Application of lncRNA IGFL2-AS1 gene inhibitors in the preparation of drugs for the treatment of lung cancer

By targeting and inhibiting the lncRNA IGFL2-AS1 gene, the problem of non-small cell lung cancer resistance to cisplatin and 5-fluorouracil was solved, the sensitization of lung cancer treatment drugs and the application of diagnostic kits were achieved, the drug resistance of lung cancer cells was reduced and the diagnostic accuracy was improved.

CN116808214BActive Publication Date: 2025-09-16AFFILIATED HOSPITAL OF BINZHOU MEDICAL COLLEGE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310427357.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-20
Publication Date
2025-09-16
Estimated Expiration
2043-04-20

AI Technical Summary

Technical Problem

Patients with non-small cell lung cancer develop resistance to cisplatin and 5-fluorouracil, which is difficult to be effectively addressed with existing treatment options. The role of lncRNA IGFL2-AS1 in lung cancer resistance has not been fully studied.

Method used

Develop lncRNA IGFL2-AS1 gene inhibitors to reduce the resistance of lung cancer cells to cisplatin or 5-fluorouracil by targeting and inhibiting the IGFL2-AS1 gene. Screen and apply them to lung cancer diagnostic kits by detecting IGFL2-AS1 gene expression.

Benefits of technology

Significantly reduce the resistance of lung cancer cells to cisplatin and 5-fluorouracil, improve the accuracy of lung cancer diagnosis, and screen out effective lung cancer treatment drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116808214B_ABST
    Figure CN116808214B_ABST
Patent Text Reader

Abstract

The present invention discloses the use of a lncRNA IGFL2-AS1 gene inhibitor in the preparation of a drug for treating lung cancer. The nucleotide sequence of the lncRNA IGFL2-AS1 gene is shown in SEQ ID NO.1. The lncRNA IGFL2-AS1 gene inhibitor is a small interfering RNA that uses the IGFL2-AS1 gene or its transcript as an inhibition target or a silencing target. The nucleotide sequence of the shRNA of the small interfering RNA is shown in SEQ ID NO.17 or SEQ ID NO.18. IGFL2-AS1 is mainly localized in the cell nucleus and expressed in a small amount in the cytoplasm. IGFL2-AS1 can promote the proliferation, migration and drug resistance of non-small cell lung cancer A549 and H520 cells. Targeted inhibition of IGFL2-AS1 can significantly reduce the drug resistance of lung cancer cells to cisplatin or 5-fluorouracil.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and particularly to the use of a lncRNA IGFL2-AS1 gene inhibitor in the preparation of a drug for treating lung cancer. Background Art

[0002] Lung cancer is divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), with NSCLC accounting for 85% of cases. Cisplatin is a first-line chemotherapy drug in NSCLC clinical regimens, offering low treatment costs. However, most patients develop primary or secondary drug resistance. Previous studies have revealed the role of various molecular signaling pathways in lung cancer drug resistance, and recent research has shown that long non-coding RNA (lncRNA) is also a key driver of lung cancer drug resistance. This study, through sequencing of the resistant and parental NSCLC cell lines A549, aims to identify lncRNAs associated with cisplatin resistance in NSCLC and further reduce cisplatin resistance in lung cancer cells through targeted inhibition of these lncRNAs. Summary of the Invention

[0003] In view of this, the object of the present invention is to provide a use of a lncRNA IGFL2-AS1 gene inhibitor in the preparation of a lung cancer therapeutic drug; a second object of the present invention is to provide a use of the lncRNA IGFL2-AS1 gene inhibitor in reducing the drug resistance of lung cancer cells to cisplatin or 5-fluorouracil; a third object of the present invention is to provide a reagent for detecting the expression of the lncRNA IGFL2-AS1 gene for use in the preparation of a lung cancer diagnostic kit; a fourth object of the present invention is to provide a use of the lncRNA IGFL2-AS1 gene in screening lung cancer therapeutic drugs.

