A cell line for lentivirus production and preparation method thereof

Abstract

The present invention provides a cell line for lentivirus production and a preparation method thereof. Specifically, a lentivirus stable packaging cell line is provided, wherein the packaging plasmid group is composed of a pREV-rtTAtTS-puro plasmid, a pVSVG-Hyg plasmid, a pGagPol-BSD plasmid and a CMV-PBtransposase plasmid. A preparation method thereof and a lentivirus stable production cell line based thereon are also provided.

Description

Technical Field

[0001] The present invention relates to the field of lentiviral vectors, more specifically to the field of lentiviral vector preparation, and in particular to a lentiviral stable production cell line and a preparation method thereof. Background Art

[0002] Lentivirus mainly includes human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), equine infectious anemia (EIA), feline immunodeficiency virus (FIV) and other viruses. Unlike other retroviral vectors, lentiviral vectors can effectively infect various types of cells such as neurons, hepatocytes, cardiomyocytes, tumor cells, endothelial cells, stem cells, etc., and can effectively integrate exogenous genes into host chromosomes to achieve persistent expression, thereby achieving good gene therapy effects, so it has broad application prospects.

[0003] At present, the preparation method of lentiviral vector is generally to produce it by transiently transfecting cells with auxiliary plasmids and lentiviral vector plasmids. However, the lentivirus produced by this production process has many residual impurities, low virus titer, unstable virus yield between batches, and high production costs. Therefore, it is urgent to provide efficient, stable, large-scale production of lentivirus packaging cell lines and production cell lines and their preparation methods. Summary of the invention

[0004] The purpose of the present invention is to provide a packaging cell line and a production cell line that can be used for efficient, stable and large-scale production of lentiviruses and a preparation method thereof.

[0005] In a first aspect, the present invention provides a lentiviral stable packaging cell line, comprising a packaging plasmid group, wherein the packaging plasmid group consists of a pREV-rtTAtTS-puro plasmid, a pVSVG-Hyg plasmid, a pGagPol-BSD plasmid and a CMV-PBtransposase plasmid;

[0006] The pREV-rtTAtTS-puro plasmid contains rtTA, tTS and REV genes, the pVSVG-Hyg plasmid contains the VSVG gene, the pGagPol-BSD plasmid contains the GagPol gene, and the CMV-PBtransposase plasmid contains the PBtransposase gene;

[0007] Wherein, the sequence of the rtTA gene is shown in SEQ ID NO: 9, the sequence of the tTS gene is shown in SEQ ID NO: 8, and the sequence of the REV gene is shown in SEQ ID NO: 6;

[0008] The sequence of the VSVG gene is shown in SEQ ID NO: 11;

[0009] The sequence of the GagPol gene is shown in SEQ ID NO: 13; and

[0010] The sequence of the PBtransposase gene is shown in SEQ ID NO:18.

[0011] In another preferred embodiment, the pREV-rtTAtTS-puro plasmid further comprises a cHS4 insulator gene, a CBh promoter, a CMV promoter, a Tight promoter, a puromycin resistance gene puroR and a polyadenylation signal;

[0012] The pVSVG-Hyg plasmid also contains the PiggyBac transposon 5'ITR sequence gene, the 3'ITR sequence gene, the cHS4 insulator core gene, the Tight promoter, the intron, the hPGK promoter, the hygromycin resistance gene HygR and the polyadenylation signal;

[0013] The pGagPol-BSD plasmid further comprises a PiggyBac transposon 5'ITR sequence gene, a 3'ITR sequence gene, a cHS4 insulator core gene, a Tight promoter, an intron, an SV40 promoter, a blasticidin resistance gene BSDR, a cPPT / CTS element, an RRE element and a polyadenylation signal; and

[0014] The CMV-PB transposase plasmid also contains the cHS4 insulator core gene and a polyadenylation signal.

[0015] In another preferred example, the sequence of the cHS4 insulator gene is shown in SEQ ID NO: 5, the sequence of the codon-optimized puromycin resistance gene puroR is shown in SEQ ID NO: 7, the sequence of the cHS4 insulator core gene is shown in SEQ ID NO: 10, the sequence of the codon-optimized hygromycin resistance gene HygR is shown in SEQ ID NO: 12, the sequence of the blasticidin resistance gene BSDR is shown in SEQ ID NO: 14, the sequence of the PiggyBac transposon 5'ITR gene is shown in SEQ ID NO: 15, the sequence of the PiggyBac transposon 3'ITR gene is shown in SEQ ID NO: 16, and the sequence of the Tight promoter gene is shown in SEQ ID NO: 17.

[0016] In another preferred example, the sequence of the pREV-rtTAtTS-puro plasmid is shown as SEQ ID NO: 1, the sequence of the pVSVG-Hyg plasmid is shown as SEQ ID NO: 2, the sequence of the pGagPol-BSD plasmid is shown as SEQ ID NO: 3, and the sequence of the CMV-PBtransposase plasmid is shown as SEQ ID NO: 4.

[0017] In another preferred embodiment, the cell line is selected from one of HEK293, HEK293-T, HEK293-SF, TE671, HT1080 or HeLa cell lines.

[0018] In another preferred embodiment, the cell line is HEK293T cell line.

[0019] In another preferred embodiment, the cell line is a cell line with a deposit number of CGMCC No.:45528.

[0020] The second aspect of the present invention provides a method for preparing a lentiviral stable packaging cell line as described in the first aspect of the present invention, wherein the method comprises the following steps:

[0021] The recipient cells are subjected to steps (i) and (ii) successively in any order:

[0022] i) linearizing the pREV-rtTAtTS-puro plasmid, transfecting cells with the linearized pREV-rtTAtTS-puro plasmid, and adding a first antibiotic for screening to obtain a first positive mixed cell;

[0023] ii) co-transfecting cells with pVSVG-Hyg plasmid, pGagPol-BSD plasmid and CMV-PBtransposase plasmid; and adding a second antibiotic for screening to obtain a second positive mixed cell;

[0024] Wherein, when step i) is performed first, the first antibiotic is puromycin; the second antibiotic is a combination of puromycin, hygromycin and blasticidin; and

[0025] When step ii) is performed first, the second antibiotic is hygromycin and blasticidin; the first antibiotic is a combination of puromycin, hygromycin and blasticidin;

[0026] The cells whose screening results in step i) and step ii) are both positive are the lentiviral stable packaging cell lines.

[0027] Step i) and step ii), in another preferred embodiment, the method further comprises the step of: further sorting out monoclonal cells from cells with positive screening results in both step i) and step ii) as the lentivirus stable packaging cell line.

[0028] In another preferred embodiment, in step i) and / or step ii), the transfection is performed in the presence of a transfection reagent, preferably, the transfection reagent is polyethyleneimine.

[0029] In another preferred embodiment, in step i), the process of transfecting cells with the linearized pREV-rtTAtTS-puro plasmid is carried out in the presence of a transfection reagent polyethyleneimine, and the mass ratio of polyethyleneimine to plasmid is: polyethyleneimine: pREV-rtTAtTS-puro plasmid = (1-4):1.

[0030] And / or, in step ii), the process of co-transfecting cells with pVSVG-Hyg plasmid, pGagPol-BSD plasmid and CMV-PBtransposase plasmid is carried out in the presence of transfection reagent polyethyleneimine, and the mass ratio of the polyethyleneimine to the total amount of (pVSVG-Hyg plasmid + pGagPol-BSD plasmid + CMV-PBtransposase plasmid) is (1-4):1.

[0031] In another preferred embodiment, the mass ratio of the polyethyleneimine to the pREV-rtTAtTS-puro plasmid is (1-2):1, preferably 1.5:1.

