A steroid compound nectriasteroid A and its preparation method and application

By chromatography on the fermented substances of the plexus red-shell fungus MHHJ-3Nectria sp., a steroid compound with tumor cytotoxic activity was prepared, which solved the problem that no anti-tumor steroid compounds were found in the plexus red-shell fungus in the prior art, and the development of new compounds for the preparation of anti-tumor drugs was achieved.

CN116751243BActive Publication Date: 2025-06-06YUNNAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310466881.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-27
Publication Date
2025-06-06
Estimated Expiration
2043-04-27

AI Technical Summary

Technical Problem

No steroid compounds with anti-tumor effects have been found in the genus Red Celestial fungi.

Method used

A new steroid compound nectriasteroid A was prepared by silica gel column chromatography, gel column chromatography and high performance liquid chromatography by subjecting to silica gel column chromatography.

Benefits of technology

nectriasteroidA has tumor cytotoxic activity and has strong inhibitory activity on cells including lung cancer, breast cancer, liver cancer, leukemia and colon cancer, and can be used to prepare anti-tumor drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116751243B_ABST
    Figure CN116751243B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of compound preparation and chemical medicine technology, and specifically relates to a steroid compound nectriasteroid A and a preparation method and application thereof. The steroid compound nectriasteroid A provided by the present invention is a new steroid compound and has tumor cell toxicity, has strong inhibitory activity on a variety of cancer cells including lung cancer cells, breast cancer cells, liver cancer cells, leukemia cells and colon cancer cells, and can be used for the preparation of anti-tumor drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of compound preparation and chemical medicine, and specifically relates to a steroid compound nectriasteroid A and a preparation method and application thereof. Background Art

[0002] Endophytic fungi are microbial warehouses hidden in host plants. Their fermentation products have rich chemical structure diversity and extensive biological activity, and are a rich source of novel compounds with pharmaceutical activity and agricultural application potential. Taking advantage of the relatively simple and short cycle of microbial cultivation, the demand for slow-growing precious plants is reduced, which is beneficial to protecting the biodiversity on the earth and is easy to solve the problem of drug sources. Therefore, it has unique advantages in development and research.

[0003] The secondary metabolites in Nectria are relatively abundant and have good pharmacological activity. Endophytic fungi in Nectria have been reported to produce paclitaxel with anticancer and antitumor activities, but there are no reports of steroidal compounds with antitumor effects in Nectria. Summary of the invention

[0004] The purpose of the present invention is to provide a steroid compound nectriasteroidA and a preparation method and application thereof. The present invention provides a new steroid compound, and the provided steroid compound nectriasteroidA has tumor cell toxicity and can be used to prepare anti-tumor drugs.

[0005] The present invention provides a steroid compound nectriasteroid A, the structure of which is shown in Formula I:

[0006]

[0007] The present invention also provides a method for preparing the steroid compound nectriasteroid A described in the above technical solution, comprising: subjecting the alcohol extract of the fermentation product of the red shell fungus MHHJ-3 Nectria sp. to silica gel column chromatography, gel column chromatography separation and high performance liquid chromatography separation in sequence to obtain the steroid compound nectriasteroid A;

[0008] The eluent of the silica gel column chromatography is a dichloromethane-methanol system; the volume ratio of dichloromethane to methanol in the dichloromethane-methanol system is 100:0 to 3:1;

[0009] The eluent for the gel column chromatography separation is methanol;

[0010] The eluent for the HPLC separation is a methanol-water system;

[0011] The preservation number of the Nectria sp. MHHJ-3 is CCTCC M 2023223.

[0012] Preferably, the silica gel column chromatography comprises:

[0013] The dichloromethane-methanol system with volume ratios of 100:0, 100:1, 50:1, 30:1, 10:1 and 3:1 was used for elution in sequence, and the elution segment of the dichloromethane-methanol solution with a volume ratio of 10:1 was collected to obtain a silica gel column chromatography liquid.

[0014] Preferably, the volume ratio of methanol to water in the methanol-water system is 1:9 to 9:1; and the chromatographic column for HPLC separation is a C18 chromatographic column.

[0015] Preferably, the preparation of the alcohol extract comprises the following steps:

[0016] Inoculating the activated MHHJ-3 Nectria sp. into a fermentation medium for fermentation culture to obtain a fermentation product of the MHHJ-3 Nectria sp.;

[0017] The fermentation product of the MHHJ-3 Nectria sp. is mixed with alcohol and then subjected to ultrasonic extraction to obtain an alcohol extract.