[0004] In order to achieve the above object, the present invention provides the following technical solutions:

[0005] 1. Application of lncRNA IGFL2-AS1 gene inhibitors in the preparation of drugs for the treatment of lung cancer

[0006] Preferably, in the present invention, the nucleotide sequence of the lncRNA IGFL2-AS1 gene is shown as SEQ ID NO.1.

[0007] Preferably, the lncRNA IGFL2-AS1 gene inhibitor is a small interfering RNA.

[0008] It is further preferred in the present invention that the nucleotide sequence of the shRNA of the small interfering RNA is shown as SEQ ID NO.17 or SEQ ID NO.18.

[0009] 2. Application of lncRNA IGFL2-AS1 gene inhibitors in the preparation of sensitizers for cisplatin or 5-fluorouracil in the treatment of lung cancer.

[0010] 3. The reagent for detecting the expression of lncRNA IGFL2-AS1 gene is used in the preparation of lung cancer diagnostic kit.

[0011] Preferably, the nucleotide sequence of the lncRNA IGFL2-AS1 gene is shown as SEQ ID NO.1; and the kit comprises the primer set shown as SEQ ID NO.5 and SEQ ID NO.6.

[0012] 4. Application of the lncRNA IGFL2-AS1 gene in screening drugs for treating lung cancer. The nucleotide sequence of the lncRNA IGFL2-AS1 gene is shown in SEQ ID NO.1.

[0013] The beneficial effects of the present invention are:

[0014] This study discovered a novel lncRNA, IGFL2-AS1, that is closely associated with multidrug resistance in lung cancer. The cellular localization and function of this non-coding RNA have not been reported in non-small cell lung cancer. The study found that IGFL2-AS1 is primarily localized in the nucleus, with a small amount expressed in the cytoplasm. IGFL2-AS1 promotes the proliferation, migration, and drug resistance of non-small cell lung cancer A549 and H520 cells. Targeted inhibition of IGFL2-AS1 significantly reduces lung cancer cell resistance to cisplatin or 5-fluorouracil. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration:

[0016] Figure 1 is the expression level of long noncoding RNA IGFL2-AS1 in A549 drug-resistant cells and stem cells;

[0017] Among them, A is the transcription level heat map of different splicing forms of IGFL2-AS1 (the vertical axis from top to bottom is IGFL2-AS1-201, IGFL2-AS1-202, IGFL2-AS1-203, IGFL2-AS1-206, IGFL2-AS1-205, IGFL2-AS1-204) in A549 control (CTRL) and DDP-resistant cells (Resistance); B is the transcription level heat map of different splicing forms of IGFL2-AS1 (the horizontal axis from left to right is IGFL2-AS1-201, IGFL2-AS1-202, IGFL2-AS1-203, IGFL2-AS1-206, IGFL2-AS1-205, IGFL2-AS1-204) in A549 control (CTRL) and DDP-resistant cells (Resistance). Figure 3 shows the transcriptional levels of IGFL2-AS1-203, IGFL2-AS1-204, IGFL2-AS1-205, and IGFL2-AS1-206 in A549 control (CTRL, black) and DDP-resistant cells (Resistance, red). C shows the transcriptional levels of IGFL2-AS1-203 in immortalized bronchial epithelial cells (HEBC) and lung cancer cells (A549, H1299, H520, SW900, and H358). D shows the transcriptional levels of IGFL2-AS1-203 in A549 lung cancer control and cells treated with 2µg / ml and 4µg / ml of IGFL2-AS1-203. The expression levels of IGFL2-AS1-203 in DDP-resistant cells after DDP treatment; E is the expression levels of IGFL2-AS1-203 in A549 lung cancer control cells and 5-fluorouracil-resistant cells after treatment with 2µg / ml and 4µg / ml 5-fluorouracil; F is the expression levels of IGFL2-AS1-203 in A549, H520 control cells, and stem cells (H549 Sphere, H520 Sphere);

[0018] Figure 2 The localization of IGFL2-AS1 in A549 and H520 lung cancer cells;

[0019] Among them, A is the nuclear-cytoplasmic fractionation experiment to detect the content of IGFL2-AS1 in the cytoplasm (red) and nucleus (blue) of lung cancer cells; B is the immunofluorescence detection of the distribution of IGFL2-AS1 in the cytoplasm and nucleus of lung cancer cells;