[0032] In another preferred embodiment, the mass ratio of the polyethyleneimine to the total amount of (pVSVG-Hyg plasmid+pGagPol-BSD plasmid+CMV-PBtransposase plasmid) is (1-2):1, preferably 1.5:1.

[0033] In another preferred embodiment, in step i), the amount of the pREV-rtTAtTS-puro plasmid is (0.5-3) μg / 10 6 cells; preferably, (1-2) μg / 10 6 cells, more preferably, 1.5 μg / 10 6 cells.

[0034] In another preferred embodiment, in step ii), the total amount of the (pVSVG-Hyg plasmid + pGagPol-BSD plasmid + CMV-PBtransposase plasmid) is (0.5-4) μg / 10 6 cells, preferably, (1-3) μg / 10 6 cells, more preferably, 2 μg / 106 cells.

[0035] In another preferred embodiment, in step ii), when the (pVSVG-Hyg plasmid + pGagPol-BSD plasmid + CMV-PBtransposase plasmid) is co-transfected into cells, the molar plasmid ratio of the transposon plasmid (pVSVG-Hyg plasmid + pGagPol-BSD plasmid) to the transposase plasmid (CMV-PBtransposase plasmid) is transposon plasmid: transposase plasmid = (1-6):1, preferably (2.5-5):1, and more preferably 4:1.

[0036] In another preferred embodiment, in step ii), when the (pVSVG-Hyg plasmid + pGagPol-BSD plasmid + CMV-PBtransposase plasmid) is co-transfected into cells, the molar plasmid ratio of the pVSVG-Hyg plasmid to the pGagPol-BSD plasmid is pVSVG-Hyg plasmid: pGagPol-BSD plasmid = 1:(0.5~4), preferably 1:(0.5~3), and more preferably 1:(1~2) or 1:1.

[0037] In another preferred embodiment, in step i) and / or step ii), the concentrations of puromycin, hygromycin and blasticidin in the first and second antibiotics are independently 0.5-3 μg / mL, 100-300 μg / mL and 10-20 μg / mL, respectively. Preferably, the concentrations of puromycin, hygromycin and blasticidin are independently 1-2 μg / mL, 100-200 μg / mL and 10-20 μg / mL, respectively.

[0038] In another preferred embodiment, step i) is performed first and then step ii), or step ii) is performed first and then step i).

[0039] In a third aspect, the present invention provides a lentivirus stable production cell line, which is obtained by a method comprising the following steps: transfecting a plasmid containing a viral packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as described in the first aspect of the present invention and screening cells in which the target gene is stably integrated, thereby constructing a lentivirus stable production cell line.

[0040] In a fourth aspect, the present invention provides a method for constructing a lentivirus stable production cell line, comprising the steps of transfecting a plasmid containing a viral packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as described in the first aspect of the present invention and screening cells in which the target gene is stably integrated, thereby constructing a lentivirus stable production cell line.

[0041] In a fifth aspect, the present invention provides a method for producing a lentivirus, comprising the steps of transfecting a plasmid containing a viral packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as described in the first aspect of the present invention and screening cells in which the target gene is stably integrated, thereby constructing a lentivirus stable production cell line, and then adding an inducer to induce the lentivirus stable production cell line to produce lentivirus.

[0042] In another preferred embodiment, the inducer is doxycycline.

[0043] In another preferred embodiment, the inducer is added 20 to 30 hours after cell inoculation, preferably 24 hours after transfection.

[0044] In another preferred embodiment, the inducing agent is added at a concentration of 1 to 5 μg / mL, preferably 2 μg / mL.

[0045] In another preferred embodiment, an enhancer is added during the lentivirus production process to increase the expression level of the lentivirus;

[0046] The enhancer is sodium butyrate;

[0047] And / or, the lentivirus is collected 42 to 62 hours after transfection.

[0048] In another preferred embodiment, the concentration of the enhancer added is 1-4 mM, preferably 1.5 mM.

[0049] In another preferred embodiment, the enhancer is added 20 to 30 hours after cell inoculation, preferably 24 hours after transfection.

[0050] In another preferred embodiment, the lentivirus is collected 48 hours after induction.

[0051] In a sixth aspect, the present invention provides a lentivirus stable production cell line, wherein the cell line is produced by transfecting a plasmid containing a viral packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as described in the first aspect of the present invention and screening cells in which the target gene is stably integrated, wherein the plasmid containing the viral packaging target gene comprises a pTol2-pLv-GOI-Bleo plasmid, and the transposase plasmid is a CMV-Tol2transposase plasmid.

[0052] In another preferred embodiment, the pTol2-Lv-GOI-Bleo plasmid further comprises a 5'IR sequence gene, a 3'IR sequence gene, a CMV promoter, a virus packaging transcription cassette, a WPRE gene and a polyadenylation signal;

[0053] The CMV-Tol2 transposase plasmid also contains a CMV promoter and a polyadenylation signal.

[0054] In another preferred embodiment, the sequence of the 5'IR gene is shown as SEQ ID NO: 21, and the sequence of the 3'IR gene is shown as SEQ ID NO: 22.

[0055] In another preferred embodiment, the sequence of the CMV-Tol2 transposase plasmid is shown as SEQ ID NO: 20.

[0056] In another preferred example, the target gene is GFP, the promoter is CMV, and the pTol2-Lv-GOI-Bleo plasmid packages the CMV-GFP gene to form the plasmid pTol2-Lv-CMV-GFP-Bleo, whose sequence is shown in SEQ ID NO: 19.

[0057] In the seventh aspect of the present invention, a method for preparing the lentivirus stable production cell line according to the sixth aspect of the present invention is provided, which comprises the following steps: 1) co-transfecting the stable packaging cell line according to the first aspect of the present invention with the pTol2-lv-GOI-Bleo plasmid (including or not including the virus packaging target gene) and the CMV-Tol2transposase plasmid, and adding a third antibiotic for screening and sorting to obtain cloned cells, i.e., the lentivirus stable production cell line; wherein the third antibiotic is a combination of puromycin, hygromycin, blasticidin and bleomycin.

[0058] In another preferred embodiment, the stable packaging cell line is a mixed cell or a monoclonal cell.

[0059] In another preferred embodiment, the bleomycin is bleomycin hydrochloride.

[0060] In another preferred embodiment, in step 1), polyethyleneimine is also added during the co-transfection of the pTol2-lv-GOI-Bleo plasmid and the CMV-Tol2transposase plasmid into the lentiviral stable packaging cell line, and the mass ratio of the polyethyleneimine to (pTol2-lv-GOI-Bleo plasmid + CMV-Tol2transposase plasmid) is (1-4):1.

[0061] In another preferred embodiment, the mass ratio of polyethyleneimine to plasmid is: polyethyleneimine: (pTol2-lv-GOI-Bleo plasmid + CMV-Tol2transposase plasmid) = (1-2): 1, preferably, 1.5:1.

[0062] In another preferred embodiment, in step 1), the total amount of the (pTol2-lv-GOI-Bleo plasmid + CMV-Tol2 transposase plasmid) is (0.5-4) μg / 10 6 The optimal value is (1-3) μg / 10 6 cells, more preferably 2 μg / 10 6 cells.

[0063] In another preferred embodiment, in step 1), when the (pTol2-lv-GOI-Bleo plasmid + CMV-Tol2transposase plasmid) is co-transfected into cells, the molar plasmid ratio of the transposon plasmid (pTol2-lv-GOI-Bleo) to the transposase plasmid (CMV-Tol2transposase plasmid) is transposon plasmid: transposase plasmid = 1:(1-6), preferably 1:(1-4), more preferably 1:1.

[0064] In another preferred embodiment, in step 1), the dosage of puromycin, hygromycin, blasticidin and bleomycin in the third antibiotic is 1 μg / mL, 150ug / ml, 10ug / ml and 400-800ug / ml respectively; preferably, it is 1 μg / mL, 150ug / ml, 10ug / ml and 400-600ug / ml respectively, and more preferably, it is 1 μg / mL, 150ug / ml, 10ug / ml and 500ug / ml respectively.