[0018] Preferably, the fermentation medium is sterilized potatoes; the fermentation culture temperature is 18-25° C., and the time is 28-32 days.

[0019] Preferably, the mass ratio of the fermentation product of Nectria sp. MHHJ-3 to the volume ratio of alcohol is (30-80) g: (50-150) mL; the frequency of the ultrasonic extraction is 40 kHz, and the time is 30-40 min.

[0020] The present invention also provides the use of the steroidal compound nectriasteroid A described in the above technical solution or the steroidal compound nectriasteroid A prepared by the preparation method in the preparation of anti-tumor drugs.

[0021] Preferably, the tumor includes one or more of lung cancer, breast cancer, liver cancer, leukemia and colon cancer.

[0022] The present invention also provides a MHHJ-3Nectria sp. (Nectria pseudotrichia), and the preservation number of the MHHJ-3Nectria sp. is CCTCC M 2023223.

[0023] Beneficial effects:

[0024] A steroid compound nectriasteroid A, the structure of which is shown in formula Ⅰ:

[0025]

[0026] The steroid compound nectriasteroid A provided by the present invention is a new steroid compound and has tumor cell toxicity activity. It has strong inhibitory activity on various cancer cells including lung cancer cells, breast cancer cells, liver cancer cells, leukemia cells and colon cancer cells, and can be used for the preparation of anti-tumor drugs.

[0027] The present invention also provides a method for preparing the steroidal compound nectriasteroid A, comprising: subjecting the alcohol extract of the fermentation product of the MHHJ-3Nectria sp. to chromatographic separation to obtain the steroidal compound nectriasteroid A; the MHHJ-3Nectria sp. has a deposit number of CCTC CM 2023223. The steroidal compound nectriasteroid A of the present invention is a metabolite of the MHHJ-3Nectria sp., and the method for preparing the steroidal compound nectriasteroid A using the MHHJ-3Nectria sp. as a raw material is simple and easy to implement, and is easy to mass produce, which not only meets the requirements of modern environmental protection and low-carbon economy, but also solves the problem of scarcity of raw materials for anti-tumor drugs.

[0028] Biodeposit Information:

[0029] MHHJ-3Nectria sp. (Nectriapseudotrichia) was deposited in the China Center for Type Culture Collection on March 1, 2023. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M 2023223. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0031] Figures 1-2 The Blast comparison results of the sequencing sequences in Example 1 in the NCBI database;

[0032] Figures 3-4 is the HR-ESI-MS spectrum of the compound nectriasteroid A in Example 2;

[0033] Figure 5 is the compound nectriasteroid A in Example 2 1 H-NMR spectrum;

[0034] Figure 6 is the compound nectriasteroid A in Example 2 13 C-NMR and DEPT spectra;

[0035] Figure 7 is the compound nectriasteroid A in Example 2 1 H- 1 H COSY spectrum.

[0036] Figure 8 is the HMBC spectrum of the compound nectriasteroid A in Example 2;

[0037] Fig. 9 is the HSQC spectrum of the compound nectriasteroid A in Example 2;

[0038] Fig.10 This is the NOESY spectrum of the compound nectriasteroid A in Example 2. DETAILED DESCRIPTION

[0039] The present invention provides a steroid compound nectriasteroid A, the structure of which is shown in Formula I:

[0040]

[0041] The present invention also provides a method for preparing the steroid compound nectriasteroid A described in the above technical solution, comprising: subjecting the alcohol extract of the fermentation product of the red shell fungus MHHJ-3 Nectria sp. to silica gel column chromatography, gel column chromatography separation and high performance liquid chromatography separation in sequence to obtain the steroid compound nectriasteroid A;

[0042] The eluent of the silica gel column chromatography is a dichloromethane-methanol system; the volume ratio of dichloromethane to methanol in the dichloromethane-methanol system is 100:0 to 3:1;

[0043] The eluent for the gel column chromatography separation is methanol;

[0044] The eluent for the HPLC separation is a methanol-water system;

[0045] The preservation number of the Nectria sp. MHHJ-3 is CCTCC M 2023223.