[0020] Figure 3 The expression level of IGFL2-AS1 in clinical lung cancer samples and its correlation with prognosis;

[0021] Among them, A is the expression level of IGFL2-AS1 in lung cancer tissues and paired adjacent normal tissues; B is the correlation between the expression level of IGFL2-AS1 in lung cancer and patient prognosis; C is the difference in IGFL2-AS1 expression before and after gefitinib treatment; D is the difference in IGFL2-AS1 expression before and after erlotinib treatment (P < 0.05 is significant, P < 0.01 is very significant, n represents the total number of samples);

[0022] Figure 4 The effect of IGFL2-AS1 overexpression on lung cancer cell proliferation;

[0023] Among them, A is the overexpression of exogenous IGFL2-AS1 in lung cancer cells; B is the effect of IGFL2-AS1 overexpression on lung cancer cell proliferation shown by CCK8 assay; C is the effect of IGFL2-AS1 overexpression on lung cancer cell clone formation; D is the effect of IGFL2-AS1 overexpression on lung cancer cell proliferation shown by EDU staining;

[0024] Figure 5 Effects of IGFL2-AS1 overexpression on the migration and stemness of lung cancer cells;

[0025] Among them, A is a scratch assay showing the effect of IGFL2-AS1 overexpression on lung cancer migration; B is a stem cell sphere assay showing the effect of IGFL2-AS1 overexpression on lung cancer cell stemness; C is the effect of IGFL2-AS1 overexpression on the expression levels of lung cancer stem cell markers ABCG2, OTC4, and Nanog;

[0026] Figure 6 The effect of IGFL2-AS1 overexpression on drug resistance in lung cancer;

[0027] Among them, A shows the effect of IGFL2-AS1 overexpressing lung cancer cells on cisplatin resistance; B shows the effect of IGFL2-AS1 overexpressing lung cancer cells on 5-fluorouracil resistance;

[0028] Figure 7 The effect of IGFL2-AS1 knockdown on lung cancer invasiveness;

[0029] Among them, A is the expression level of IGFL2-AS1 in lung cancer cells after knockdown; B is the effect of IGFL2-AS1 knockdown on the perforation ability of lung cancer cells;

[0030] Figure 8 Effects of IGFL2-AS1 knockdown on the proliferation and drug resistance of H520 lung cancer cells. DETAILED DESCRIPTION

[0031] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0032] Example 1: RNA high-throughput sequencing and RT-PCR detection

[0033] Transcriptome sequencing was performed on the parental A549 cell line and the DDP-resistant cell line, and expression levels in tumor tissues were assessed using RT-PCR. The RT-PCR protocol was as follows: Total RNA from tumor tissues was extracted using a tissue total RNA extraction kit, and RNA was reverse transcribed into cDNA using a PrimeScript™ RT Master Mix Reverse Transcription Kit. Genetic changes were detected using gene-specific primers (supplementary primer sequences) according to the instructions of the SYBR Premix ExTaq™ real-time fluorescence quantitative detection kit. GAPDH was used as an internal control for gene detection.

[0034] The results showed that compared with the control group, 2,384 genes were upregulated and 2,305 genes were downregulated in the drug-resistant group. The volcano plot of gene expression differences between A549 lung cancer parental cells and DDP-resistant cells showed 938 genes upregulated and 551 genes downregulated. The volcano plot of gene expression differences between A549 lung cancer parental cells and DDP-treated cells showed 1,493 genes upregulated and 940 genes downregulated.