[0065] In an eighth aspect, the present invention provides a method for producing a lentivirus, comprising: adding an inducer to the production cell described in the sixth aspect of the present invention to induce a lentivirus stable production cell line to produce a lentivirus.

[0066] In another preferred embodiment, the inducer is doxycycline.

[0067] In another preferred embodiment, the inducer is added 20 to 30 hours after cell inoculation, preferably 24 hours after transfection.

[0068] In another preferred embodiment, the inducing agent is added at a concentration of 1 to 5 μg / mL, preferably 2 μg / mL.

[0069] In another preferred embodiment, an enhancer is added during the lentivirus production process to increase the expression level of the lentivirus;

[0070] The enhancer is sodium butyrate;

[0071] And / or, the lentivirus is collected 42 to 62 hours after transfection.

[0072] In another preferred embodiment, the concentration of the enhancer added is 1-4 mM, preferably 1.5 mM.

[0073] In another preferred embodiment, the enhancer is added 20 to 30 hours after cell inoculation, preferably 24 hours after transfection.

[0074] In another preferred embodiment, the lentivirus is collected 48 hours after induction.

[0075] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] Figure 1 Plasmid maps constructed for packaging cell lines; a is the plasmid map of pREV-rtTAtTS-puro plasmid, b is the plasmid map of pVSVG-Hyg plasmid, c is the plasmid map of pGagPol-BSD plasmid, and d is the plasmid map of CMV-PBtransposase plasmid;

[0077] Figure 2 Plasmid maps constructed for production cell lines; a is the plasmid map of pTol2-Lv-CMV-GFP-Bleo plasmid, and b is the plasmid map of CMV-Tol2transposase plasmid;

[0078] Figure 3 This is the result diagram of the effect of different transfection ratios of GAGPOL and VSVG plasmids on the toxin titer of the cell line;

[0079] Figure 4 This is the result diagram of the effect of the total amount of GAGPOL and VSVG plasmid transfection on the toxin titer of the cell line;

[0080] Figure 5 The results of the toxicity titer of different monoclonal cells in the stable packaging cell line;

[0081] Figure 6 Results of the toxicity titer of different monoclonal cells for stable production cell lines;

[0082] Figure 7 This is a graph showing the effect of transfection plasmid on the toxicity of the cell line after the Clone4 monoclonal cell is supplemented;

[0083] Figure 8 This is the result of the passage stability of Clone4 monoclonal cells;

[0084] Fig. 9This is the result diagram of the toxin production stability of Clone4 monoclonal cells;

[0085] Fig.10 These are the results of the gene copy number stability of Clone4 monoclonal cells; a is the result of the copy number stability of REV gene of Clone4 monoclonal cells, b is the result of the copy number stability of VSVG gene of Clone4 monoclonal cells, and c is the result of the copy number stability of GAGPOL gene of Clone4 monoclonal cells. DETAILED DESCRIPTION

[0086] After extensive and in-depth research, a large number of screening and tests, the inventors have provided a packaging cell line and a production cell line based on the packaging cell line that can be used for efficient, stable and large-scale production of lentiviruses and a preparation method thereof. The inventors unexpectedly found that after placing the genetic elements of lentivirus packaging in a plasmid in a specific manner according to the present invention and transfecting cells, the resulting packaging cell line and the production cell line based on the packaging cell line have excellent toxin production capabilities, and can produce up to 10 7 The virus titer of TU / mL is very suitable for the production of lentiviral vectors. On this basis, the present invention was completed.

[0087] the term

[0088] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0089] As used herein, when used in reference to a specific recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0090] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0091] As used herein, the term "room temperature" or "normal temperature" refers to a temperature of 4-40°C, preferably, 25±5°C.

[0092] Lentiviral Stable Packaging Cell Line

[0093] A lentivirus stable packaging cell line, comprising a packaging plasmid group, wherein the packaging plasmid group consists of a pREV-rtTAtTS-puro plasmid, a pVSVG-Hyg plasmid, a pGagPol-BSD plasmid and a CMV-PBtransposase plasmid;

[0094] The pREV-rtTAtTS-puro plasmid contains rtTA, tTS and REV genes, the pVSVG-Hyg plasmid contains VSVG gene, the pGagPol-BSD plasmid contains GagPol gene, and the CMV-PBtransposase plasmid contains PBtransposase gene;

[0095] Wherein, the sequence of the rtTA gene is shown in SEQ ID NO: 9, the sequence of the tTS gene is shown in SEQ ID NO: 8, and the sequence of the REV gene is shown in SEQ ID NO: 6;

[0096] The sequence of the VSVG gene is shown in SEQ ID NO: 11;

[0097] The sequence of the GagPol gene is shown in SEQ ID NO: 13; and

[0098] The sequence of the PBtransposase gene is shown in SEQ ID NO:18.

[0099] The pREV-rtTAtTS-puro plasmid, pVSVG-Hyg plasmid, pGagPol-BSD and CMV-PBtransposase plasmid of the present invention can be constructed based on a commercial plasmid backbone and then inserting the target gene, or the preferred specific gene of the present invention and the commonly used plasmid elements in the field can be obtained by total plasmid synthesis. For example, the specific genes in the pREV-rtTAtTS-puro plasmid include the REV gene (which encodes a viral particle protein expression regulatory factor), rtTA and tTS genes (tetracycline inducible system stable opening and closing genes), the sequence of the REV gene is shown in SEQ ID NO: 6, the sequence of the rtTA gene is shown in SEQ ID NO: 9, and the sequence of the tTS gene is shown in SEQ ID NO: 8; the specific genes of the pVSVG-Hyg plasmid include the VSVG (vesicular stomatitis virus glycoprotein) gene, and the sequence of the VSVG gene is shown in SEQ ID NO: 11; the specific genes of the pGagPol-BSD plasmid include GagPol (Gag gene encodes the viral capsid protein, and Pol gene encodes the viral reverse transcriptase and gene integrase), and the sequence of the GagPol gene is shown in SEQ ID NO: 13; the specific genes of the CMV-PBtransposase plasmid include PBtransposase (PiggyBac transposase), and the sequence of the PBtransposase gene is shown in SEQ ID NO: 18.

[0100] Preferably, the pREV-rtTAtTS-puro plasmid further comprises a cHS4 insulator gene, a CBh promoter, a CMV promoter, a Tight promoter, a puromycin resistance gene puroR and a polyadenylation signal.

[0101] Preferably, the pVSVG-Hyg plasmid further comprises a PiggyBac transposon 5'ITR sequence gene, a 3'ITR sequence gene, a cHS4 insulator core gene, a Tight promoter, an intron, an hPGK promoter, a hygromycin resistance gene HygR and a polyadenylation signal.

[0102] Preferably, the pGagPol-BSD plasmid further comprises a PiggyBac transposon 5'ITR sequence gene, a 3'ITR sequence gene, a cHS4 insulator core gene, a Tight promoter, an intron, a SV40 promoter, a blasticidin resistance gene BSDR, a cPPT / CTS element, an RRE element and a polyadenylation signal.

[0103] Preferably, the CMV-PB transposase plasmid further comprises a cHS4 insulator core gene and a polyadenylation signal.

[0104] Unless otherwise specified, the specific sequence of the gene of the present invention is known to those skilled in the art.

[0105] In another preferred example, the sequence of the pREV-rtTAtTS-puro plasmid is shown as SEQ ID NO: 1, the sequence of the pVSVG-Hyg plasmid is shown as SEQ ID NO: 2, the sequence of the pGagPol-BSD plasmid is shown as SEQ ID NO: 3, and the sequence of the CMV-PBtransposase plasmid is shown as SEQ ID NO: 4.