[0046] Preferably, the silica gel column chromatography comprises:

[0047] The dichloromethane-methanol system with volume ratios of 100:0, 100:1, 50:1, 30:1, 10:1 and 3:1 was used for elution in sequence, and the elution segment of the dichloromethane-methanol solution with a volume ratio of 10:1 was collected to obtain a silica gel column chromatography liquid.

[0048] The present invention preferably prepares the fermentation product of the MHHJ-3Nectria sp., and the preparation method of the fermentation product of the MHHJ-3Nectria sp. preferably includes: inoculating activated MHHJ-3Nectria sp. into a fermentation medium for fermentation culture to obtain the fermentation product of the MHHJ-3Nectria sp.

[0049] In the present invention, the MHHJ-3Nectria sp. is preferably inoculated onto a PDA slant culture medium for activation culture to obtain the activated MHHJ-3Nectria sp.

[0050] The red shell fungus MHHJ-3Nectria sp. of the present invention is preferably isolated from the leaves of Sedum chinense collected in Zhipu County, Guilin City, Guangxi Zhuang Autonomous Region. The ITS sequence of the red shell fungus MHHJ-3Nectria sp. of the present invention is preferably as shown in SEQ ID NO.1, specifically 5'-CCTATAATTGTTGCTTCGG CGGGACCGCCCCGGCGCCCACTCGGGCCCGGACCCAGGCGCCCGCCGGAGGCCCCAAACTCTTTGTTTTTACGTTGTGTATCTTCTGAGTTATACAAGCAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTATTCTAGCGGGCATGCC TGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGTCGGCTTGGTGTTGGGGATCGGCCGCAAGCCTTCACGGCAGGCGGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGTAGTCCCCCTCTGCGTAGTAATTACACCTCGCACTGGAAGCTCGGCCTGACCACGCCGTAAAACCCCCCACTTCTGAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG-3', the homology of this strain with Nectria ps eudotrichia in the NCBI database is as high as 99.40%, as shown in Figures 1-2 As shown; based on the similarity between 80% and 90%, it is considered to be at the same phylum level; the similarity between 90% and 95% is considered to be at the same family level; the similarity between 95% and 97% is considered to be at the same genus level; the similarity above 97% is considered to be at the same species level. This standard shows that this strain has a very high similarity with the Nectria sp., therefore, this strain was named Nectria sp. MHHJ-3.

[0051] The temperature of the activation culture of the present invention is preferably 28° C. and the time is preferably 5 days.

[0052] After obtaining the activated Nectocarp fungus MHHJ-3Nectria sp., the present invention preferably inoculates the activated Nectocarp fungus MHHJ-3Nectria sp. into a fermentation medium for fermentation culture to obtain the fermentation product of the Nectocarp fungus MHHJ-3Nectria sp. The fermentation medium of the present invention is preferably sterilized potato. The preparation method of the fermentation medium of the present invention preferably includes: sealing and sterilizing clean potato pieces in a tissue culture device to obtain the fermentation medium. The diameter of the clean potato pieces of the present invention is preferably 1 cm; the tissue culture device is preferably a tissue culture bottle, and the mass of the clean potato pieces in the tissue culture bottle is preferably 80-100 g / bottle, more preferably 80 g / bottle. The sterilization temperature of the present invention is preferably 120°C, and the time is preferably 30 min.

[0053] The inoculation amount of the activated MHHJ-3 Nectria sp. of the present invention is preferably 1% of the volume of the fermentation medium. The temperature of the fermentation culture of the present invention is preferably 18-25°C, and the time is 28-32 days.

[0054] After obtaining the fermented product of the MHHJ-3Nectria sp., the present invention preferably mixes the fermented product of the MHHJ-3Nectria sp. with alcohol and then performs ultrasonic extraction to obtain an ultrasonic extraction mixture. The volume ratio of the mass of the fermented product of the MHHJ-3Nectria sp. of the present invention to the alcohol is preferably (30-80): (50-150) mL, more preferably 80 g: 100 mL. The alcohol of the present invention preferably includes methanol or ethanol, more preferably methanol. The frequency of the ultrasonic extraction of the present invention is preferably 40 kHz; the time of the ultrasonic extraction is preferably 30-40 min, more preferably 40 min.

[0055] After obtaining the ultrasonic extraction mixture, the present invention preferably filters the ultrasonic extraction mixture, and concentrates the obtained filtrate under reduced pressure until there is no alcohol taste, so as to obtain a crude extract. The present invention does not specifically limit the specific process of the filtration and reduced pressure concentration, and the process well known to those skilled in the art can be used.

