Antigenic epitope peptide of fimA of klebsiella pneumoniae and application thereof

By screening and conjugating antigenic dominant epitope peptides of the FimA protein, combined with aluminum adjuvants and specific antibodies, the targeting problem in Klebsiella pneumoniae vaccine design has been solved, achieving highly efficient and safe prevention and treatment effects, and providing a broad-spectrum diagnostic tool.

CN116813725BActive Publication Date: 2025-11-04SHENZHEN KANGTAI BIOLOGICAL PROD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310825584.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-06
Publication Date
2025-11-04
Estimated Expiration
2043-07-06

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively screening and identifying B-cell dominant epitopes of the FimA protein in Klebsiella pneumoniae, resulting in a lack of specificity and effectiveness in the design of vaccines and treatments against Klebsiella pneumoniae infection.

Method used

The dominant epitope peptide of FimA protein was screened using bioinformatics methods, and then conjugated with polypeptides to prepare a pharmaceutical composition for the prevention or treatment of Klebsiella pneumoniae infection. Immunization was performed using aluminum adjuvants such as Al(OH)3, and specific antibodies were combined for diagnosis and treatment.

Benefits of technology

It achieves efficient, low-toxicity, and safe prevention and treatment of Klebsiella pneumoniae infection, provides an efficient diagnostic tool, and the epitope peptide has a sequence conserved in multiple Klebsiella pneumoniae strains, making it suitable for various forms of infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116813725B_ABST
    Figure CN116813725B_ABST
Patent Text Reader

Abstract

The application provides an antigen epitope peptide of FimA of Klebsiella pneumoniae, and the antigen epitope peptide comprises an antigen dominant epitope with an amino acid sequence of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 and / or SEQ ID NO: 25. The antigen epitope peptide provided by the application is coupled with a protein to realize active immunization, and has an effect of preventing Klebsiella pneumoniae infection, and can be used for preparing a high-efficiency, low-toxicity and high-safety FimA-based drug for preventing Klebsiella pneumoniae infection.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of medicine and immunology, and particularly relates to an antigen epitope peptide of FimA of Klebsiella pneumoniae and application thereof. BACKGROUND

[0002] Klebsiella pneumoniae (KP) is one of the most common and important pathogenic bacteria in hospital-acquired infections, which can cause severe systemic and multi-organ infections, and is also a common drug-resistant strain worldwide. According to the data of CHINET Chinese Bacterial Drug Resistance Surveillance Network in 2020, among the pathogenic bacteria isolated from clinical infection samples, Klebsiella pneumoniae ranked second (13.86%), and showed an increasing trend year by year, with a drug resistance rate of more than 30% to the third generation cephalosporins. The average mortality rate of Klebsiella pneumoniae infection cases in China is 15.2%-27.8%.

[0003] According to its virulence and pathogenic characteristics, Klebsiella pneumoniae (KP) can be divided into classic Klebsiella pneumonia (cKP) and hypervirulent Klebsiella pneumonia (hvKP), among which hvKP is more likely to cause diseases in healthy people and young people due to its high mucosity. In recent years, due to the widespread prevalence of highly invasive and highly toxic bacteria such as carbapenem-resistant Klebsiella pneumoniae, it has become a major threat to public health, and the drug resistance situation is also very serious, and the drug resistance mechanisms are complex and diverse, including production of β-lactamase, aminoglycoside inactivation enzyme, chromosomal variation, plasmid and integron mediation, outer membrane porin deletion, target change, biofilm formation and active efflux mechanism, etc. Making it difficult to treat with antibiotics, and finding new non-antibiotic therapies is imminent, and vaccines are not affected by antibiotic resistance, starting from the immunological perspective, developing safe and effective vaccines is a very potential control strategy. However, there is no certified Klebsiella pneumoniae vaccine at present. Analyzing the effective components of important antigens of Klebsiella pneumoniae to induce protective response and the immune response mechanism is the basis and premise for solving this scientific problem.