[0106] In another preferred embodiment, the cell line that can be used as the recipient cell of the present invention is preferably selected from HEK293, HEK293-T, HEK293-SF, TE671, HT1080 or HeLa cell lines, preferably HEK293T cell line.

[0107] In another preferred embodiment, the lentiviral stable packaging cell line of the present invention is an adherent culture cell or a suspension cell.

[0108] In another preferred embodiment, the lentiviral stable packaging cell line is a mixed cell or a monoclonal cell, preferably a monoclonal cell.

[0109] A particularly preferred lentivirus stable packaging cell line of the present invention is a cell line with a deposit number of CGMCC No.: 45528. Experiments have shown that the toxin titer of the cell is > 4×10 7 TU / mL.

[0110] The present invention has conducted stability research on the constructed lentiviral stable packaging cell line, including passage stability, toxin production stability and copy number stability. The experimental results show that the constructed lentiviral stable packaging cell line can be stably passed down and inherited without screening pressure (without adding antibiotics), and it can be stably passed down for more than 30 generations without screening pressure; the cells that are passed down without adding antibiotics can be normally inherited and have the ability to produce toxins; the copy numbers of GagPol gene, VSVG gene and Rev gene are relatively stable. That is, the lentiviral stable packaging cell line constructed by the present invention has excellent properties in terms of passage, toxin production and genetic gene copy number.

[0111] Method for preparing stable lentiviral packaging cell line

[0112] The present invention also provides a method for preparing the above-mentioned lentiviral stable packaging cell line, which comprises the following steps:

[0113] Subject recipient cells to steps (i) and (ii) in any order:

[0114] i) linearizing the pREV-rtTAtTS-puro plasmid, transfecting cells with the linearized pREV-rtTAtTS-puro plasmid, and adding a first antibiotic for screening to obtain a first positive mixed cell;

[0115] ii) co-transfecting cells with pVSVG-Hyg plasmid, pGagPol-BSD plasmid and CMV-PBtransposase plasmid; and adding a second antibiotic for screening to obtain a second positive mixed cell;

[0116] Wherein, when step i) is performed first, the first antibiotic is puromycin; the second antibiotic is a combination of puromycin, hygromycin and blasticidin; and

[0117] When step ii) is performed first, the second antibiotic is hygromycin and blasticidin; the first antibiotic is a combination of puromycin, hygromycin and blasticidin;

[0118] The cells whose screening results in step i) and step ii) are both positive are the lentiviral stable packaging cell lines.

[0119] Those skilled in the art will appreciate that the transfection order of the plasmids can be adjusted as needed, and the antibiotics used for screening can be adjusted accordingly. Cells transfected with each plasmid can be obtained by first performing step i) and then performing step ii), or first performing step ii) and then performing step i). In step ii), each plasmid can also be transfected separately or co-transfected in different combinations.

[0120] Usually, in step i) and / or step ii), the transfection is performed in the presence of a transfection reagent. The present invention has no special requirements for the transfection reagent, and a commonly used transfection reagent in the present invention, such as polyethyleneimine, can be used.

[0121] In step i), the linearization can be achieved by restriction endonuclease.

[0122] Lentivirus stable production cell line and construction method thereof, and lentivirus stable production method

[0123] The present invention also provides a lentivirus stable production cell line, which is obtained by a method comprising the following steps: transfecting a plasmid containing a virus packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as described in the first aspect of the present invention and screening cells in which the target gene is stably integrated, thereby constructing a lentivirus stable production cell line.

[0124] The present invention also provides a method for constructing a lentivirus stable production cell line, comprising the steps of transfecting a plasmid containing a viral packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as described in the first aspect of the present invention and screening cells in which the target gene is stably integrated, thereby constructing a lentivirus stable production cell line.

[0125] The present invention also provides a method for producing lentivirus using the above-mentioned lentivirus stable production cell line, comprising the steps of transfecting a plasmid containing a virus packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as described in the first aspect of the present invention and screening cells in which the target gene is stably integrated, thereby constructing a lentivirus stable production cell line, and then adding an inducer to induce the lentivirus stable production cell line to produce lentivirus.

[0126] Preferably, antibiotics can be added for screening according to the type of resistance gene, thereby obtaining target cells.

[0127] Whether the target gene is stably integrated can be evaluated by detecting whether the cell can stably express the corresponding gene, which is well known to those skilled in the art.

[0128] The lentivirus stable production cell line of the present invention comprises a tetracycline-induced expression system. When producing lentivirus, doxycycline (dox) can be added to induce toxin production. It is also found that adding sodium butyrate during the toxin production process can increase the yield of lentivirus.

[0129] The present invention provides a specific lentivirus stable production cell line, which is obtained by transfecting a plasmid containing a virus packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as described in the first aspect of the present invention, and screening cells with stable integration of the target gene, wherein the plasmid containing the virus packaging target gene includes a pTol2-Lv-GOI-Bleo plasmid, and the transposase plasmid is a CMV-Tol2transposase plasmid.

[0130] The pTol2-Lv-GOI-Bleo plasmid is an empty plasmid that does not contain the target gene. When the target gene is packaged, the plasmid containing the virus-packaged target gene can be formed.

[0131] For example, a target gene commonly used in an experiment is the GFP (green fluorescent protein) gene, and the promoter is CMV. The sequence of the plasmid pTol2-Lv-CMV-GFP-Bleo formed after the pTol2-Lv-GOI-Bleo plasmid packages the CMV-GFP gene is shown in SEQ ID NO: 19.

[0132] Typically, the lentivirus stable production cell line comprising the pTol2-Lv-GOI-Bleo plasmid (a plasmid not comprising the target gene or a plasmid comprising the target gene) and the CMV-Tol2transposase plasmid can be prepared by the following method, which comprises the following steps: 1) co-transfecting the pTol2-lv-GOI-Bleo plasmid and the CMV-Tol2transposase plasmid into a stable packaging cell line mixed cell, and adding a third antibiotic for screening and sorting to obtain monoclonal cells, i.e., a lentivirus stable production cell line; wherein the third antibiotic is a combination of puromycin, hygromycin, blasticidin and bleomycin hydrochloride.

[0133] Typically, the lentivirus stable production cell line constructed using the pTol2-Lv-GOI-Bleo plasmid and the CMV-Tol2 transposase plasmid is induced by an inducer to stably produce the lentivirus. Preferably, the inducer is doxycycline.

[0134] The main advantages of the present invention include:

[0135] The lentiviral stable production cell line constructed by the present invention can produce lentiviral vectors by directly inducing cells without the need for plasmids and transfection reagents, thus greatly reducing the production cost of viral vectors.

[0136] The stable lentivirus production cell line constructed by the present invention has a stable process for producing lentivirus, and the difference between batches of lentivirus products is small;

[0137] The stable lentivirus production cell line constructed by the present invention is easy to scale up when producing lentivirus, and has high yield.

[0138] The present invention will be further described below in conjunction with specific implementation. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0139] Example 1: Plasmid construction method

[0140] 1.1 Construction of pREV-rtTAtTS-puro, pVSVG-Hyg, pGagPol-BSD and CMV-PBtransposase plasmids

[0141] The lentiviral stable packaging cell line constructed in this example is composed of four plasmids, namely, pREV-rtTAtTS-puro plasmid (comprising REV, rtTA and tTS genes), pVSVG-Hyg plasmid (comprising VSVG gene), pGagPol-BSD plasmid (comprising gagpol gene) and CMV-PBtransposase plasmid (comprising PiggyBac transposase PBtransposase gene). The plasmid maps thereof are respectively shown in Figure 1 a, b, c and d.

[0142] 1.1.1 Construction of pREV-rtTAtTS-puro plasmid: The whole plasmid was synthesized (Qingke Biosynthesis).