[0056] After obtaining the crude extract, the present invention preferably performs silica gel column chromatography on the crude extract; the silica gel column chromatography preferably comprises the following steps:

[0057] dissolving the crude extract with a dichloromethane-methanol solution to obtain a crude extract solution;

[0058] Mixing the crude extract solution with silica gel, removing the solvent from the obtained mixture, and loading the obtained silica gel adsorbed with the crude extract into a column;

[0059] Gradient elution was performed using a dichloromethane-methanol system with volume ratios of 100:0, 100:1, 50:1, 30:1, 10:1, and 3:1 in sequence, and the section with a volume ratio of 10:1 was collected to obtain a silica gel column chromatography liquid.

[0060] The silica gel column chromatography separation of the present invention is preferably normal phase silica gel column chromatography separation, and the diameter of the column used is preferably 1 cm.

[0061] The present invention preferably dissolves the crude extract in a dichloromethane-methanol solution to obtain a crude extract solution. The volume ratio of dichloromethane to methanol in the dichloromethane-methanol solution of the present invention is preferably 2-5:1, more preferably 2:1.

[0062] The crude extract solution is obtained. In the present invention, the crude extract solution is preferably mixed with silica gel, the solvent in the obtained mixture is removed, and the silica gel adsorbed with the crude extract is loaded into a column. The mass of the silica gel in the present invention is preferably 0.8 to 1.5 times the mass of the crude extract. The particle size of the silica gel in the present invention is preferably 200 mesh.

[0063] After the sample is loaded on the column, the present invention preferably uses a dichloromethane-methanol system with a volume ratio of 100:0, 100:1, 50:1, 30:1, 10:1, and 3:1 for gradient elution, and obtains dichloromethane-methanol solution elution sections with a volume ratio of 100:0, 100:1, 50:1, 30:1, 10:1, and 3:1, respectively; the dichloromethane-methanol solution elution section with a volume ratio of 10:1 is a silica gel column chromatography chromatographic liquid. The flow rate of the gradient elution of the present invention is preferably 1 ml / min.

[0064] The silica gel column chromatography chromatographic liquid is obtained. The present invention preferably performs gel column chromatography separation on the silica gel column chromatography chromatographic liquid to obtain a gel column chromatography eluent. The eluent for the gel column chromatography separation of the present invention is preferably methanol; the flow rate is preferably 2 ml / min. The diameter of the pre-packed column for the gel column chromatography separation of the present invention is preferably 2 cm, and the column length is preferably 1.8 m.

[0065] After obtaining the gel column chromatography eluate, the present invention preferably evaporates the gel column chromatography eluate to dryness by a rotary evaporator, dissolves it in methanol, and then filters it for high performance liquid chromatography separation to obtain the steroid compound nectriasteroid A. The high performance liquid chromatography separation of the present invention is preferably preparative high performance liquid chromatography; the chromatographic column of the high performance liquid chromatography separation is preferably a C18 chromatographic column, and the eluent preferably includes a methanol-water system, and the volume ratio of methanol and water in the methanol-water system is preferably 1:9 to 9:1. More preferably, it is 6:4. The elution time of the present invention is preferably 14 minutes, and the elution segment of 6 to 11 minutes is preferably collected. The detection wavelength of the high performance liquid chromatography separation of the present invention is preferably 210nm or 254nm. The column temperature of the high performance liquid chromatography separation of the present invention is preferably 20°C; the flow rate is preferably 2mL / min. The steroid compound nectriasteroid A of the present invention is a new steroid compound and has tumor cell toxicity activity. It has strong inhibitory activity on various cancer cells including lung cancer cells, breast cancer cells, liver cancer cells, leukemia cells and colon cancer cells, and can be used for the preparation of anti-tumor drugs.

[0066] Based on the above technical advantages, the present invention also provides the use of the steroid compound nectriasteroidA described in the above technical solution or the steroid compound nectriasteroidA prepared by the preparation method in the preparation of anti-tumor drugs. The tumor described in the present invention preferably includes one or more of lung cancer, breast cancer, liver cancer, leukemia and colon cancer, and further includes lung cancer, breast cancer, liver cancer, leukemia or colon cancer, and more preferably lung cancer.

