ManC containing B0034 RBS, fragments of Gmd and WcaG containing B0034 RBS, and a fragment of FutC containing B0034 RBS were amplified respectively. The fragments of ManB and ManC containing B0034 RBS were inserted into the pJ01 vector digested with Xho1 by one-step multi-fragment homologous recombination to obtain the pJ01-BC plasmid. In the same way, the fragments of Gmd and WcaG containing B0034 RBS and the fragment of FutC containing B0034 RBS were inserted into the pJ01 vector digested with Spe1 by one-step multi-fragment homologous recombination to obtain the pJ01-DGF plasmid. Using the pJ01-DGF plasmid as a template and F3 and F4 as primers, a pJ01-DGF fragment with a promoter was amplified and inserted into the pJ01-BC vector digested with Sal1 by one-step single-fragment homologous recombination to obtain pJ01-BCDGF.

[0064] The plasmid pJ01-BCDGF was transformed into Escherichia coli BL(21) to obtain the 2'-fucosyllactose production chassis strain FL. Subsequently, the plasmid p-dCas9-sgRNA constructed in Example 1 gltA was introduced into the FL competent cells to obtain the 2'-fucosyllactose production strains FL-S60, FL-fic, and FL-bolA carrying pJ01-BCDGF and p-dCas9-sgRNA gltA (pS60-p-dCas9-sgRNA gltA 、pfic-p-dCas9-sgRNA gltA or pbolA-p-dCas9-sgRNA gltA ).

[0065] The above-mentioned 2'-fucosyllactose production strains were cultured in a shake flask in DM medium, and the content of 2'-fucosyllactose in the fermentation broth was identified. The results are as Figure 3 shown. With the prolongation of the culture time, the 2'-fucosyllactose yield of the control group FL was 1.8 g / L, and the production intensity reached 0.03 g / L / h. While the 2'-fucosyllactose yields of the experimental groups FL-S60, FL-fic, and FL-bolA could reach 2.4 g / L, 2.9 g / L, and 2.65 g / L respectively, and the production intensities reached 0.03 g / L / h, 0.04 g / L / h, and 0.04 g / L / h respectively. Among them, the yields were increased by 33.3%, 61.1%, and 47.2% respectively compared with the control group.

[0066] Example 3 Detection of 2'-fucosyllactose content in a fermenter

[0067] The fermentation performance of the FL-fic strain was detected in a 7.5 L fermenter.

[0068] The FL-fic strain constructed in Example 2 was inoculated into 10 mL of seed medium and cultured at 37 °C and 200 rpm for 12 - 18 h to obtain a seed solution. The seed solution was inoculated into a fermenter filled with 3.5 L of DM medium at an inoculation amount of 5% (v / v). The pH was 7.1, the pressure was 1 mpa, the temperature was kept constant at 37 °C, the rotation speed was 550 rpm, the ventilation rate was 1 vvm, and the fermentation cycle was 72 h.

[0069] As Figure 4 shown, at the end of fermentation, the yields and production intensities of 2'-fucosyllactose reached 31.3 g / L and 0.43 g / L / h, respectively.

[0070] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A genetically engineered bacterium, characterized in that, the genetically engineered bacterium uses Escherichia coli BL(21) as the host; uses the p-dCas9 plasmid as the vector to express the expression cassette for dynamically regulating the expression of citrate synthase GltA, and co-expresses the genes related to the 2'-fucosyllactose synthesis pathway with the pJ01 vector; the expression cassette for dynamically regulating the expression of citrate synthase GltA contains dCas9 regulated by a stationary-phase promoter and sgRNA regulated by a constitutive promoter; the genes related to the 2'-fucosyllactose synthesis pathway include the gene manB encoding phosphomannomutase ManB, the gene manC encoding mannose-1-phosphate guanylyltransferase ManC, the gene gmd encoding GDP-mannose 4,6-dehydratase Gmd, the gene wcaG encoding GDP-L-fucose synthase WcaG, and the gene futC encoding fucosyltransferase FutC; the stationary-phase promoter is selected from any one of pS60, pfic or pbolA; the constitutive promoter is Pj23119; the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.7; the genes manB, manC, gmd, wcaG and futC all contain B0034RBS.

2. The genetically engineered bacterium according to claim 1, characterized in that, the nucleotide sequence of the stationary-phase promoter pS60 is as shown in SEQ ID NO.8, the nucleotide sequence of pfic is as shown in SEQ ID NO.9, and the nucleotide sequence of pbolA is as shown in SEQ ID NO.10; the nucleotide sequence of Pj23119 is as shown in SEQ ID NO.

11.

3. The genetically engineered bacterium according to claim 1, characterized in that, the nucleotide sequence of the gene gltA encoding citrate synthase is SEQ ID NO.1; the nucleotide sequence of the gene manB encoding phosphomannomutase is SEQ ID NO.2; the nucleotide sequence of the gene manC encoding mannose-1-phosphate guanylyltransferase is SEQ ID NO.3; the nucleotide sequence of the gene gmd encoding GDP-mannose 4,6-dehydratase is SEQ ID NO.4; the nucleotide sequence of the gene wcaG encoding GDP-L-fucose synthase is SEQ ID NO.5; the nucleotide sequence of the gene futC encoding fucosyltransferase is SEQ ID NO.

6.

4. A method for producing 2'-fucosyllactose, characterized in that, the genetically engineered bacterium according to any one of claims 1 to 3 is used for the fermentative production of 2'-fucosyllactose.

5. Use of the genetically engineered bacterium according to any one of claims 1 to 3 or the method according to claim 4 in the preparation of 2'-fucosyllactose or a product containing 2'-fucosyllactose.

Images