[0143] 1.1.2 Construction of pGagPol-BSD plasmid: The KANA-ori gene fragment was obtained by primers 3ITR-ORI-F and 5ITR-Amppro-R and template pREV-rtTAtTS-puro plasmid, the CHS4-3ITR gene fragment was obtained by primers bgPA-CHS4-F and Ori-3ITR-R and template pPB-ITR-CHS4-Tight plasmid (Golden Weichi Biosynthesis), and the 5ITR-Tight gene fragment was obtained by primers Amppro-5ITR-F and Intron-Tight-R and template pPB-ITR-CHS4-Tight plasmid (Qingke Biosynthesis). The above fragments were ligated between the FspI and BamHI restriction sites of plasmid pGAGPOL-KANA (Golden Weichi Biosynthesis) by homologous recombination to construct plasmid pGagPol-BSD-1 and sequenced for verification. The SV40-BSD gene fragment was obtained using primers bgPA-sv40pro-F and CHS4-sv40PA-R and a template psv40-BSD plasmid (Qingke Biosynthesis). The SV40-BSD gene fragment was ligated to the FspI restriction site of the plasmid pGagPol-BSD-1 by homologous recombination to construct the plasmid pGagPol-BSD and sequenced for verification.

[0144]

[0145] 1.1.3 Construction of pVSVG-Hyg plasmid: pGagPol-BSD plasmid and pVSVG-KANA plasmid were double-digested with BamHI and FspI, respectively, and the corresponding fragments were recovered. The fragments recovered by digestion were ligated with T4 ligase to construct plasmid pVSVG-1 plasmid and sequenced for verification. The PGK-Hyg-sv40PA gene fragment was obtained by primers bgPA-PGK-F and 3ITR-sv40PA-R and template pPGK-Hyg-sv40PA plasmid (Qingke Biosynthesis), and the PGK-Hyg-sv40PA gene fragment was ligated between the NotI and XbaI restriction sites of pVSVG-1 plasmid by homologous recombination to construct pVSVG-Hyg plasmid and sequenced for verification.

[0146]

[0147] 1.1.4 Construction of CMV-PB transposase plasmid: The KANA-ori gene fragment was obtained using primers ORI-F and Apmpro-R and template pREV-rtTAtTS-puro plasmid, the CHS4-rPolr2A gene fragment was obtained using primers Apmpro-CHS4-F and sv40Intron-R and template Super PiggyBac Transposase plasmid (SBI-PB200PA-1), and the transposase gene fragment was obtained using primers sv40Intron-transposase-F and ORI-sv40PA-R and template Super PiggyBac Transposase plasmid (SBI-PB200PA-1). The above three fragments were connected using the homologous recombination method to construct the CMV-PB transposase plasmid and sequenced for verification.

[0148]

[0149] 1.2 Construction of pTol2-Lv-GOI-Bleo plasmid and CMV-Tol2transposase plasmid The lentiviral stable production cell line constructed in this example is composed of two plasmids, pTol2-Lv-CMV-GFP-Bleo plasmid (containing the lentiviral genome transcription and packaging target gene GFP) and CMV-Tol2transposase plasmid (containing the Tol2 transposase Tol2transposase gene).

[0150] 1.2.1 Construction of pTol2-Lv-CMV-GFP-Bleo plasmid: The KANA-ori gene fragment was obtained by primers 3LTR-ORI-F and 5IR-Amppro-R and template pREV-rtTAtTS-puro plasmid, the 5IR gene fragment was obtained by primers Amppro-5IR-F and CMV-5IR-R and template pminiTol2 plasmid (ADDGENE-31829), and the CMV-PAI gene fragment was obtained by primers 5IR-CMV-F and RRE-PAI-R and template pTK945 plasmid (Qingke Biosynthesis). The above fragments were ligated between the ApaI and NotI restriction sites of plasmid pTK945 plasmid (Qingke Biosynthesis) by homologous recombination to construct plasmid pLv-GOI-1 and sequenced for verification. The bgPA gene fragment was obtained by primers 3LTR-bgPA-F and sv40pro-bgPA-R and template pTK945 plasmid (Qingke Biosynthesis), the SV0pro-Bleo-sv40PA gene fragment was obtained by primers bgPA-sv40pro-F2 and 3IR-sv40PA-R and template pSV0pro-Bleo-sv40PA plasmid (Qingke Biosynthesis), and the 3IR gene fragment was obtained by primers sv40pro-3IR-F and ORI-3IR-R and template pminiTol2 plasmid (ADDGENE-31829). The above gene fragments were ligated between the ApaI restriction sites of plasmid pLv-GOI-1 by homologous recombination to construct plasmid

[0151] pTol2-Lv-CMV-GFP-Bleo was verified by sequencing.

[0152]

[0153] 1.2.2 Construction of CMV-Tol2 transposase plasmid: The KANA-ori gene fragment was obtained using primers sv40PA-ORI-F and CMV-Amppro-R and the template pREV-rtTAtTS-puro plasmid. The above fragment was ligated to the SphI restriction site of the plasmid pCMV-Tol2 plasmid (ADDGENE-31823) by homologous recombination to construct the plasmid CMV-Tol2 transposase and sequenced for verification.

[0154]

[0155] Example 2: Construction of a stable lentiviral packaging cell line

[0156] 2.1PB transposon transfection gagpol and VSVG plasmid transfection conditions

[0157] 2.1.1 Transfection ratio of gagpol and VSVG plasmids

[0158] This embodiment uses the PB transposon tool to stably integrate the gagpol and VSVG genes into the cell genome. There is an optimal transfection ratio of gagpol and VSVG during transfection, and it affects the toxic value of the cell line. 293T cells were inoculated into a 6-well plate (Corning, Catalog No.: 3516), 8E+05 cells per well, and after overnight culture, each well was transfected with different ratios of pVSVG-Hyg and pGagPol-BSD plasmids, as shown in Table 1, wherein the ratio of plasmid to transfection reagent PEI (polyethyleneimine) (Polyplus, Catalog No.: 115-010) during transfection was total plasmid amount (ug): PEI = 1: 1.5. After 48 hours of transfection, the transfected cells were digested and inoculated into a T75 culture flask (Corning, Catalog No.: 430641), with an inoculation density of 4E+04 / cm 2 24 hours after inoculation, the culture medium containing 15μg / mL BSD (blasticidin) (YEASEN, catalog number: 60218ES10) and 200μg / mL Hyg (hygromycin) (YEASEN, catalog number: 60224ES03) antibiotics was replaced for pressure screening. The screening medium was replaced every 3-4 days. After 2 weeks of cell screening, the cells were inoculated in 6-well plates and transfected with pREV-rtTAtTS-puro and pTol2-Lv-CMV-GFP-Bleo plasmids to package the virus. The virus was collected 48 hours after transfection to detect the titer. The toxicity value of the cell lines constructed by different transfection ratios of gagpol and VSVG plasmids was compared. The results are shown in Figure 3 , indicating that the cell line constructed when the transfection ratio of VSVG to gagpol was 1:1 had the highest toxic value.