[0067] The present invention also provides a MHHJ-3Nectria sp., and the deposit number of the MH HJ-3Nectria sp. is CCTCC M 2023223. The source of the MH HJ-3Nectria sp. of the present invention has been described and defined in the above technical scheme, and will not be described in detail.

[0068] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0069] Example 1

[0070] The isolation and identification of Nectria sp. MHHJ-3 were carried out as follows:

[0071] 1. Preprocessing:

[0072] Take freshly collected leaves of Scutellaria baicalensis, remove the surface mud and sand, and then rinse with tap water for about 2 hours; among them, the leaves of Scutellaria baicalensis were collected in Zhipu County, Guilin City, Guangxi Zhuang Autonomous Region, and the samples were immediately placed in a sealed bag and stored at 4°C after collection; the isolation of endophytic fungi was completed within 72 hours after collection.

[0073] 2. Surface disinfection:

[0074] In the clean bench, soak in sodium hypochlorite solution with an effective chlorine content of 50%, soak in 75% ethanol solution for 30 seconds, rinse with sterile water 3 times, soak in 75% ethanol solution for 30 seconds, rinse with sterile water 4 times, and dry with sterile filter paper for later use;

[0075] In order to check whether the tissue surface is thoroughly disinfected, a control experiment is required, specifically: 50 μL of the sterile water used for the last wash is directly added to the PDA separation plate, and then spread on the culture medium with a coating rod, and cultured under the same conditions as a control group; if no colonies grow in all control groups, it proves that the surface disinfection in the above steps is thorough, thereby ensuring that the isolated microorganisms are plant endophytes rather than microorganisms attached to the air or tissue surface;

[0076] 3. Isolation of endophytic fungi:

[0077] Use sterilized scissors to cut the thoroughly sterilized leaves of the red flower vine into several pieces of 0.5×0.5cm 2 The processed samples are implanted into the PDA culture medium plates that have been prepared in advance. Each plate is divided into four areas: A, B, C, and D. 3 to 4 samples are placed in each area. Seal the culture dish with sealing film, write the number, and invert it in a 28℃ constant temperature incubator for cultivation. Check it once a day; if new colonies are found, inoculate them on new plates immediately;

[0078] 4. Purification of endophytic fungi (plate streak method):

[0079] After hyphae grow on the PDA medium plate, the grown hyphae are repeatedly streaked and separated and cultured until a pure strain is obtained.

[0080] 5. Preservation of endophytic fungi:

[0081] For short-term storage of purified fungal strains, they can be directly inoculated on PDA slants. After the strains grow, seal the test tubes with sealing film and store them in a 4°C refrigerator.

[0082] 6. Identification of endophytic fungi:

[0083] The DNA of the fungus obtained above was extracted (using conventional methods), PCR amplified, and finally sequenced (the sample was sent to Qingke Biotechnology Co., Ltd. for sequencing), and the ITS sequence of the endophytic fungus was obtained as follows: 5'-CCTATAATTGTTGCTTCGGCGGGACCGCCCCGGCGCCCACTCGGG CCCGGACCCAGGCGCCCGCCGGAGGCCCCAAACTCTTTGTTTTTACGTTGTGTATCTTCTGAGTTATACAAGCAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTATTC TAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGTCGGCTTGGTGTGGGGGATCGGCCGCAAGCCTTCACGGCAGGCGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGTAGTCCCCCTCTGCGTAGTAATTACACCTCGCACTGGAAGCTCGGCCTGACCACGCCGTAAAACCCCCCACTTCTGAAGGTT-3'(SEQID NO.1). The sequencing results were input into GenBank (www.ncbi.nlm.nih.gov), and the BLAST program was used to search for homologous sequences for comparison. According to the currently commonly used standards (i.e., similarity between 80% and 90% is considered to be at the same phylum level; similarity between 90% and 95% is considered to be at the same family level; similarity between 95% and 97% is considered to be at the same genus level; similarity above 97% is considered to be at the same species level), the most similar sequence was found. The results are as follows: Figures 1-2 As shown by Figures 1-2 It can be concluded that the similarity between the endophytic fungus isolated by the present invention and Nectria pseudotrichia reaches 99.40%, and thus it is considered that an endophytic fungus of the genus Nectria pseudotrichia is isolated and named as MHHJ-3Nectria sp., and a biological deposit is made with the deposit number CCTCC M 2023223.

