A "copper death" nanomaterial and its preparation method and application

Abstract

The present invention discloses a "copper-dead" nanomaterial, its preparation method, and application. The material is self-assembled from a functional element with copper ion chelation, a functional element with catalytic function, and a functional element that enhances biocompatibility. The "copper-dead" nanomaterial of the present invention has the advantages of a simple preparation process, green economy, low cost, and mass production. It also exhibits excellent anti-tumor and anti-metastasis effects, expanding new treatment options for copper-disordered tumors and providing new insights into tumor treatment. Furthermore, by varying the types of copper-chelating, catalytic, and biocompatibility-enhancing components, as well as the self-assembly method, the material can be extended to the synergistic treatment of other diseases.

Description

Technical Field

[0001] The present invention relates to a "copper death" type nano material and a preparation method and application thereof, belonging to the technical field of nano drug for tumor treatment. Background Art

[0002] Copper, an essential trace element for the human body, is involved in numerous life activities and cellular processes: embryonic development and red blood cell formation; as a cofactor for cellular enzymes, it participates in mitochondrial respiration, maintains intracellular redox balance, and promotes the biosynthesis of neurotransmitters. Consequently, dynamic copper imbalances can cause human diseases. For example, copper deficiency can lead to cardiovascular disease and early embryonic lethality; abnormal copper metabolism is associated with the onset of Parkinson's disease and Alzheimer's disease; and copper accumulation in the body is linked to the development and progression of Wilson's disease and tumors.

[0003] In March 2020, renowned oncologists including Linda Vahdat of Weill Cornell Medical Center and Nick Tonks of Cold Spring Harbor Laboratory initiated the "Copper and Cancer Forum," proposing the concept of copper hyperplasia, or copper-dependent tumor cell growth and proliferation. While tumor growth requires high copper, the copper content within tumor cells must remain within a certain threshold. Therefore, disrupting copper homeostasis within tumor cells has become another potential target for cancer treatment, potentially offering new insights and approaches.

[0004] Currently, there are two main ways to disrupt copper homeostasis in tumor cells and cause copper imbalance in tumor cells: one is based on the high copper demand of tumor patients, using copper chelators to reduce the copper content of tumor cells, thereby interfering with corresponding signaling pathways (such as the RAF-MEK-mediated cell growth and proliferation pathway) to inhibit tumor growth; the other is based on copper overload, using copper ion carriers and additional copper agents to cause a large accumulation of copper ions in tumor cells, resulting in mitochondrial damage and inducing cell death. Copper overload-mediated tumor treatment strategies require copper supplementation, which inevitably causes copper poisoning to normal tissues or cells; copper chelation-mediated tumor treatment also requires large amounts of copper chelators, which have toxic side effects on normal cells. Therefore, to avoid the harm of copper-imbalanced tumor treatment to normal tissues / cells, it is urgent to design and develop effective new drugs and new methods for copper-imbalanced tumor treatment.

[0005] In recent years, nanotechnology-mediated drug delivery systems have developed rapidly. With the help of nanomaterial carriers, targeted and efficient drug delivery can be achieved, thereby preventing normal cells from taking up large amounts of copper chelated drugs and additional copper agents, and developing accurate tumor copper overload treatments. Throughout the history of tumor treatment, including surgical resection, radiotherapy, chemotherapy, immunotherapy, and multimodal combination therapy, multimodal combination therapy is still the most effective tumor treatment method. Therefore, based on the designability and multifunctionality of nanomedicines, it is extremely necessary to design and develop a new type of copper chelated multimodal tumor treatment nanomedicine, which has the following important significance. Summary of the Invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a "copper death" type nanomaterial with good anti-tumor and anti-metastasis effects, as well as its preparation method and application.

[0007] Technical solution: In order to solve the above technical problems, the present invention provides a "copper death" type nanomaterial, which is formed by self-assembly of a functional element with copper ion chelating ability, a functional element with catalytic function and a functional element for increasing biocompatibility; the functional element with copper ion chelating ability includes ZnS nanoparticles, the functional element with catalytic function includes nuclease, the functional element for increasing biocompatibility includes polydopamine, and the self-assembly method includes a non-covalent self-assembly method.