[0159] Table 1

[0160]

[0161] 2.1.2. Transfection amount of gagpol and VSVG plasmids

[0162] 293T cells were inoculated into 6-well plates, with 8E+05 cells per well. After overnight culture, each well was transfected with different total amounts of CMV-PBTransposase, pVSVG-Hyg and pGagPol-BSD plasmids, as shown in Table 2. The ratio of plasmid to transfection reagent PEI (polyethyleneimine) during transfection was total amount of plasmid (ug): PEI = 1:1.5. After 48 hours of transfection, the transfected cells were digested and inoculated into T75 culture flasks at an inoculation density of 4E+04 / cm 224 hours after inoculation, the medium containing 15μg / mL BSD (blasticidin) and 200μg / mL Hyg (hygromycin) antibiotics was replaced for pressure screening. The screening medium was replaced every 3-4 days. After 2 weeks of cell screening, the cells were inoculated in 6-well plates and transfected with pREV-rtTAtTS-puro and pTol2-Lv-CMV-GFP-Bleo plasmids to package the virus. The virus was collected 48 hours after transfection to detect the titer. The toxin production value of the cell lines constructed by transfection of different CMV-PBTransposase, pVSVG-Hyg and pGagPol-BSD plasmids was compared. The results are shown in Figure 4 , indicating that increasing the amount of plasmid transfection will increase the toxic value of the cell line, but continuing to increase the total amount of transfection after the total amount of transfection reaches 2ug / 1E+06 cells will not significantly increase the titer value.

[0163] Table 2

[0164]

[0165] 2.2 Preparation of stable lentiviral packaging cell lines

[0166] 293T cells were inoculated in T75 culture flasks at a seeding number of 6E+06 / flask. After culturing overnight, the pREV-rtTAtTS-puro plasmid constructed in Example 1 was linearized and dephosphorylated using pvuI (NEB, catalog number: #R3150S). The linearized pREV-rtTAtTS-puro plasmid and PEI (polyethyleneimine) were co-transfected into 293T cells. The amount of pREV-rtTAtTS-puro plasmid used during transfection was 1.5 μg / 10 6 cells, the PEI dosage was pREV-rtTAtTS-puro plasmid: PEI = 1:1.5, and the cells were re-inoculated into T175 culture flasks (Corning, catalog number: 431080) 48 hours after transfection, with an inoculation density of 4E+04 / cm 2 After the cells adhered overnight, the culture medium containing the antibiotic Puro (puromycin) (YEASEN, catalog number: 60210ES25) at a final concentration of 2 μg / mL was replaced for pressure screening. The screening culture medium was replaced every 3-4 days. After 10 days of cell screening, a drug-resistant positive stable cell pool was obtained, i.e., the first positive mixed cell. The first positive cells were inoculated in a 6-well plate, transfected with pVSVG-Hyg, pGagPol-BSD, and pTol2-Lv-CMV-GFP-Bleo plasmid packaging virus, and the virus was collected 48 hours after transfection to detect the titer.

[0167] After the titer test confirmed that the REV gene was stably integrated into the cells and could be stably expressed, the first positive mixed cells were inoculated in a 6-well plate, with 8E+05 cells per well. After culturing overnight, the pVSVG-Hyg, pGagPol-BSD and CMV-PBtransposase plasmids and PEI (polyethyleneimine) were co-transfected into the first positive mixed cells. The plasmid dosage during transfection (pVSVG-Hyg+pGagPol-BSD+CMV-PBtransposase) was 2 μg / 10 6 cells, the PEI dosage is (pVSVG-Hyg+pGagPol-BSD+CMV-PBtransposase) plasmid: PEI=1:1.5, and the cells are re-inoculated into T75 culture flasks 48 hours after transfection, with an inoculation density of 4E+04 / cm2. After the cells adhere to the wall overnight, the culture medium containing the final concentration of 2μg / mL Puro (puromycin), 15μg / mL BSD (blasticidin) and 200μg / mL Hyg (hygromycin) antibiotics is replaced for pressure screening. The cells are replaced with the screening culture medium every 3-4 days. After 2 weeks of cell screening, a drug-resistant positive stable cell pool is obtained, that is, a lentivirus stable packaging mixed cell. The polyclonal lentivirus stable packaging mixed cells are plated with cells by limiting dilution method in a 96-well plate (Falcon, catalog number: 353072), with 0.5 cells / 100μL culture medium per well. Then observe under a microscope, pick out the wells with only single cells, mark them, and culture them in an incubator for about 20-30 days. The monoclonal cells that survived in the 96-well plate were numbered Clone 2, 4, 11, 34, 53, 54, 68, 72, 81, 82, 90, 102, 110, 112, 132, 138, 145, and 150. The titer of different clones was tested, and the results are shown in Figure 5 Among them, Clone4, which produced the highest virus titer and had the best cell stability, has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit number: CGMCC No.:45528.

[0168] Example 3: Construction of a stable lentiviral production cell line

[0169] 3.1 Transgenic plasmid transfection conditions

[0170] This embodiment uses the Tol2 transposon tool to stably integrate the virus packaging transcription cassette and the packaging target gene GFP gene into the cell genome. During transfection, there is an optimal transfection ratio of Tol2 transposon and transposase and an optimal total amount of plasmid transfection, which affects the value of cell line toxicity. Stable packaging cell line clone4 cells were inoculated into a 6-well plate, with 8E+05 cells per well. After culturing overnight, each well was transfected with different proportions and different total amounts of pTol2-Lv-CMV-GFP-Bleo and CMV-Tol2transposase plasmids, as shown in Table 3, wherein the ratio of plasmid to transfection reagent PEI (polyethyleneimine) during transfection is total amount of plasmid (ug): PEI = 1:1.5. 48 hours after transfection, the transfected cells were digested and inoculated into a T75 culture flask with an inoculation density of 4E+04 / cm2. 24 hours after inoculation, the culture medium containing 1μg / mL Puro (puromycin), 10μg / mL BSD (blasticidin), 150μg / mL Hyg (hygromycin) and 500ug / ml Zeocin (zeocin hydrochloride) (YEASEN, catalog number: 60216ES60) antibiotics was replaced for pressure screening. The screening medium was replaced every 3-4 days. After 2 weeks of cell screening, the cells were inoculated into 6-well plates and induced to produce toxins. The toxins were collected 48 hours after induction and the titer was detected. The toxicity value of cell lines constructed by different ratios and total amounts of pTol2-Lv-CMV-GFP-Bleo and CMV-Tol2transposase plasmids was compared. The results showed that the transfection ratio of pTol2-Lv-CMV-GFP-Bleo and CMV-Tol2transposase was 1:1, and the total transfection amount was 2ug / 10 6 The cell line constructed with 10 cells has the highest toxicity value.

[0171] Table 3

[0172]

[0173] 3.2 Preparation of stable lentiviral production cell lines

[0174] The stable packaging cell line clone4 cells were inoculated in a 6-well plate at a seeding number of 6E+06 / bottle. After overnight culture, the pTol2-Lv-CMV-GFP-Bleo plasmid and CMV-Tol2transposase plasmid and PEI (polyethyleneimine) were co-transfected into the first positive mixed cells. The plasmid dosage during transfection (pTol2-Lv-CMV-GFP-Bleo + CMV-Tol2transposase) was 2 μg / 10 6cells, the transfection ratio of pTol2-Lv-CMV-GFP-Bleo and CMV-Tol2transposase plasmids was 1:1, the amount of PEI was (pTol2-Lv-CMV-GFP-Bleo+CMV-Tol2transposase) plasmid: PEI = 1:1.5, and the cells were re-inoculated into T75 culture flasks 48 hours after transfection, with an inoculation density of 4E+04 / cm 2 After the cells adhered overnight, the culture medium containing the final concentration of 1μg / mL Puro (puromycin), 10μg / mL BSD (blasticidin), 150μg / mL Hyg (hygromycin) and 500ug / ml Zeocin (bleomycin hydrochloride) antibiotics was replaced for pressure screening. The cells were replaced with the screening medium every 3-4 days. After 2 weeks of cell screening, a drug-resistant positive stable cell pool was obtained, that is, a lentivirus stable production mixed cell. The polyclonal lentivirus stable packaging mixed cells were plated with cells by limiting dilution method in 96-well plates, with 0.5 cells / 100μL culture medium per well. Then observe under a microscope, pick out the wells with only single cells, mark them, and culture them in an incubator for about 20-30 days. The monoclonal cells that survived in the 96-well plate were numbered Clone 4, 8, 15, 28, 33, 38, 56, 60, 70, 71, 85, 92, 100, 103, 121, 124, 136, 145, 159, 170, 181, and 183. The titers of different clones were tested, and the results are shown in the table. Figure 6 .