[0084] Example 2

[0085] The steps for preparing the steroid compound nectriasteroid A are as follows:

[0086] 1. Activation of strains: The Nectria sp. isolated in Example 1 was inoculated onto a PDA slant culture medium, cultured at 28° C. for 5 days, and then stored in a 4° C. refrigerator for later use.

[0087] 2. Preparation of fermentation medium: Wash potatoes, cut them into 1 cm diameter pieces and place them in tissue culture bottles (80 g / bottle). Cover the tissue culture bottles and sterilize them at 120°C for 30 min. Cool them to obtain the fermentation medium.

[0088] 3. The endophytic fungus MHHJ-3Nectria sp. activated in step 1 is inoculated into the fermentation medium prepared in step 2 at an inoculum amount of 1% by volume, covered (the lid has air holes covered by a filter membrane), and then cultured at a constant temperature of 28° C. for 30 days to obtain the fermentation product of the fungus MHHJ-3Nectria sp.

[0089] 4. Mix 80 g of the fermentation product prepared in step 3 with 100 mL of methanol, ultrasonicate at 40 kHz for 30 min, filter, and concentrate the filtrate under reduced pressure until there is no alcohol taste to obtain 10.6 g of nectriasteroid A crude extract.

[0090] 5. Dissolve 10.6 g of crude extract of nectriasteroid A in 15 mL of a 2:1 volume ratio of dichloromethane-methanol solution, mix with 11.0 g of 200-mesh silica gel, concentrate under reduced pressure to remove the solvent, and load onto a column;

[0091] Gradient elution was performed using dichloromethane-methanol solutions with volume ratios of 100:0, 100:1, 50:1, 30:1, 10:1, and 3:1, in sequence;

[0092] Taking the eluted portion of the dichloromethane-methanol solution with a volume ratio of 10:1, and eluting it through a gel column chromatography with methanol as a solvent to obtain an eluent;

[0093] The eluent is subjected to high performance liquid chromatography using methanol as solvent through a preparative high performance liquid chromatograph, the chromatographic column is a C18 chromatographic column; the mobile phase is methanol and water, wherein the volume ratio of methanol to water is 60:40; the detection wavelength is 210 or 254 nm, and the steroid compound nectriasteroid A (2.5 mg) is prepared;

[0094] The steroid compound nectriasteroid A prepared in Example 1 was structurally identified by one-dimensional nuclear magnetic resonance spectroscopy and two-dimensional nuclear magnetic resonance spectroscopy (1D / 2D NMR) and high-resolution electrospray ionization mass spectrometry (HR-ESI-MS). The HR-ESI-MS spectrum is as follows: Figures 3-4As shown, 1 H-NMR spectrum Figure 5 As shown, 13 C-NMR and DEPT spectra Figure 6 shown.

[0095] From the HSQC spectrum ( Fig. 9 ) Combined with the carbon spectrum, the chemical shift data of H and C connected to nectriasteroid A can be obtained, as shown in Table 1:

[0096] Table 1 Nectriasteroid A 1 H(400MHz) and 13 C (100 MHz) NMR data

[0097]

[0098]

[0099]

[0100] The compound nectriasteroidA is a white amorphous powder. The molecular weight of the compound is [469.3289[M+Na]+(calcd for C 28 H 46 O 4 Na,469.3288)], suggesting that its molecular formula is C 28 H 46 O 4 The unsaturation degree is 6, of which 2 double bonds C-7=C-8 and C-24=C-28, and the remaining 4 unsaturations indicate that the compound has a tetracyclic skeleton. The infrared spectrum is at 3405 and 1647 cm -1 There is a characteristic absorption peak at , indicating that nectriasteroid A contains hydroxyl groups and double bonds. 1 H. 13 C combined with HSQC NMR spectrum showed that the structure contained 28 carbon atoms and 5 methyl signals (δ C 7.5, 14.0, 20.8, 22.1 and 22.6; δ H 0.82, 0.77, 1.25, 1.08 and 1.08), 9 methylene signals (δ C 22.2, 23.8, 26.2, 30.1, 36.8, 38.4, 42.0, 42.2 and 108.7; H1.80, 1.53, 2.31, 1.82, 1.87, 1.98, 2.50, 1.29, 1.64, 1.54, 1.92, 1.38, 2.09 and 4.85), 9 methine signals (including three oxygen-linked methines) (δ C 34.8, 39.6, 51.5, 55.9, 57.0, 68.9, 76.1, 79.5 and 118.5; H 2.31, 1.28, 1.85, 2.04, 1.86, 3.60, 3.50, 3.39 and 3.12), 5 quaternary carbons (including 1 oxygen-linked quaternary carbon) (δ C 41.0, 44.8, 77.8, 141.1 and 155.3). The analytical data revealed that the compound was similar to aervecdysteroid C, indicating that the compound had a steroidal structure.