[0004] Although Klebsiella pneumoniae has multiple virulence factors to play a pathogenic role, the premise of Klebsiella pneumoniae pathogenesis is to be able to colonize in the patient's body, and then grow and cause disease. Pili is a protruding structure on the surface of gram-negative bacteria, which has strong adhesion activity, and can adhere Klebsiella pneumoniae to the surface of host cells, trigger infection and cause disease. Type I pili contains FimA, B, C, D, E and H and other proteins, among which FimA is the main structural protein, accounting for more than 95% of the total protein of type I pili. FimA protein can stimulate the host to secrete inflammatory factors, participate in adhesion and inhibit apoptosis, and studies have confirmed that type I pili is a key factor for urinary tract infection of Escherichia coli and Klebsiella pneumoniae, and the structure of type I pili of Klebsiella pneumoniae and Escherichia coli is highly similar, and the main component is FimA protein. Studies have confirmed that the monoclonal antibody against FimA protein can prevent Porphyromonas gingivalis from adhering and protect the host. This suggests that FimA is a potential protective antigen against Klebsiella pneumoniae infection.

[0005] A large number of reports have confirmed that antibody response plays an important protective role in anti-Klebsiella pneumoniae infection. Since protein antigens exert their functions mainly through epitopes in them to embody specificity, the "immunodominant" epitopes play a major role. Therefore, the identification of the protective epitopes of the immunodominant response in the FimA antigen is an important prerequisite for improving and optimizing the design of the Klebsiella pneumoniae vaccine based on the FimA antigen. Screening the immunodominant epitopes of FimA is a prerequisite for stimulating more effective FimA immune response. The known B cell epitopes of FimA at present are either speculated by bioinformatics software or identified using human or animal immune models, and there is no report on the comprehensive screening of the "dominant epitopes" of FimA involved in immune response in different immune pathways. Since the existing human population immune vaccine adjuvants mainly include aluminum adjuvants (such as Al(OH)3) and MF59, etc., therefore, it is urgent to establish an accurate and effective method for screening and identifying the B cell "dominant epitopes" of FimA involved in immune response under aluminum adjuvant. SUMMARY

[0006] In view of the above-mentioned needs, the present application provides a method for identifying the antibody dominant epitope peptide of Klebsiella pneumoniae FimA, and application of the epitope peptide in preparation of a medicine for diagnosing, preventing and / or treating Klebsiella pneumoniae infection.

[0007] The present application first provides an antigen epitope peptide of Klebsiella pneumoniae FimA protein, which comprises at least one antigen dominant epitope, and the amino acid sequence of the antigen dominant epitope is SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 25.

[0008] In one embodiment according to the present application, the antigen epitope peptide is coupled with a polypeptide label at its N-terminus or C-terminus; preferably, the polypeptide label is a biotin label or a fluorescent label.

[0009] The present application further provides use of the antigen epitope peptide in preparation of a diagnostic reagent for diagnosing Klebsiella pneumoniae infection, and use of the antigen epitope peptide in preparation of a vaccine for preventing or treating Klebsiella pneumoniae infection.

[0010] The present application further provides a pharmaceutical composition for preventing or treating Klebsiella pneumoniae infection, comprising the antigen epitope peptide and a pharmaceutically acceptable excipient; preferably, further comprising a carrier protein coupled with the antigen epitope peptide, the carrier protein being Keyhole Limpet Hemocyanin (KLH), Bovine Serum Albumin (BSA) or Ovalbumin (OVA).

[0011] In one embodiment according to the present application, the pharmaceutical composition further comprises an adjuvant selected from Al(OH)3, complete Freund's adjuvant, incomplete Freund's adjuvant, AddaVax; preferably, the adjuvant is Al(OH)3.

[0012] In one embodiment according to the present application, the pharmaceutical composition is in a dosage form for nasal administration; preferably, a spray, a nasal drop, a powder, a gel preparation or a microsphere preparation.