[0175] Example 4: Optimization of the production conditions of monoclonal lentiviral stable production cell lines

[0176] Pick Figure 6 The monoclonal clone Clone33 with a relatively high virus production titer was further studied. Clone33 was inoculated in a 6-well plate with 1E+06 cells per well. After 24 hours, the virus production conditions were set using DoE design (experimental design). The factors included: the concentration of sodium butyrate, the time of adding sodium butyrate, the time of adding dox (doxycycline), the concentration of adding dox (doxycycline) and the time of virus harvesting. If it is shown that the optimal experimental scheme is: the concentration of sodium butyrate (Sigma, catalog number: 303410-100G) is 1.5mM, the time of adding sodium butyrate is 24h after cell inoculation, the time of adding dox (Sigma, catalog number: doxycycline) (D3072-1ML) is 24h after cell inoculation, that is, when the sodium butyrate solution is changed, the concentration of dox (doxycycline) added is 2μg / mL, and the virus harvesting time is 48h after the addition of the inducer. The virus titer produced under the optimal conditions is 4.5E+07 (ie 4.5×10 7 )TU / mL.

[0177] Example 5: Gene copy number saturation test of monoclonal lentiviral stable packaging cell line

[0178] The stable packaging cell line clone4 was inoculated in a 6-well plate, with 8E5 cells in each well. After 24 hours, each well was transfected with 0.8ugpREV-rtTAtTS-puro and 1.6ugpTol2-Lv-CMV-GFP-Bleo, 0.8ugpVSVG-Hyg and 1.6ugpTol2-Lv-CMV-GFP-Bleo, 0.8ugpGagPol-BSD and 1.6ugpTol2-Lv-CMV-GFP-Bleo plasmids, respectively. After 48 hours of transfection, the viral supernatants were collected to detect the titers. The cytotoxicity values ​​of the stable packaging cell line clone4 after transfection with the supplementary plasmids were compared with the changes in the cytotoxicity of the original cell line. The results are shown in Figure 2. Figure 7 .

[0179] The results showed that after supplementing the plasmids of various elements required for transfection virus packaging, the cell toxicity value did not change significantly, indicating that the proportion of integrated genes in the stable packaging cell line has reached the optimal level.

[0180] Example 6: Stability verification of monoclonal lentiviral stable packaging cell line

[0181] Further stability studies were conducted on the lentiviral stable packaging cell line Clone4, including cell passage stability and differences in cell toxin production batches.

[0182] 6.1 Stability of cell culture

[0183] 6.1.1 Cell growth stability

[0184] Test the cell growth stability of Clone4 monoclonal cells with and without antibiotics. Specifically, Clone4 cells were inoculated into T75 culture flasks, and medium containing 1μg / mL Puro (puromycin), 10μg / mL BSD (blasticidin), 150μg / mL Hyg (hygromycin) antibiotics or antibiotic-free medium was added. Subculture once every other day, and count the cell number and viability. The cells were inoculated at the same inoculation density during subculture. Check its subculture stability.

[0185] Experiments have shown that when no antibiotics are added (no selection pressure), the cell growth rate and cell viability of Clone4 monoclonal cells are basically the same when antibiotics are added or not, indicating that cells can be stably propagated for more than 30 generations without selection pressure (see Figure 8 ).

[0186] 6.1.2 Toxin production stability

[0187] The toxin production stability of Clone4 monoclonal cells with and without antibiotics was tested. Specifically, Clone4 cells were inoculated into T75 culture flasks, and medium containing 1μg / mL Puro (puromycin), 10μg / mL BSD (blasticidin), 150μg / mL Hyg (hygromycin) antibiotics or antibiotic-free medium was added. The cells were subcultured every other day, and the cell number and viability were counted. The cells were inoculated at the same inoculation density during subculture. The cells of the 1st, 2nd, 4th, 8th, 12th, 16th, 20th, 24th, and 30th generations were frozen, and the above frozen cells were revived at the same time. After one generation of subculture, the pLv-CMV-GFP-Bleo plasmid was transfected to induce toxin production, and the toxin production stability of cells of different generations was compared. The experiment showed that the toxin production value of Clone4 monoclonal cells was consistent when antibiotics were added and not added, and the toxin production value could remain stable when the cells were stably subcultured for 30 generations without screening pressure (see Fig. 9 )

[0188] 6.1.3 Copy number stability

[0189] The gene passage stability of Clone4 monoclonal cells with and without antibiotics was tested. The genomic DNA of Clone4 monoclonal cells with and without antibiotics was extracted using a cell genome extraction kit (Tiangen Biochemical Technology Co., Ltd., catalog number: DP304-02), and then the qPCR method was used to amplify the copy numbers of GagPol, Rev, and VSVG in the genome of Clone4 monoclonal cells. Specifically, Clone4 cells were inoculated in T75 culture flasks, and culture medium containing a final concentration of 1μg / mL Puro (puromycin), 10μg / mL BSD (blasticidin), and 150μg / mL Hyg (hygromycin) antibiotics or antibiotic-free culture medium were added. The cells were subcultured every other day, and the cell number and viability were counted. The cells were inoculated at the same inoculation density during subculture. Cells of the 5th, 10th, 20th, and 30th generations were collected and frozen. 5×10 5 100 frozen cells of each generation, and use the cell genome extraction kit to extract genomic DNA. For specific operations, refer to the kit instructions. Dilute the cell genomic DNA to about 10-50ng / μL for qPCR quantification. The specific operation steps are as follows: dilute the 5 standard plasmid DNAs to 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1PCR amplified GagPol, Rev, VSVG and ALB, a total of 4 genes, and the same genomic DNA sample was added for the detection of the 4 genes. The qPCR reaction system (Thermo, catalog number: A25742) is as follows:

[0190]

[0191] The F primer and R primer are as follows:

[0192]

[0193] The qPCR reaction program is shown in the table below. At the same time, the instrument default melting curve program is set.

[0194]

[0195] After the PCR reaction is completed, the total number of copies of each gene to be tested is calculated according to the standard curve. Since the genomic DNA added to the reactions of different genes to be tested is the same sample and the added amount is the same, and the copy number of the ALB gene in the sample to be tested is known to be 2 copies / cell, the gene copy number / cell of other genes is calculated according to the following formula:

[0196] The number of copies of the gene to be tested / cell = 2 × the total number of copies of the gene to be tested / the total number of copies of the ALB gene

[0197] The single-cell copy number results of each gene in Clone4 monoclonal cells are shown in Fig.10 The results showed that the copy numbers of GagPol, Rev, and VSVG genes in Clone4 monoclonal cells were relatively stable.

[0198] Strain preservation

[0199] The lentiviral stable packaging cell line 293T-GPVG-R (2-1-4) of the present invention has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC, Beijing, China), with a deposit date of March 31, 2023 and a deposit number of CGMCC No.: 45528.