[0101] exist 1 H- 1 H COSY( Figure 7 ), the sequential correlations of H-1 / H-2 / H-3 / H-4 / H-5 / H-6 / H-7, H-9 / H-11 / H-12, and H-15 / H-16 / H-17, combined with the HMBC correlations of H-1 with C-9, C-10 and C-18, H-7 with C-5, C-9 and C-14, and HMBC correlations of H-12 with C-13, and H-17 with C-13 ( Figure 8 ) correlation indicates that there are four rotation systems in the structure, confirming the existence of the steroid skeleton. The existence of side chains is based on the following 1 H- 1 H COSY and HMBC correlations determined: H-22 / H-23 and H-25 / H-26 / H-27 correlations, combined with H-17 and C-20, H-22 and C-20, C-21, and H-28 and C-23, C-25 HMBC correlations to clarify the side chain linkage. 13 The chemical shift values ​​of C determined that the hydroxyl groups were located at C-1 / C-3 / C-20 and C-22. Thus, the planar structure of nectriasteroid A was elucidated.

[0102] The absolute configuration of NectriasteroidA was determined by NOESY experiment. Fig.10), the NOESY correlation between CH3-19 and H-5 indicated that H-5 had a β orientation. There were no NOE correlations between CH3-19 and H-1, and between CH3-18 and H-17, supporting the β orientation of OH-1 and C-17. Due to the NOE correlation between H-1 and H-3, the stereochemistry of the hydroxyl function on C-3 can be determined as β. The NOE correlation between CH3-21 and H-17 determined the β orientation of OH-20. The chemical shifts of the steroidal side chains C-20R / C-22R are reported to be approximately 76.0 (C-20) and 77.0 (C-22) ppm (Li Y, Cai L, Dong JW, et al), while the chemical shifts of C-20R / C-22S are approximately 76.5 (C-20) and 80.5 (C-22) ppm. (Watanabe B, Nakagawa Y, Ogura T, et al), the chemical shifts of C-20 and C-22 in this compound appeared at 77.8 and 76.1 ppm, respectively. Combined with the absence of NOE correlation between CH3-21 and H-22, the absolute configuration of C-22 was named R. Therefore, the absolute configuration of nectriasteroid A is 1R, 3R, 5R, 9S, 10S, 13S, 14R, 17S, 20R, 22R.

[0103] Application Example 1

[0104] The steroid compound nectriasteroid A prepared in Example 2 was tested for antitumor activity in the following steps:

[0105] Principle of MTS method for detecting cell activity: MTS is a new MTT analogue and a yellow dye. Succinate dehydrogenase in the mitochondria of living cells can metabolize and reduce MTS to generate soluble formazan compounds. The content of formazan can be measured at 490nm using an enzyme marker. Under normal circumstances, the amount of formazan generated is proportional to the number of living cells, so the number of living cells can be inferred based on the optical density OD value.

[0106] Experimental methods:

[0107] 1. Inoculation of cells: Prepare a single cell suspension with culture medium (DMEM or RMPI1640) containing 10% fetal bovine serum, inoculate 3000 to 15000 cells per well into a 96-well plate, with a volume of 100 μL per well. The cells should be inoculated and cultured 12 to 24 hours in advance.

[0108] 2. Add compound nectriasteroid A solution: compound nectriasteroid A is dissolved in DMSO, compound nectriasteroid A is initially screened at a concentration of 40 μM, the final volume of each well is 200 μL, and 3 replicate wells are set for each treatment.

[0109] 3. Color development: After culturing at 37°C for 48 hours, discard the culture medium in the wells for adherent cells, add 20 μL of MTS solution and 100 μL of culture medium to each well; discard 100 μL of culture supernatant for HL-60 suspension cells, add 20 μL of MTS solution to each well; set up 3 blank replicate wells (a mixture of 20 μL MTS solution and 100 μL culture medium), continue incubation for 2 to 4 hours, allow the reaction to proceed fully, and then measure the absorbance value.