[0008] In addition, the functional element with copper ion chelating ability includes nanomaterials, and the nanomaterials also include FeS, MnS or HgS; the functional element with catalytic function also includes protease, ribozyme or nanozyme; the functional element for increasing biocompatibility also includes hyaluronic acid, chitosan or polyethylene glycol; the self-assembly method also includes self-assembly triggered by physical action or structural characteristics, chemical assembly or van der Waals force.

[0009] Among them, the "copper death" nanomaterial uses ZnS as the core, and polydopamine is modified on its surface. A nuclease with mRNA cleavage activity is coupled to the surface of polydopamine through non-covalent self-assembly.

[0010] The present invention also provides a method for preparing the "copper death" type nanomaterial, comprising the following steps:

[0011] (1) dissolving zinc nitrate hexahydrate, cetyltrimethylammonium bromide, hexamethylenetetramine, citric acid monohydrate, and thioacetamide in deionized water, stirring, heating, and centrifuging to obtain functional element ZnS nanoparticles having copper ion chelating ability;

[0012] (2) mixing the ZnS nanoparticles prepared in step (1) with dopamine hydrochloride and stirring to obtain ZnS@PDA;

[0013] (3) The ZnS@PDA prepared in step (2) is mixed with the functional element nuclease having catalytic function, incubated, and the collected precipitate is the "copper death" type nanomaterial ZnS@PDA / GD.

[0014] The mass ratio of zinc nitrate hexahydrate, cetyltrimethylammonium bromide, hexamethylenetetramine, citric acid monohydrate and thioacetamide described in step (1) is 138.8:85:35:25:20.

[0015] Wherein, the mass ratio of the ZnS nanoparticles to dopamine hydrochloride described in step (2) is 1:1.

[0016] Wherein, the sequence of the nanomaterial nuclease described in step (3) is shown as SEQ ID NO.1.

[0017] The present invention also provides the use of the "copper death" type nanomaterial in the preparation of drugs for improving and / or treating tumors.

[0018] The present invention also provides the use of the "copper death" nanomaterial in the preparation of drugs for preventing the spread and / or metastasis of cancer cells.

[0019] The present invention also provides the application of the "copper death" nanomaterial in promoting tumor immunotherapy mediated by immunogenic molecules.

[0020] Wherein, when the "copper death" type nanomaterial is ZnS@PDA / GD, the concentration of ZnS@PDA / GD is 12.5-100 μg / mL.

[0021] Preferably, the concentration of ZnS@PDA / GD is 12.5-75 μg / mL.

[0022] More preferably, the concentration of ZnS@PDA / GD is 12.5-50 μg / mL.

[0023] More preferably, the concentration of ZnS@PDA / GD is 12.5-25 μg / mL.

[0024] Principle of the present invention: Figure 1As shown in the figure, after ZnS@PDA / GD is phagocytosed by tumor cells, the polydopamine layer is degraded under the action of tumor cell lysosomes, and ZnS and GD are released: ZnS chelates copper ions in tumor cells, promoting copper chelation therapy of tumors; ZnS chelates copper ions to form CuS particles with photothermal effect in situ, which promote photothermal therapy of tumors under laser irradiation; ZnS releases Zn after chelating copper ions. 2+ Activate GD, thereby triggering the cleavage of Glut 1mRNA, reducing the expression of Glut 1 and reducing glucose uptake, and promoting starvation therapy for tumors; based on copper chelation therapy, photothermal therapy and starvation therapy, the released immunogenic molecules promote tumor immunotherapy.

[0025] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: the present invention obtains nano-carrier materials through a simple synthesis method, and co-assembles elements with intracellular copper ion chelating ability, elements with catalytic function and elements with increased biocompatibility to form nano-medicines, and applies them to the tumor-bearing model and metastatic tumor model of breast cancer in mice, both showing good anti-tumor and anti-metastasis effects, expanding new copper-disordered tumor treatment methods and providing new ideas for tumor treatment; by changing the type of functional elements with copper chelating ability, the type of elements with catalytic function, the type of elements with increased biocompatibility and the self-assembly method, it can be extended to the synergistic treatment of other diseases; the multifunctional nano-medicine of the present invention has the advantages of simple preparation process, green economy, environmental friendliness, low cost and mass production, and based on the development of new copper-chelating nano-medicines, it promotes the research on the molecular mechanism of copper chelation tumor treatment; integrating the concept of multimodal treatment, bringing more hope of survival for cancer patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a diagram of four tumor treatment modes mediated by the novel "copper death" tumor treatment nanomedicine ZnS@PDA / GD prepared by the present invention;