[0035] The most significant lncRNA was screened out, namely IGFL2-AS1, and its spliceosomes IGFL2-AS1-203 (SEQ ID NO.1), IGFL2-AS1-204 (SEQ ID NO.2), IGFL2-AS1-205 (SEQ ID NO.3), and IGFL2-AS1-206 (SEQ ID NO.4) were found to have significantly higher transcription levels in DDP-resistant cells (Resistance) than in the A549 control group ( Figure 1 , A, B), and the transcription level of IGFL2-AS1-203 in lung cancer cells A549, H1299, H520, SW900, and H358 was significantly higher than that in the control group HEBC ( Figure 1 , C). The expression of IGFL2-AS1-203 transcript (hereinafter referred to as IGFL2-AS1) in DDP- and 5-FU-resistant A59 cells was significantly higher than that in parental A549 cells ( Figure 1 , D, E). IGFL2-AS1 expression in multidrug-resistant A549 and H520 stem cells was significantly higher than that in the corresponding lung cancer parental cells ( Figure 1 , F).

[0036] Example 2: IGFL2-AS1 cell localization experiment

[0037] (1) RNA nuclear-cytoplasmic separation

[0038] Using cytoplasmic and nuclear RNA extraction kits, the cytoplasm and nuclei of lung cancer cells A549 and H520 were isolated, and RNA was extracted from each cell line. The nuclear and cytoplasmic RNA were reverse-transcribed into cDNA, and the expression of lncRNAs in the cytoplasm and nucleus was determined by RT-PCR. GAPDH and U6 were used as internal controls for cytoplasmic and nuclear gene detection, respectively. The primer sets used in this invention are shown in Table 1.

[0039] Table 1 Primer set sequences

[0040] Gene Primer Sequence (5′-3′) IGFL2-AS1 IGFL2-AS1-F CATGGAGGAGACAGAGCC (SEQ ID NO.5) IGFL2-AS1-R AGCAGGTAGATAGACTGGAT (SEQ ID NO.6) GAPDH GAPDH-F CTCCTCCTGTTCGACAGTCAGC (SEQ ID NO.7) GAPDH-R CCCAATACGACCAAATCCGTT (SEQ ID NO.8) U6 U6-F CTCGCTTCGGCAGCACA (SEQ ID NO.9) U6-R AACGCTTCACGAATTTGGCT (SEQ ID NO.10) ABCG2 ABCG2-F GTAATCCCCAGGCCTCTATAG (SEQ ID NO.11) ABCG2-R ACTTGGTAACATCCTCATGGG (SEQ ID NO.12) OCT4 OCT4-F GCAGCGACTATGCACAAC (SEQ ID NO.13) OCT4-R GAAAGGGACCGAGGAGTA (SEQ ID NO.14) Nango Nango-F CTCCTCCCATCCCTCATA (SEQ ID NO.15) Nango-R AGGCTCCAACCATACTCC (SEQ ID NO.16)

[0041] The results are as follows Figure 2 As shown in Figure A, IGFL2-AS1 is mainly distributed in the cell nucleus and a small amount is distributed in the cytoplasm, indicating that IGFL2-AS1 mainly functions in the cell nucleus.

[0042] (2) In situ hybridization experiments

[0043] Cells were cultured on poly-lysine-treated coverslips and fixed with 4% paraformaldehyde and washed with distilled water. The slides were treated with methanolic H2O2 at room temperature for 30 min and washed with distilled water. The slides were digested with freshly diluted pepsin in 3% citric acid at 37°C or at room temperature for 5-120 s to expose the nucleic acid fragments. The slides were fixed with 1% paraformaldehyde at room temperature for 10 min. 20 μL of prehybridization solution was added to each slide and the slides were incubated at 38-42°C for 2-4 h. The excess liquid was removed. 20 μL of hybridization solution was added to each slide and the slides were hybridized overnight at 38-42°C. After hybridization, the slides were washed and blocked with blocking solution at 37°C for 30 min. Biotinylated mouse anti-digoxigenin was added dropwise and the slides were incubated at 37°C for 60 min or at room temperature for 120 min, followed by washing with PBS. SABC was added dropwise at 37°C for 20 min or at room temperature for 30 min, followed by washing with PBS. Biotinylated peroxidase was added dropwise at 37°C for 20 min or at room temperature for 30 min, followed by washing with PBS. DAPI staining was performed and washed with PBS. Color development; counterstaining with hematoxylin; dehydration with alcohol, clearing with xylene, and sealing. Figure 2 , As shown in B, IGFL2-AS1 is mainly located in the nucleus.