[0013] The present application further provides a diagnostic reagent for diagnosing Klebsiella pneumoniae infection, comprising the antigen epitope peptide coated on a detection carrier, the detection carrier being selected from any one of polystyrene micro-reaction plates, colloidal gold reagent strips, magnetic beads and microfluidic chips.

[0014] In one embodiment according to the present application, the diagnostic reagent further comprises a first antibody specifically recognizing the antigen epitope peptide, the first antibody being a murine antibody; preferably, the first antibody is a polyclonal antibody isolated from a mouse or rat immunized with the antigen epitope peptide, or a monoclonal antibody prepared based on B lymphocytes of the mouse or rat after immunization.

[0015] In one embodiment according to the present application, the diagnostic reagent further comprises a second antibody specifically recognizing the murine IgG antibody;

[0016] Preferably, the second antibody is selected from one of a goat anti-mouse monoclonal antibody and a rabbit anti-mouse polyclonal antibody;

[0017] Preferably, the second antibody is coupled with a coordination group activating or quenching the specific fluorescent group.

[0018] The beneficial effects of the above technical solutions of the present application are as follows:

[0019] The antigen epitope peptide of FimA protein provided by the present application has a significant effect of resisting Klebsiella pneumoniae infection, and can be used to prepare a high-efficiency, low-toxicity, high-safety FimA-based drug, such as a prophylactic vaccine, for preventing Klebsiella pneumoniae infection.

[0020] The antibody dominant epitope peptide of FimA of Klebsiella pneumoniae provided by the present application has an effect of resisting Klebsiella pneumoniae infection, and animals immunized with the dominant epitope have no irrelevant components or harmful components in the immunization preparation. The specific monoclonal antibody prepared from the antibody dominant epitope peptide can better prevent Klebsiella pneumoniae infection.

[0021] Through sequence alignment analysis, the antibody dominant epitope peptide of FimA of Klebsiella pneumoniae provided by the present application is conserved in sequences in various Klebsiella pneumoniae strains, and therefore, it can also be used as a diagnostic reagent for Klebsiella pneumoniae or for the prevention and treatment of other Klebsiella pneumoniae infections. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 A result map of ELISA detection of the overlapping peptides screened by the present application using the serum of BALB / c mice immunized by intramuscular injection of FimA as a primary antibody;

[0023] Figure 2 A specific antibody titer map of the serum induced by BALB / c mice immunized by intramuscular injection of FimA;

[0024] Figure 3 A specific antibody subtype map of the serum induced by BALB / c mice immunized by intramuscular injection of FimA;

[0025] Figure 4 A survival rate map of BALB / c mice immunized by intramuscular injection of FimA against Klebsiella pneumoniae infection;

[0026] Figure 5 An antibody titer map specific to the FimA epitope-KLH conjugate protein screened by the present application;

[0027] Figure 6 A result map of the antibody subtype specific to the FimA epitope-KLH conjugate protein screened by the present application;

[0028] Figure 7 A result map of the survival rate of mice immunized by the FimA epitope-KLH conjugate protein screened by the present application against Klebsiella pneumoniae infection;

[0029] Figure 8Figure of amino acid sequence conservation analysis of the FimA antibody immune dominant epitope peptide screened by the present application. DETAILED DESCRIPTION

[0030] To make the technical problems, technical solutions and advantages of the present application clearer, the following will be described in detail with reference to the drawings and specific embodiments.

[0031] If not specifically stated, the reagents used in the embodiments are all of analytical purity, and the progress of all chemical reactions is detected by thin layer chromatography.

[0032] Obtaining of overlapping peptides in Example 1

[0033] Based on the FimA protein sequence (Sequence ID: WP_032434944.1), relative to the length of the expected overlapping peptide, the amino acid number moving downstream each time is less than the length of the overlapping peptide, and another expected overlapping peptide is obtained again. Among them, the length of the expected overlapping peptide can be 15-30 amino acids, and the amino acid number of each step can be 4-8. In this embodiment, 6 amino acids are moved each time starting from the first amino acid, and 18 amino acid polypeptides are synthesized by stepwise overlapping (Shanghai Jier Biochemical Technology Co., Ltd.). A total of 25 overlapping peptides are obtained, all with a purity of greater than 95%. The information of the synthesized stepwise overlapping peptides is shown in Table 1. The synthesized peptide segments are dissolved in dimethyl sulfoxide (DMSO) to a storage concentration of 1 mg / mL, aliquoted and stored at -70°C, and diluted to 1 mM with PBS before use.