[0027] Figure 2 This is the synthesis route of the novel "copper death" tumor treatment nanomedicine ZnS@PDA / GD of the present invention;

[0028] Figure 3 For the characterization of ZnS nanoparticles: Figure 3 a is a transmission electron microscopy (TEM) image of ZnS nanoparticles; Figure 3 b is the hydrated particle size distribution diagram of ZnS nanoparticles;

[0029] Figure 4 ZnS and Cu 2+ Schematic diagram of ion exchange to generate CuS;

[0030] Figure 5 ZnS and Cu 2+ Characterization of CuS after exchange: Figure 5 a is ZnS via Cu 2+ Transmission electron microscopy image of CuS produced after exchange; Figure 5 b is ZnS via Cu 2+ Distribution of hydration kinetic diameters of CuS produced after exchange; Figure 5 c is ZnS and Cu 2+ Schematic diagram of ion exchange reaction; Figure 5 d is ZnS and ZnS through Cu 2+ X-ray diffraction pattern of CuS produced after exchange;

[0031] Figure 6 TEM image of ZnS@PDA;

[0032] Figure 7 TEM image of ZnS@PDA / GD;

[0033] Figure 8 is the hydration kinetic diameter and charge diagram of ZP and ZPD;

[0034] Figure 9 Photothermal effect of nanomedicine for novel "copper-death" tumor treatment: Figure 9 a is the photothermal effect diagram of ZnS nanoparticles, CuS and ZPD; Figure 9 b is the photothermal quantization curve of ZnS nanoparticles, CuS and ZPD;

[0035] Figure 10 Catalytic Activity of Novel 'Copper-Dead' Nanomedicines for Tumor Therapy: Figure 10 a is a schematic diagram of cleavage of mRNA after activation of Glut 1 DNAzyme; Figure 10 b is the gel electrophoresis of the cleavage substrate of GD under different treatment conditions;

[0036] Figure 11 Schematic diagram of the accumulation of intracellular copper ions in normal cells L02 and tumor cells 4T1;

[0037] Figure 12 Cellular-level characterization of novel 'copper-death' nanomedicines for tumor therapy: Figure 12 a is the effect of ZPD on the survival rate of tumor cells; Figure 12 b is a schematic diagram of GD activation and tumor cell starvation treatment; Figure 12 c is the expression of Glut1 in tumor cells after treatment with different materials; Figure 12 d is the glucose concentration in the culture supernatant of different groups;

[0038] Figure 13Anti-tumor validation of new "copper-death" tumor-treating nanomedicine at the small animal level: Figure 13 a is a graph showing the tumor size under different treatment conditions in a breast cancer tumor-bearing model; Figure 13 b is a graph showing the changes in tumor volume over time in a breast cancer tumor-bearing model;

[0039] Figure 14 This is a picture of mouse lung metastasis: Figure 14 a is a graph showing the changes in the number of lung metastases in mice in the 4T1 metastatic tumor model; Figure 14 b is a picture of lung metastases in mice in the 4T1 metastatic tumor model. DETAILED DESCRIPTION

[0040] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0041] Zinc nitrate hexahydrate, cetyltrimethylammonium bromide, hexamethylenetetramine (analytical grade), citric acid monohydrate, thioacetamide, and dopamine hydrochloride were purchased from China National Pharmaceutical Group Co., Ltd.

[0042] Balb / c mice were obtained from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. Phloretin is a commercial glucose uptake inhibitor.

[0043] Example 1 Preparation and Characterization of ZnS Nanoparticles as Functional Element with Copper Ion Chelation Capability

[0044] 1. According to Figure 2 The method shown in the figure is used to prepare ZnS nanoparticles. The specific steps are as follows:

[0045] (a) Zinc nitrate hexahydrate (138.8 mg), cetyltrimethylammonium bromide (85.0 mg), hexamethylenetetramine (analytical grade, 35.0 mg), citric acid monohydrate (25.0 mg), and thioacetamide (20.0 mg) were dissolved in 100 mL of deionized water and stirred at room temperature for 10 min to obtain a mixture;