[0044] Example 3. Analysis of IGFL2-AS1 expression levels in lung cancer clinical samples and its correlation with prognosis

[0045] The samples in this example are from the database https: / / lncar.renlab.org / . The expression level of IGFL2-AS1 in clinical lung cancer samples and the correlation analysis results with prognosis are shown in Figure 3As shown in Figure 2, the expression levels of IGFL2-AS1 in lung cancer tissues and paired adjacent adjacent tissues from 9 lung cancer patients were higher than those in 9 healthy samples ( Figure 3 , A), and 128 patients with low expression of IGFL2-AS1 ( Figure 3 , B blue) had a higher overall survival rate than 53 patients with high IGFL2-AS1 expression ( Figure 3 , B red line), indicating that the expression level of IGFL2-AS1 in lung cancer is negatively correlated with the patient's prognosis. The expression level of IGFL2-AS1 in patients treated with gefitinib and erlotinib is reduced ( Figure 3 , C, D).

[0046] Example 4: Effects of IGFL2-AS1 overexpression on lung cancer cell proliferation, migration, colony formation, and stem cell formation

[0047] (1) Take A549 and H520 cells in logarithmic growth phase and culture them at a rate of 1×10 5 100 μg / mL were inoculated into 6-well plates, and 2.5 μg each of the control plasmid pcDNA3.1(-) and the IGLF2-AS1 OE plasmid (the IGFL2-AS1 overexpression plasmid constructed by inserting the IGFL2-AS1-203 fragment shown in SEQ ID NO.1 into the BamH I / Xho I sites of the pcDNA3.1(-) plasmid) (purchased from Weizhen Biotechnology Co., Ltd.) were added and the mixture was stirred at 4 ℃ for 2 h. Transfection was performed using the 3000 Mixture kit. 48 h after transfection, 1 μg / ml puromycin was added to select stable transfected cell lines for subsequent experiments.

[0048] The results are as follows Figure 4 As shown in Figure A, IGFL2-AS1 overexpression cell lines were successfully established in human non-small cell lung cancer cell lines A549 and H520, and the expression level of IGFL2-AS1 was significantly increased.

[0049] (2) Cell culture conditions

[0050] A549 and H520 cells and IGFL2-AS1 overexpressing cell lines were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum at 37°C in a 5% CO2 incubator. HBEC cells were cultured in RPMI-1640 medium supplemented with 20% fetal bovine serum and 5 ng / ml EGF at 37°C in a 5% CO2 incubator.

[0051] (3) CCK8

[0052] Cells in the logarithmic growth phase were seeded into 96-well plates at a density of 5,000 cells per well. Each sample was plated in triplicate, and three blank control wells were included. At 0, 12, 24, 48, 72, and 96 h of culture, 10 µL of CCK-8 solution was added to each well. The plates were incubated in an incubator for 1–4 h. The optical density (OD) at 450 nm was measured using a SpectraMax M5 microplate reader, and the cell proliferation rate was calculated as (OD value of the experimental group - OD value of the blank group) / (OD value of the control group - OD value of the blank group) × 100%.

[0053] The results are as follows Figure 4 As shown in Figure 2, the number of cells in the IGFL2-AS1 overexpression group (red line) was higher than that in the control group A549 and H520. EDU staining also showed that the proportion of EDU-positive cells in the IGFL2-AS1 overexpression group (red line) was higher than that in the control group A549 and H520 ( Figure 4 , D).

[0054] (4) Clone formation experiment

[0055] Cells in logarithmic growth phase were taken and inoculated into 6-well plates, with 500 cells per well. Three replicates were made for each sample. After 2 weeks of culture, the culture medium was discarded, the plates were rinsed once with PBS, fixed with 4% formaldehyde for 15 minutes, stained with crystal violet for 30 minutes, and slowly rinsed with tap water until the background was clean. The plates were then allowed to dry naturally. Gel imaging was used to take pictures, and the results were statistically analyzed using Image J software. Figure 4 , C, overexpression of IGFL2-AS1 significantly enhanced the clonogenic ability of A549 and H520 cells.