[0034] Table 1: Information of stepwise overlapping peptides

[0035]

[0036] Collection and preservation of FimA immune serum in Example 2

[0037] The recombinant FimA whole protein is prepared by reverse vaccinology technology. The gene sequence of Klebsiella pneumoniae strain is analyzed by bioinformatics method to obtain the gene and amino acid information of the antigen FimA (information number KPN_02984, Table 2). The primers are designed and the target gene is cloned (primer information as shown in Table 3, and the gene sequence is SEQ ID NO: 26). The enzyme cutting sites are BamHI and XhoI, and the pGEX-6P-1 plasmid is connected. The Escherichia coli is used as the host cell to construct the genetic engineering bacteria. The target protein with GST tag is induced and expressed. The GST tag is removed by enzyme cutting. The molecular weight of the FimA recombinant protein after removing the GST tag is 17.3 KDa. The purified protein is subjected to SDS-PAGE to identify the size of the molecular weight. The FimA protein with a purity of greater than 95% is prepared.

[0038] The nucleotide sequence of the original gene of the FimA protein SEQ ID NO: 26 is as follows: ATGGTACTCGTCGGCTTGACCTCACACTATGCCTCCGCGGCGGACGGTACGCTGTATTTTTCAGGTACAATTGTCAACTCAACTTGCAAACTGGCAAGCGGCAATGAGAAGGGTCTCATTGAAGTTAAGATGGGCGCTGTTCCGCTGTCTAAATTAAAAAATGATACCAATGGCACCGGGCCAGAAGTTGGGGTCAATATTAGCGTCAAAGATTGTGAAGCGGGCACGTACTATATTGTGCTCGACGGTGCTTCAGCCAACGAGGCGCCTATCACTAACGTACTGGCTCTCGATGCGGGTAATCCTACAGCTAAAAAAGTCGGCATTAAGCTAACCGACCGCAATAATACCCCGGTCACGCTCGATAAACCTTTCGATCCCAACGTCGACCCGCGTATTACGGTCAATGCCGATGGCACCGGTACCTTCAACCTGAAAGCCTATTACTATACCTGGGATAAAGACAACGCCGAAGCTGGCGACGGCAATGCGACCGCCAGGTTTACCATTATACAGCAATAA

[0039] Table 2 Basic information of FimA antigen

[0040]

[0041] Table 3 Primer information of FimA protein

[0042]

[0043] The FimA protein dose for immunizing mice was 50 ug per mouse, the adjuvant Al(OH)3 dose was 50 μL, the immunization route was nasal drop immunization, and the immunization was performed three times at 0, 7, and 14 days. The titer of the antiserum was measured, and the mouse immune serum with a FimA titer greater than 1:64,000 was selected for subsequent detection.

[0044] Example 3 Screening of B cell immunodominant epitopes of FimA

[0045] Adjust the concentration of the overlapping peptide coating 5 pg / well (use the peptide pool of full protein FimA as a positive control), after coating-washing-blocking-washing again, add the FimA immune antiserum obtained in Example 2, dilution 1:500, incubate for 1 h-washing, add HRP-goat anti-mouse IgG (purchased from Biyun, item number A0216), dilution 1:5000, after washing, add TMB substrate developing solution (purchased from Beyotime / Biyun, item number P0209-500ml), after stopping the reaction, read OD value at 450nm, according to the formula 18 amino acid overlapping peptide OD detection value-blank control detection value) / (negative peptide OD detection value-blank control detection value)≥2.1 as positive overlapping peptide. The data were tested by GraphPad Prism 8.0 software, and the positive overlapping peptide with significant statistical significance relative to the readings of other positive overlapping peptides was obtained by oneway Analysis Of Variance (ANOVA) analysis method, defined as the immunodominant epitope peptide of B cells, that is, the immunodominant epitope peptide. The irrelevant peptide OVA 192–201 (SEQ ID NO:29EDTQAMPFRV) is a negative control peptide.