[0110] 4. Colorimetry: Select 492nm wavelength, use a multifunctional microplate reader (MULTISKAN FC) to read the light absorption value of each well, record the results, and after data processing, draw a cell inhibition rate graph with the compound number as the horizontal axis and the cell inhibition rate as the vertical axis.

[0111] 5. Positive control compounds: Two positive compounds, cisplatin (DDP) and paclitaxel (Taxol), were set in each experiment. The cell growth curve was drawn with the concentration as the horizontal axis and the cell survival rate as the vertical axis. The IC of the compound was calculated using the two-point method (Reed and Muench method) 50 The results are shown in Table 2:

[0112] The experimental results showed that in the screening test of the inhibitory activity of the steroid compound nectriasteroid A on five tumor cells in vitro (human lung cancer cells A549, human breast cancer cells MCF-7, human liver cancer cells SMMC-7721, human leukemia cells HL-60 and human colon cancer cells SW480) (positive control: cisplatin), the steroid compound nectriasteroid A exhibited good tumor cytotoxic activity, especially a significant inhibitory effect on human lung cancer cells A549.

[0113] Table 2: Screening of tumor cytotoxic activity of steroidal nectriasteroid A (IC 50 )

[0114]

[0115] It can be concluded from the above examples that the steroid compound nectriasteroid A has tumor cell toxicity and has research value as a lead compound for developing anti-tumor drugs.

[0116] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A steroid compound nectriasteroid A, the structure of which is shown in Formula I:

2. A method for preparing the steroid compound nectriasteroid A according to claim 1, It is characterized in that include: Sequentially subjecting the alcohol extract of the fermentation product of the red shell fungus MHHJ-3 Nectria sp. to silica gel column chromatography, gel column chromatography and high performance liquid chromatography to obtain the steroid compound nectriasteroid A; The eluent of the silica gel column chromatography is a dichloromethane-methanol system; the volume ratio of dichloromethane to methanol in the dichloromethane-methanol system is 100:0 to 3:1; The eluent for the gel column chromatography separation is methanol; The eluent for the HPLC separation is a methanol-water system; The deposit number of the MHHJ-3 Nectria sp. is CCTCC M 2023223.

3. The preparation method according to claim 2, It is characterized in that The silica gel column chromatography comprises: The dichloromethane-methanol system with volume ratios of 100:0, 100:1, 50:1, 30:1, 10:1 and 3:1 was used for elution in sequence, and the elution segment of the dichloromethane-methanol solution with a volume ratio of 10:1 was collected to obtain a silica gel column chromatography liquid.

4. The preparation method according to claim 2, It is characterized in that The volume ratio of methanol to water in the methanol-water system is 1:9 to 9:1; the chromatographic column for high performance liquid chromatography separation is a C18 chromatographic column.

5. The preparation method according to claim 2, It is characterized in that The preparation of the alcohol extract comprises the following steps: inoculating the activated MHHJ-3 Nectria sp. into a fermentation medium for fermentation culture to obtain a fermentation product of the MHHJ-3 Nectria sp.; The fermented product of the MHHJ-3 Nectria sp. is mixed with alcohol and then subjected to ultrasonic extraction to obtain an alcohol extract.

6. The preparation method according to claim 5, It is characterized in that The fermentation medium is sterilized potato; the temperature of the fermentation culture is 18-25°C and the time is 28-32 days.

7. The preparation method according to claim 5, It is characterized in that The mass ratio of the fermented product of MHHJ-3 Nectria sp. to the volume ratio of alcohol is (30-80) g: (50-150) mL; the frequency of the ultrasonic extraction is 40 kHz, and the time is 30-40 min.

8. Use of the steroidal compound nectriasteroid A according to claim 1 or the steroidal compound nectriasteroid A prepared by the preparation method according to any one of claims 2 to 7 in the preparation of antitumor drugs.

9. The use according to claim 8, It is characterized in that The tumor includes one or more of lung cancer, breast cancer, liver cancer, leukemia and colon cancer.

10. A Nectria sp. (Nectria pseudotrichia) MHHJ-3, the deposit number of which is CCTCC M 2023223.

Citation Information

Patent Citations

  • 5alpha-reductase inhibitor dicephalosterol

    JP1997067393A

  • Nerve trunk cell propagation accelerator

    WO2009096445A1