[0046] (b) heating the mixture in an air circulating oven at 85° C. for 5 hours to obtain the product;

[0047] (c) The product was centrifuged at 10000 rpm for 10 min, and the precipitate was washed three times with water and ethanol to obtain functional element ZnS nanoparticles with copper ion chelating ability, which were dried for later use. Then, the ZnS nanoparticles were observed by transmission electron microscopy. Figure 3 As shown in a, ZnS is in the form of mesoporous spheres. The hydration kinetic diameter distribution of ZnS nanoparticles was statistically analyzed based on the transmission electron microscopy morphology ( Figure 3b), the hydration kinetic diameter distribution of ZnS nanoparticles is mainly around 150 nm, and the PDI value is 0.15.

[0048] 2. If Figure 4 As shown, a saturated Cu 2+ , the generated CuS was characterized after the replacement reaction ( Figure 5 ), CuS maintains a mesoporous spherical morphology similar to that of ZnS ( Figure 5 a), the hydration kinetic diameter distribution is mainly around 160nm ( Figure 5 b); X-ray energy spectrum photoelectric analysis of the generated CuS and the original ZnS was performed at the same time ( Figure 5 c) and X-ray diffraction analysis ( Figure 5 d), Spectral characterization shows the successful formation of CuS.

[0049] Example 2 Preparation and characterization of ZnS@PDA

[0050] The components with copper chelating ability are assembled with components that increase biocompatibility. In the present invention, nanomaterial ZnS is used as the copper ion chelating component and polydopamine (PDA) is used as the component that increases biocompatibility to obtain ZnS@PDA (abbreviated as ZP) through self-polymerization assembly. The preparation method ( Figure 2 )as follows:

[0051] The above 10mM ZnS nanoparticles and dopamine hydrochloride were mixed in a mass ratio of 1:1 and stirred at room temperature for two hours at pH = 8.5. After the surface turned light black, it was washed three times with deionized water and stored at 4°C for later use. Then, the ZnS@PDA was observed by transmission electron microscopy. Figure 6 As shown, ZnS@PDA maintains a spherical shape and the thickness of the PDA coating layer is about 3 nm.

[0052] Example 3 Preparation and characterization of "copper death" nanomedicine

[0053] A nanomedicine composed of an element with copper chelation ability, an element for increasing biocompatibility, and an element with catalytic function was prepared. Based on Example 2, a catalytic functional element ribozyme (Glut 1 DNAzyme, abbreviated as GD, a DNA enzyme with glucose transporter cleavage activity, synthesized by Shanghai Sangon Biotechnology Co., Ltd., and its sequence is SEQ ID NO. 1:

[0054] ACCAGGGCTCCGAGCCGGTCGAAACTTCAAAGA), the nanomedicine ZnS@PDA / GD (abbreviated as ZPD) was obtained by self-assembly on the ZP surface. The preparation method is as follows ( Figure 2 ):

[0055] Glut 1 DNAzyme and ZP were added to a 10 mM HEPES buffer at pH 7.6 (the final concentration of Glut 1 DNAzyme was 10 nM and the final concentration of ZP was 50 μg / mL). After incubation for 1 hour, the precipitate was collected and washed for later use. Then, ZnS@PDA / GD was observed by transmission electron microscopy. Figure 7 As shown in Figure 3, ZnS@PDA / GD maintains a spherical structure and its basic morphology is consistent with that of ZnS@PDA.

[0056] like Figure 8 As shown in the figure, by observing and statistically analyzing the hydration kinetic diameters and charge diagrams of ZP and ZPD, it was found that the hydration kinetic diameters of ZP and ZPD showed an obvious increasing trend compared with ZnS, and the charge also changed accordingly. These results indicate the successful preparation of ZP and ZPD.