[0046] Results: As shown in Figure 1 FimA 97-114 (SEQ ID NO:17KLTDRNNTPVTLDKPFDP), FimA 103-120 (SEQ ID NO:18NTPVTLDKPFDPNVDPRI), FimA 109-126 (SEQ ID NO:19DKPFDPNVDPRITVNADG) and FimA 145-160 (SEQ ID NO:25EAGDGNATARFTIIQQ) have significant statistical significance relative to the readings of other dominant peptides, defined as dominant epitopes, and OVA 192-201 is a negative control peptide in the figure; not only all B cell epitopes of FimA are screened by this method, but also the B cell dominant epitopes of FimA are determined.

[0047] Example 4 Analysis of the ability of FimA muscle injection immunized BALB / c mice to protect mice against Klebsiella pneumoniae infection

[0048] To evaluate the immunogenicity of FimA, the recombinant FimA protein obtained in Example 2 was used to immunize BALB / c mice (10, 6-8 weeks old) by intramuscular injection at a dose of 50 μg / mouse, mixed with Al(OH)3 (purchased from InvivoGen) at a dose of 50 μl / mouse. Seven days after the last immunization, the tail vein blood was collected to isolate antisera, and the FimA-specific antibody level was detected.

[0049] 1. Detection of the binding of antisera to FimA protein:

[0050] The coating concentration of FimA whole protein was adjusted to 5 μg / ml. After coating, washing, blocking and washing again, the antisera (normal mouse serum as negative control, and PBST as blank control) were added at dilutions of 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000 and 1:128000, respectively, and incubated for 1 h. After washing, HRP-goat anti-mouse IgG (purchased from Biyun, A0216) was added at a dilution of 1:250, and TMB substrate (purchased from Beyotime, P0209-500 ml) was added after washing. The reaction was terminated, and the OD value was read at 450 nm.

[0051] The FimA-specific IgG antibody titer of the serum of immunized mice was determined as shown in Table 1. Figure 2 The results showed that the log10 value of FimA-specific IgG antibody titer was 1.87 ± 0.00 (P < 0.001). The above results indicated that nasal immunization of FimA with Al(OH)3 adjuvant could induce high levels of FimA-specific antibodies.

[0052] The FimA-specific IgG antibody subtype analysis results of the serum of immunized mice are shown in Table 2. The FimA-specific IgG antibodies were mainly of IgG1 subtype. Figure 3

[0053] 2. Challenge protection test

[0054] To evaluate the immunoprotection of FimA, the BALB / c mice (6-8 weeks old, female) were subjected to challenge protection test of Klebsiella pneumoniae 7 days after the last immunization.

[0055] After the BALB / c mice were anesthetized by intraperitoneal injection of sodium pentobarbital (75 mg / kg), the trachea was cannulated through the mouth without incision, and 20 μl of PBS resuspended Klebsiella pneumoniae was injected into the lungs using a microsyringe. The challenge bacteria amount was 3 x 10 8 ​CFU / ml. The infected mice were observed for signs every 12 h on days 0-10 post-challenge. The survival rate of mice was observed for 7 consecutive days post-challenge.

[0056] 3. Survival rate calculation:

[0057] The survival of the wild female transgenic mice in the immunization group and the control group was observed in the systemic infection model two weeks after the last immunization with the epitope peptide-KLH fusion protein antigen, and the survival curves of the experimental and control groups were analyzed.

[0058] The results are shown in Table 1. Figure 4

[0059] The survival rate of mice actively immunized with recombinant FimA combined with adjuvant Al(OH)3 was 90%, and the survival rate of mice actively immunized with PBS combined with adjuvant Al(OH)3 was 10%. It was confirmed that FimA is an ideal protective antigen against infection of Klebsiella pneumoniae standard strain ATCC700721.