[0056] (5) Cell scratch test

[0057] Cells in logarithmic growth phase were seeded in 12-well plates, with 5×10 cells per well. 5 cells, and 3 replicates were made for each sample. After 12 hours of culture, the culture medium was replaced with serum-free culture medium, and a 200µL pipette tip was used to scratch a cross cell scratch on the well plate. Immediately take a picture under the microscope and record the position of the picture, which is the scratch 0h. After 48 hours of culture, the culture plate was removed, the culture medium was discarded, and the photo was slowly rinsed once with PBS. Blank culture medium was added, and the position was recorded and photographed at 0h. The scratch width was recorded under the microscope. The scratch position length was measured using Image J software. The 48h cell migration distance (mm) = 0h scratch width - 48h scratch width, 48h cell migration rate = (0h scratch width - 48h scratch width) / 0h scratch width × 100%. The results are as follows Figure 5 , As shown in A, IGFL2-AS1 overexpression significantly increased the migration rate of A549 and H520 cells.

[0058] (6) Lung cancer stem cell sphere formation experiment

[0059] Cells in logarithmic growth phase were cultured in ultra-low adhesion 12-well cell culture plates in 1 ml of serum-free DMEM supplemented with 1×B27, 20 ng / ml EGF, and 20 ng / ml bFGF, with 1000 cells per well. After 10 days of culture, the number and size of cell spheres were observed and counted. The results showed that overexpression of IGFL2-AS1 promoted the proliferation and sphere formation of A549 and H520 stem cells. Figure 5 , B), IGFL2-AS1 overexpression significantly increased the expression of stem cell markers ABCG2, OCT4, and Nanog in A549 and H520 cells ( Figure 5 , C).

[0060] (7) Effect of IGFL2-AS1 overexpression on drug resistance in lung cancer

[0061] Cells in logarithmically growing phase were seeded into 96-well plates at a density of 5,000 cells per well. Each sample was plated in triplicate, and three blank control wells were also included. After overnight culture, various concentrations of DDP (0 µg / ml, 0.5 µg / ml, 1 µg / ml, 2 µg / ml, 4 µg / ml, and 8 µg / ml) or 5FU (0 µg / ml, 2 µg / ml, 4 µg / ml, 8 µg / ml, 32 µg / ml, and 16 µg / ml) were added to each well. After 48 hours, 10 µL of CCK-8 solution was added to each well. The cells were incubated in an incubator for 1-4 hours, and the absorbance (OD) at 450 nm was measured using a microplate reader. Cell viability (%) was calculated as [A(treated) - A(blank)] / [A(0 treated) - A(blank)] × 100.

[0062] The results are as follows Figure 6 As shown, IGFL2-AS1 overexpression significantly increased the half-maximal inhibitory concentration (IC50) of DDP on A549 and H520 cells. Figure 6 , A), IGFL2-AS1 overexpression significantly increased the half inhibitory concentration IC50 of 5-FU on A549 and H520 cells ( Figure 6 , B), indicating that IGFL2-AS1 overexpression increased the drug resistance of lung cancer cells to DDP and 5-FU.

[0063] Example 5: Effects of IGFL2-AS1 knockdown on lung cancer invasiveness, cell proliferation, and drug resistance

[0064] (1) Referring to the method in (1) of Example 4, the control plasmid pLent (modified and provided by Weizhen Biotechnology Co., Ltd., number: pLV10001-KD, pLent-U6-[BamH I / Mlu I]-CMV-copGFP-P2A-Puro) and the IGLF2-AS1 knockdown plasmids #2 and #3 (obtained by inserting the shRNA2 fragment shown in SEQ ID NO.17 or the shRNA3 fragment shown in SEQ ID NO.18 into the BamH I / Mlu I restriction site of the control plasmid pLent) were transfected into A549 and H520 cells. After 48 hours of transfection, 1 μg / ml puromycin was added to screen the stable transfected cell lines for subsequent experiments. RT-PCR showed that shRNA targeting IGFL2-AS1 could significantly reduce the expression of IGFL2-AS1 in lung cancer cells A549 and H520 ( Figure 7 , A).