[0057] Example 4 Analysis of Cellular Characteristics of Novel “Copper Death” Tumor Therapeutic Nanomedicine

[0058] like Figure 9 As shown, the photothermal effect, catalytic activity and cellular level characteristics of the ZnS nanoparticles, CuS and ZPD prepared above were characterized respectively (wherein Treated-ZPD refers to ZPD treated with acid). Figure 9 As shown in a, ZnS nanoparticles can chelate copper ions to form CuS with photothermal effect. ZPD is exposed to ZnS particles after acid treatment, and also has the ability to chelate copper ions to produce CuS with photothermal effect. Figure 9 As shown in b, CuS and Treated-ZPD both exhibit photothermal effect under laser irradiation, while pure ZnS and ZPD do not have photothermal effect, indicating that Treated-ZPD is effective in Cu 2+ After chelation, CuS is formed, which has a photothermal effect. Figure 10 As shown, Glut 1 DNAzyme cleaves mRNA after activation ( Figure 10 a) Zn released after ZnS chelates copper ions 2+ It can activate GD activity and promote mRNA cleavage (10b); Figure 11 As shown in Figure 2, tumor cells have a higher copper uptake than normal cells; Figure 12 As shown in a, as the drug concentration increases, the cell activity decreases, that is, the cytotoxicity increases; Figure 12 As shown in b, GD can activate starvation therapy of tumor cells; Figure 12 As shown in c, ZPD can significantly reduce the expression of Glut 1 and thus block the uptake of glucose; Figure 12As shown in Figure d, the glucose concentration in the culture supernatant of ZPD was significantly higher than that of the control group, ZnS and ZP groups. GD can block the uptake of glucose by inhibiting the expression of Glut 1 and retain glucose in the culture supernatant.

[0059] Example 5 Evaluation of the anti-tumor effect of the new "copper death" tumor treatment nanomedicine

[0060] 1. The 4T1 breast cancer tumor model was used as a model tumor model. 4T1 tumor cells (seeding density of 5×10 6 cells / mouse, 4T1 tumor cells were obtained from ATCC, No. CRL-2539), and the mice were bred in a conventional manner until tumor-forming mice were obtained.

[0061] 2. Mice with tumors were divided into 7 groups and 200 μL of drugs were administered via the tail vein, with the drug concentration of each group being 5 mg / kg: Group 1 (administered with ZnS): ZnS prepared in Example 1; Group 2 (administered with ZnS+L): ZnS prepared in Example 1 and laser irradiated (808 nm laser, power 2 W, irradiation for 5 min); Group 3 (administered with ZP): ZP, a self-assembly of the nanocarrier ZnS and PDA coating prepared in Example 2; Group 4 (administered with ZP+L): ZP prepared in Example 2 and laser irradiated (808 nm laser, power 2 W, irradiation for 5 min); Group 5 (administered with ZPD): ZnS prepared in Example 3, PDA coating, and Glutamine. 1. Nanodrug ZnS@PDA / GD formed by DNAzyme self-assembly, namely ZPD; Group 6 (administration of ZPD+L): ZPD prepared in Example 3, and laser irradiation (808 nm laser, power 2 W, irradiation for 5 min); Ctrl group: mice were given 0.01 M PBS (pH 7.4).

[0062] 3. Measure the changes in tumor volume of each group of mice, examine the anti-tumor effect and analyze the mechanism.

[0063] The changes in subcutaneous tumor volume of mice were observed and recorded on days 8, 10, 12, 14, 16, 18, 20, and 22 after administration. On day 22 after administration, samples were collected from mice and the tumors were dissected for analysis: From the photos of the dissected tumors, it can be seen that the tumors of mice in the ZPD+L group were significantly smaller than those in the other groups ( Figure 13 a); During the entire treatment cycle, the tumor volume of each group changed with time. The tumor volume of mice in the ZnS group, ZnS+L group, ZP group, ZP+L group, ZPD group, and Ctrl group continued to increase, while the tumor size of mice in the ZPD+L group did not change significantly, indicating that the growth of mouse tumors can be effectively inhibited under the conditions of the ZPD+L group ( Figure 13b) The best therapeutic effect was achieved when the PDA-coated ZnS nanomaterials were used as nanocarriers to carry the Glut 1 DNAzyme and then irradiated with laser. The tumor volume in the ZPD+L group was only 1 / 8 of that in the Ctrl group, approximately 100 mm. 2 It can be seen that the combination of copper chelation therapy, photothermal therapy and starvation therapy can significantly enhance the anti-tumor ability.

[0064] Example 6 Evaluation of the anti-metastatic effect of a novel "copper death" tumor treatment nanomedicine

[0065] 1. The 4T1 breast cancer tumor-bearing model was used as a model tumor model. Balb / c mice were subcutaneously administered with murine 4T1 tumor cells. On the 7th day after administration of 4T1 cells, 4T1 cells were injected into the tail vein of each group of mice to establish a 4T1 metastatic tumor model.