[0060] Example 5 Analysis of the ability of immunodominant epitope peptide active immunization to protect mice against Klebsiella pneumoniae infection

[0061] 1. Animal immunization:

[0062] 6-8 week old BALB / c mice were immunized with immunodominant epitope peptide-KLH fusion protein three times on the thigh muscle at days 0, 7, and 14 with the aid of adjuvant Al(OH)3 (purchased from InvivoGen company). The immunization dose was 100 μg per mouse for epitope peptide-KLH fusion protein and 100 μL per mouse for adjuvant Al(OH)3 (purchased from InvivoGen company).

[0063] The results are shown in Table 2. Figure 5 The log10 value of epitope peptide-specific IgG antibody titer in the serum of immunized mice was 3.18±0.20 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3, 3.45±0.04 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3, and 3.28±0.13 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3. 97-114 The log10 value of epitope peptide-specific IgG antibody titer in the serum of immunized mice was 3.18±0.20 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3, 3.45±0.04 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3, and 3.28±0.13 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3. 103-120 The log10 value of epitope peptide-specific IgG antibody titer in the serum of immunized mice was 3.18±0.20 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3, 3.45±0.04 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3, and 3.28±0.13 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3. 109-126 The log10 value of epitope peptide-specific IgG antibody titer in the serum of immunized mice was 3.18±0.20 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3, 3.45±0.04 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3, and 3.28±0.13 (P<0.001) in the group actively immunized with FimA-KLH combined with adjuvant Al(OH)3. 145-160 ​The log10 value of the IgG antibody titer specific to the epitope peptide was 2.69+0.34 (P<0.001) in the KLH combined with the adjuvant Al(OH)3 active immunization, which indicated that the immunodominant peptide-FimA-KLH conjugated protein combined with the Al(OH)3 adjuvant intramuscular immunization could induce a high level of the epitope peptide specific antibody.

[0064] The results of the epitope peptide specific antibody subtype of the immunized mouse serum are shown in Table 2. Figure 6 As shown in Table 2, the four kinds of epitope peptide specific IgG antibodies were mainly IgG1 subtype in the PBS combined with the adjuvant Al(OH)3 group as the control.

[0065] 2. Evaluation of the immunoprotective effect:

[0066] On the 7th day after the last immunization of the immunodominant epitope peptide-FimA-KLH fusion protein, the BALB / c mice were anesthetized by intraperitoneal injection of sodium pentobarbital (75 mg / kg), and 20 μl of the PBS resuspended Klebsiella pneumoniae bacterial solution was injected into the lungs through the oral tracheal intubation with a micro-injection needle, and the bacterial amount of each mouse was 3x10 8 CFU / ml. The infected mice were observed every 12 hours from the 0th day to the 10th day after the infection. The survival rate of the mice was observed for 7 days after the infection.

[0067] 3. Calculation of the survival rate:

[0068] The survival state of the mice in the whole body infection model was observed two weeks after the last immunization of the epitope peptide-KLH fusion protein antigen in the wild female transgenic mice of the immunized group and the control group, and the survival curve analysis of the experimental group and the control group was performed.

[0069] The results are shown in Table 3. Figure 7 As shown in Table 3, the results showed that the survival rate of the mice in the KLH combined with the adjuvant Al(OH)3 active immunization was 20%, the survival rate of the mice in the FimA 97-114 -KLH combined with the adjuvant Al(OH)3 active immunization of the mice was 20%, the survival rate of the mice in the FimA 103-120 -KLH combined with the adjuvant Al(OH)3 active immunization of the mice was 50%, the survival rate of the mice in the FimA 109-1260 -KLH combined with the adjuvant Al(OH)3 active immunization of the mice was 40%, the survival rate of the mice in the FimA 145-160 -KLH combined with the adjuvant Al(OH)3 active immunization of the mice was 20%. In comparison, the survival rate of the mice in the PBS combined with the adjuvant Al(OH)3 active immunization was 10%.