[0200] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

[0208]

[0209]

[0210]

[0211] SEQ ID NO:5

[0212]

[0213] tggcacaacgtaaggccattatctctcatccaactccaggacggagtcagtgaggatggggc

[0214] Rev

[0215] SEQ ID NO:6

[0216] ATGGCCGGCAGAAGCGGCGACAGCGACGAGGACCTGCTGAAAGCCGTGCGGCTGATCAAGTTCCTGTACCAGTCTAATCCTCCTCCTAACCCCGAGGGCACAAGACAGGCTAGACGCAACAGAAGGCGGAGATGGCGGGAAAGACAAAGACAGATCCACAGCATCAGCGAGAGAATCCTGTCCACATACCTGGGCAGATCCGCCGAGCCTGTCCCCCTGCAGCTGCCTCCACTCGAGCGGCTGACCCTGGATTGCAACGAGGATTGTGGCACCAGCGGAACCCAGGGCGTGGGCAGCCCTC

[0217] AGATTCTGGTGGAAAGCCCCACCATCCTGGAATCTGGAGCCAAGGAATGA

[0218] puroR

[0219] SEQ ID NO:7

[0220] ATGACAGAGTACAAGCCTACCGTGCGGCTGGCAACCCGGGACGATGTGCCTAGGGCCGTGCGGACCCTGGCCGCCGCCTTTGCCGACTACCCCGCCACAAGACACACCGTGGACCCTGATAGACATATCGAGCGGGTGACCGAGCTGCAGGAGCTGTTCCTGACAAGAGTGGGCCTGGACATCGGCAAAGTGTGGGTCGCCGATGACGGCGCCGCTGTGGCCGTGTGGACCACCCCTGAGAGCGTGGAAGCCGGTGCTGTGTTCGCCGAGATCGGCCCCAGAATGGCCGAGCTGAGCGGCTCTAGACTGGCCGCTCAGCAACAGATGGAAGGCCTGCTGGCCCCTCACAGACCTAAGGAACCAGCCTGGTTCCTGGCTACAGTTGGAGTGTCCCCTGACCACCAGGGCAAGGGCCTGGGAAGCGCCGTGGTGCTGCCTGGCGTGGAAGCCGCTGAACGGGCCGGAGTGCCCGCTTTTCTCGAGACAAGCGCCCCTCGCAACCTGCCCTTCTACGAGAGACTGGGCTTCACAGTCACCGCCGACGT

[0221] GGAAGTGCCAGAGGGCCCTAGAACCTGGTGCATGACCAGAAAGCCCGGCGCCTGA

[0222] tTS

[0223] SEQ ID NO:8

[0224] ATGAGCAGACTGGACAAGTCCAAGGTGATCAACAGCGCCCTGGAACTGCTGAACGAGGTCGGCATCGAAGGCCTGACCACAAGAAAGCTGGCCCAAAAGCTCGGAGTGGAACAGCCTACCTTGTACTGGCACGTGCGGAACAAGCAGACCCTGATGAACATGCTGAGCGAGGCCATCCTGGCCAAGCACCACACCAGATCTGCCCCTCTGCCTACCGAGTCTTGGCAGCAATTTCTGCAGGAGAACGCCCTGTCTTTCAGAAAGGCCCTGCTCGTGCACAGAGATGGCGCTAGACTGCACATCGGCACCAGCCCTACACCCCCCCAGTTCGAGCAGGCCGAGGCCCAGCTGAGATGTCTGTGCGACGCCGGCTTCAGCGTGGAAGAAGCTCTGTTCATCCTGCAGAGCATCAGCCACTTCACCCTGGGCGCCGTGCTGGAAGAGCAGGCTACAAATCAGATCGAGAACAACCACGTGATCGACGCCGCCCCTCCACTGCTGCAAGAGGCATTCAACATCCAGGCCCGCACCAGCGCTGAAATGGCCTTCCACTTCGGCCTGAAGAGCCTGATCTTCGGCTTTAGCGCCCAGCTGGACGAGAAGAAACATACACCTATCGAGGATGGAAATAAACCTAAGAAAAAAAGAAAGCTGGCTGTGTCCGTGACCTTCGAGGACGTGGCCGTTCTGTTCACCCGGGACGAATGGAAGAAGCTGGATCTGTCCCAGCGGAGCCTGTACCGGGAAGTGATGCTTGAGAATTACAGCAACCTGGCCAGCATGGCCGGA

[0225] TTCCTGTTTACAAAGCCCAAGGTGATTTCTCTGCTGCAGCAGGGCGAGGACCCCTGGTGA

[0226] rtTA

[0227] SEQ ID No:9

[0228] ATGTCTAGACTGGACAAGAGCAAAGTCATAAACGGCGCTCTGGAATTACTCAATGGAGTCGGTATCGAAGGCCTGACGACAAGGAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTA

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

Claims

1. A lentiviral stable packaging cell line, characterized in that: It comprises a packaging plasmid group, wherein the packaging plasmid group consists of a pREV-rtTAtTS-puro plasmid, a pVSVG-Hyg plasmid, a pGagPol-BSD plasmid and a CMV-PBtransposase plasmid; The pREV-rtTAtTS-puro plasmid contains rtTA, tTS and REV genes. The pVSVG-Hyg plasmid contains the VSVG gene, The pGagPol-BSD plasmid contains the GagPol gene, and The CMV-PBtransposase plasmid contains the PBtransposase gene; Among them, the sequence of the pREV-rtTAtTS-puro plasmid is shown in SEQ ID NO: 1, the sequence of the pVSVG-Hyg plasmid is shown in SEQ ID NO: 2, the sequence of the pGagPol-BSD plasmid is shown in SEQ ID NO: 3, and the sequence of the CMV-PBtransposase plasmid is shown in SEQ ID NO:

4.

2. The lentiviral stable packaging cell line according to claim 1, characterized in that The cell line is selected from one of HEK293, HEK293-T, HEK293-SF, TE671, HT1080 or HeLa cell lines.

3. The lentiviral stable packaging cell line according to claim 1, characterized in that The cell line is a cell line with a deposit number of CGMCC No.45528.

4. A method for preparing a lentiviral stable packaging cell line according to claim 1, characterized in that: The following steps are involved: i) linearizing the pREV-rtTAtTS-puro plasmid; transfecting the linearized pREV-rtTAtTS-puro plasmid into recipient cells, and adding a first antibiotic for screening to obtain a first positive mixed cell; ii) co-transfecting the first positive mixed cells with the pVSVG-Hyg plasmid, the pGagPol-BSD plasmid and the CMV-PBtransposase plasmid, and adding the second antibiotic for screening to obtain the second positive mixed cells; Wherein, the first antibiotic is puromycin; the second antibiotic is a combination of puromycin, hygromycin and blasticidin; and The cells with positive screening results in both step i) and step ii) are the lentiviral stable packaging cell lines.

5. A lentivirus stable production cell line, characterized in that: The method comprises the following steps: transfecting a plasmid containing a virus packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as claimed in claim 1 and screening cells with stable integration of the target gene, thereby constructing a lentivirus stable production cell line.

6. The lentiviral stable production cell line according to claim 5, characterized in that The plasmid containing the virus packaging target gene is a pTol2-Lv-GOI-Bleo plasmid containing the virus packaging target gene, and the transposase plasmid is a CMV-Tol2 transposase plasmid.

7. A method for constructing a lentivirus stable production cell line, characterized in that: The method comprises the steps of: transfecting a plasmid containing a virus packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as claimed in claim 1 and screening cells in which the target gene is stably integrated, thereby constructing a lentivirus stable production cell line.

8. A method for producing a lentivirus, characterized in that: The method comprises the steps of: transfecting a plasmid containing a virus packaging target gene and a transposase plasmid into the lentivirus stable packaging cell line as claimed in claim 1 and screening cells with stable integration of the target gene, thereby constructing a lentivirus stable production cell line, and then adding an inducer to induce the lentivirus stable production cell line to produce lentivirus.

9. A method for preparing the lentivirus stable production cell line according to claim 6, characterized in that: The following steps are involved: 1) co-transfecting the stable packaging cell line according to claim 1 with the pTol2-lv-GOI-Bleo plasmid containing the virus packaging target gene and the CMV-Tol2 transposase plasmid, and adding a third antibiotic for screening and sorting to obtain cloned cells, which is a lentivirus stable production cell line; wherein the third antibiotic is a combination of puromycin, hygromycin, blasticidin and bleomycin.

Images