[0066] 2. Mice with tumors were divided into 7 groups according to the method of Example 4 and 200 μL of drugs were administered via the tail vein, with the drug concentration of 5 mg / kg in each group: Group 1 (administered with ZnS): ZnS prepared in Example 1; Group 2 (administered with ZnS+L): ZnS prepared in Example 1 and laser irradiated (808 nm laser, power 2 W, irradiation for 5 min); Group 3 (administered with ZP): ZP, a self-assembly of the nanocarrier ZnS and PDA coating prepared in Example 2; Group 4 (administered with ZP+L): ZP prepared in Example 2 and laser irradiated (808 nm laser, power 2 W, irradiation for 5 min); Group 5 (administered with ZPD): ZnS prepared in Example 3 and PDA coating and Glut 1. Nanodrug ZnS@PDA / GD formed by DNAzyme self-assembly, namely ZPD; Group 6 (administration of ZPD+L): ZPD prepared in Example 3, and laser irradiation (808 nm laser, power 2 W, irradiation for 5 min); Ctrl group: mice were given 0.01 M PBS (pH 7.4).

[0067] 3. On the 21st day after administration, samples were collected from the mice, and the whole lungs of the mice were dissected to analyze the number and status of lung metastases.

[0068] Depend on Figure 14 a and Figure 14 As shown in Figure b, the anti-tumor effect is evident: the number of lung metastases in the ZPD+L group of mice in the 4T1 breast cancer lung metastasis model is far less than that in the other groups, indicating that ZnS@PDA / GD exhibits the best anti-metastatic properties. These findings are attributed to the immunogenic molecules released by the combined copper chelation therapy, photothermal therapy, and starvation therapy, which trigger tumor immunotherapy and thus exhibit anti-metastatic properties.

Claims

1. A "copper death" nanomaterial, characterized in that: The "copper death" nanomaterial is formed by self-assembly of a functional element with copper ion chelating ability, a functional element with catalytic function and a functional element for increasing biocompatibility; the functional element with copper ion chelating ability is ZnS, the functional element with catalytic function is a nuclease with a nucleotide sequence as shown in SEQ ID NO.1, and the functional element for increasing biocompatibility is polydopamine, and the self-assembly method includes a non-covalent self-assembly method.

2. The "copper death" nanomaterial according to claim 1, characterized in that: The "copper death" nanomaterial uses ZnS as a core, is modified with polydopamine on its surface, and a nuclease with mRNA cleavage activity is coupled to the surface of the polydopamine through non-covalent self-assembly.

3. A method for preparing the "copper death" nanomaterial according to any one of claims 1 to 2, characterized in that: The following steps are involved: (1) Dissolving zinc nitrate hexahydrate, cetyltrimethylammonium bromide, hexamethylenetetramine, citric acid monohydrate, and thioacetamide in deionized water, stirring, heating, and centrifuging to obtain functional element ZnS nanoparticles with copper ion chelating ability; (2) mixing the ZnS nanoparticles prepared in step (1) with dopamine hydrochloride and stirring to obtain ZnS@PDA; (3) The ZnS@PDA prepared in step (2) is mixed with a functional element nuclease having a catalytic function, incubated, and the collected precipitate is the "copper death" type nanomaterial ZnS@PDA / GD; the sequence of the nuclease is shown in SEQ ID NO.

1.

4. Use of the "copper death" nanomaterial according to claim 1 in the preparation of drugs for improving and / or treating breast cancer.

5. Use of the "copper death" nanomaterial according to claim 1 in the preparation of a drug for inhibiting the spread and / or metastasis of breast cancer cells.

6. The use according to claim 4 or 5, characterized in that When the "copper death" nanomaterial is ZnS@PDA / GD, the concentration of ZnS@PDA / GD is 12.5~100 μg / mL.

7. The use according to claim 4 or 5, characterized in that When the "copper death" nanomaterial is ZnS@PDA / GD, the concentration of ZnS@PDA / GD is 12.5~75 μg / mL.

8. The use according to claim 4 or 5, characterized in that When the "copper death" nanomaterial is ZnS@PDA / GD, the concentration of ZnS@PDA / GD is 12.5~50 μg / mL.

Images