[0070] Data were analyzed by GraphPad Prism 8.0 software, and the survival data of the PBS combined with adjuvant Al(OH)3 group were used as controls. The highest survival rate of the two groups was FimA 103-120 KLH as antigen combined with adjuvant Al(OH)3 immunization group survival data P=0.0029, FimA 109-126 KLH as antigen combined with adjuvant Al(OH)3 immunization group survival data P=0.0047, all with statistical differences. The above proves that the dominant peptide FimA 97-114 , FimA 103-120 , FimA 109-126 and FimA 145-160 are all protective immune dominant epitopes of K. pneumoniae standard strain ATCC700721 infection, in which the dominant peptide FimA 103-120 and FimA 109-126 have stronger active immunization protection effect.

[0071] Example 7 This example is used to analyze the amino acid sequence conservation of the antibody immune dominant epitope peptide FimA 97-114 , FimA 103-120 , FimA 109-126 and FimA 145-160 screened by the present application

[0072] The amino acid sequences of FimA proteins of 30 K. pneumoniae strains were retrieved from the Genbank database, and the Basic Local Alignment Search Tool (BLAST) software of NCBI was used for amino acid sequence alignment analysis. Randomly selected 30 strains were subjected to multiple sequence alignment (Multiple Alignment), and the website address was https: / / blast.ncbi.nlm.nih.gov / Blast.cgi.

[0073] The results are shown in Figure 8 , FimA 97-114 , FimA 103-120 , FimA 109-126 and FimA 145-160 have good application prospects.

[0074] The above is the preferred embodiment of the present application. It should be noted that for those skilled in the art, without departing from the principles of the present application, several improvements and refinements can be made, and these improvements and refinements should be considered as the protection scope of the present application.

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

Claims

1. An antigenic epitope peptide of Klebsiella pneumoniae FimA protein, characterized in that, The amino acid sequence of the antigenic epitope peptide is SEQ ID NO:

18.

2. An antigenic epitope peptide of Klebsiella pneumoniae FimA protein, characterized in that, The antigenic epitope peptide of claim 1 is coupled with a polypeptide label at its N-terminus or C-terminus.

3. The antigenic epitope peptide according to claim 2, characterized in that, The polypeptide is labeled with biotin or fluorescent label.

4. Use of the antigenic epitope peptide as described in claim 1 or 2 in the preparation of diagnostic reagents for diagnosing Klebsiella pneumoniae infection.

5. Use of the antigenic epitope peptide as described in claim 1 or 2 in the preparation of a vaccine for the prevention or treatment of Klebsiella pneumoniae infection.

6. A pharmaceutical composition for the prevention or treatment of Klebsiella pneumoniae infection, characterized in that, The pharmaceutical composition contains the antigenic epitope peptide as described in claim 1 or 2, or a fusion protein formed by the antigenic epitope peptide and a carrier protein, and pharmaceutically acceptable excipients; and The carrier protein is keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), or ovalbumin (OVA).

7. The pharmaceutical composition according to claim 6, characterized in that, It also contains an adjuvant selected from Al(OH)3, complete Freund's adjuvant, incomplete Freund's adjuvant, and AddaVax.

8. The pharmaceutical composition according to claim 7, characterized in that, The adjuvant is Al(OH)3.

9. The pharmaceutical composition according to any one of claims 6-8, characterized in that, The pharmaceutical composition is a nasal dosage form.

10. The pharmaceutical composition according to claim 9, characterized in that, The dosage form is a spray, nasal drops, powder, gel, or microsphere.

11. A diagnostic reagent for diagnosing Klebsiella pneumoniae infection, characterized in that, The assay comprises the antigenic epitope peptide as described in claim 1 or 2, wherein the antigenic epitope peptide is coated on a detection carrier selected from any one of polystyrene microplates, colloidal gold strips, magnetic beads, and microfluidic chips.