[0065] shRNA2(IGLF2-AS1 #2): ACACATAACACCGTGTTTAATTTCAAGAGAATTAAACACGGTGTTATGTGTTTTTTT (SEQ ID NO.17);

[0066] shRNA3(IGLF2-AS1 #3): CACAAGCTGTTCCAGTATAATTTCAAGAGAATTATACTGGAACAGCTTGTGTTTTTT (SEQ ID NO.18);

[0067] (2) Cell perforation assay to detect the effect of IGFL2-AS1 knockdown on lung cancer invasiveness

[0068] Cells in logarithmic growth phase were taken and the cell content was adjusted to 1×10 5 150 µL of cell suspension was added to the upper chamber of the Transwell, and 700 µL of DMEM medium or conditioned medium containing 20% ​​fetal bovine serum was added to the lower chamber. After 24 h of incubation, the chamber was removed and fixed with methanol for 20 min. After washing with PBS, the cells were stained with 0.1% crystal violet for 20 min. The floating stain was washed with PBS, and the cells were observed and photographed under a microscope. Three random fields of view were read in each chamber to count the cells. The experimental results are shown in Figure 2. Figure 7 As shown in Figure , B, IGFL2-AS1 overexpression can promote lung cancer cell migration, and IGFL2-AS1 knockdown can significantly inhibit lung cancer cell migration.

[0069] (3) Effects of IGFL2-AS1 knockdown on lung cancer cell proliferation and drug resistance

[0070] Referring to the experimental methods of (3) and (7) in Example 4, the proliferation and drug resistance of A549 and H520 IGFL2-AS1 knockdown cell lines were tested. Figure 8 As shown in the results, IGFL2-AS1 knockdown can significantly reduce the half inhibitory concentration IC50 of DDP on H520 and A549 lung cancer cells, and IGFL2-AS1 knockdown can also significantly reduce the half inhibitory concentration IC50 of 5-FU on H520 and A549 lung cancer cells.

[0071] This study discovered a novel lncRNA, IGFL2-AS1, that is closely associated with multidrug resistance in lung cancer. The cellular localization and function of this non-coding RNA have not been reported in non-small cell lung cancer. The study found that IGFL2-AS1 is primarily localized in the nucleus, with a small amount expressed in the cytoplasm. IGFL2-AS1 promotes the proliferation, migration, and drug resistance of non-small cell lung cancer A549 and H520 cells. Targeted inhibition of IGFL2-AS1 significantly reduces lung cancer cell resistance to cisplatin or 5-fluorouracil.

[0072] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

Claims

1. Use of a lncRNA IGFL2-AS1 gene inhibitor in the preparation of a drug for treating lung cancer, characterized in that: The nucleotide sequence of the lncRNA IGFL2-AS1 gene is shown as SEQ ID NO.1, and the lncRNA IGFL2-AS1 gene inhibitor is the shRNA sequence shown as SEQ ID NO.17 or SEQ ID NO.

18.

2. Use of a lncRNA IGFL2-AS1 gene inhibitor in the preparation of a sensitizer for cisplatin or 5-fluorouracil in the treatment of lung cancer, characterized by: The nucleotide sequence of the lncRNA IGFL2-AS1 gene is shown as SEQ ID NO.1, and the lncRNA IGFL2-AS1 gene inhibitor is the shRNA sequence shown as SEQ ID NO.17 or SEQ ID NO.

18.

3. A reagent for detecting lncRNA IGFL2-AS1 gene expression is used in the preparation of a lung cancer diagnostic kit, characterized in that: The nucleotide sequence of the lncRNA IGFL2-AS1 gene is shown in SEQ ID NO.1; the reagent for detecting the expression of the lncRNA IGFL2-AS1 gene comprises the primer set shown in SEQ ID NO.5 and SEQ ID NO.6.

Citation Information

Patent Citations

  • Application of lncRNA IGFL2-AS1 as colon cancer diagnosis marker

    CN111411155A

  • Simultaneous spatio-temporal measurement of gene expression and cellular activity

    US20220090175A1