A picrorhiza small rna, a small rna composition for preventing and / or treating non-alcoholic fatty liver, a preparation method and use thereof
By extracting and screening three small RNAs from Pien Tze Huang, which bind to and inhibit genes related to non-alcoholic fatty liver disease, the problem of unclear pharmacological mechanism of Pien Tze Huang has been solved, achieving effective prevention and treatment of non-alcoholic fatty liver disease and improving the quality control of Pien Tze Huang products.
Patent Information
- Application Number
- CN202310933809.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-27
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2043-07-27
AI Technical Summary
In the existing technology, the pharmacological mechanism of Pien Tze Huang is unclear, and there is a lack of effective drug components for the prevention and treatment of non-alcoholic fatty liver disease.
Three small RNAs (PTH-sRNA-6, PTH-sRNA-24, and PTH-sRNA-37) were extracted and screened from the traditional Chinese medicine Pien Tze Huang. These small RNAs can be absorbed through the digestive tract and specifically bind to and inhibit the expression of genes associated with non-alcoholic fatty liver disease, including PCK1, G6PC, PPARA, and HNF4A. They were then prepared into a composition for the prevention and treatment of non-alcoholic fatty liver disease.
By inhibiting the expression of related genes, it significantly suppresses fat accumulation and reduces the levels of TG, ALT, AST, FFA, and ROS, effectively preventing and treating non-alcoholic fatty liver disease. It can also serve as a marker for the quality control of Pien Tze Huang, improving treatment efficacy.
Smart Images

Figure CN116814630B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a small RNA of Pianzhihuang, a small RNA composition of Pianzhihuang, a preparation method and use for preventing and / or treating non-alcoholic fatty liver. BACKGROUND
[0002] Non-alcoholic fatty liver disease (NAFLD) is a clinical and pathological syndrome characterized by excessive deposition of fat in hepatocytes, which is caused by factors other than alcohol and other clear liver damage factors, and is closely related to insulin resistance and genetic susceptibility. It is an acquired metabolic stress-induced liver injury. It includes simple fatty liver (SFL), non-alcoholic steatohepatitis (NASH) and related cirrhosis. With the global trend of obesity and its related metabolic syndrome, non-alcoholic fatty liver disease has become an important cause of chronic liver disease, which seriously threatens human physical and mental health.
[0003] Patent application with publication number CN104042655A discloses that Pianzhihuang and its preparations can be used for treating non-alcoholic fatty liver, and the effect is excellent. The Pianzhihuang formula is a state secret formula, which is mainly refined from various precious traditional Chinese medicines such as Sanqi, snake gall, ox gall, musk and the like, and has multiple effects such as protecting hepatocytes, regulating liver lipid metabolism, reducing collagen deposition and reducing inflammatory response. Pianzhihuang has a wide range of pharmacological effects, significant efficacy, small side effects, focuses on overall regulation, has the advantages of multiple levels and multiple targets, and is widely used for liver protection. However, the mechanism of Pianzhihuang in exerting efficacy has not been clearly defined.
[0004] Small RNA (sRNA) refers to a type of non-coding RNA molecule with a length of less than 200 nt, including micro RNA (miRNA), small interference RNA (siRNA) and piwi-interacting RNA (piRNA). Small RNA can regulate gene expression at the post-transcriptional level and plays an important role in physiological and pathological processes. Recent studies have found that some small RNAs in traditional Chinese medicines can enter the blood and tissues and organs of the body through the digestive tract and play an important role in disease treatment. For example, MIR2911 in honeysuckle decoction can enter the mouse body through oral administration and directly affect the influenza virus. These findings suggest that small RNAs in traditional Chinese medicines may be a new type of effective ingredient of traditional Chinese medicines that has been overlooked for a long time, which can be absorbed through the digestive tract after oral administration and reach the target organs to exert therapeutic value. SUMMARY
[0005] The purpose of the present application is to provide a small RNA of Pianzhihuang, a small RNA composition of Pianzhihuang, a preparation method and use for preventing and / or treating non-alcoholic fatty liver.
[0006] The present application provides a small RNA for preventing and / or treating non-alcoholic fatty liver, which is a nucleotide sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2.
[0007] The present application also provides use of the small RNA nucleotide sequence as shown in any one of SEQ ID NO. 1-3 in preparation of a medicine for preventing and / or treating non-alcoholic fatty liver.
[0008] Preferably, the medicine is a medicine for inhibiting fat accumulation.
[0009] Preferably, the medicine is a medicine for inhibiting TG, ALT and AST levels.
[0010] Preferably, the medicine is a medicine for inhibiting FFA and ROS expression levels.
[0011] Further, the medicine prepared from the nucleotide sequence as shown in SEQ ID NO. 1 is a medicine for inhibiting PPARA gene expression.
[0012] Further, the medicine prepared from the nucleotide sequence as shown in SEQ ID NO. 2 is a medicine for inhibiting HNF4A gene expression.
[0013] Further, the medicine prepared from the nucleotide sequence as shown in SEQ ID NO. 3 is a medicine for inhibiting PCK1 gene and G6PC gene expression.
[0014] The present application also provides a small RNA composition for preventing and / or treating non-alcoholic fatty liver, which is composed of the nucleotide sequences as shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3.
[0015] Further, the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 1 is 40-80%, the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 2 is 10-40%, and the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 3 is 10-30%.
[0016] Further, the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 1 is 66-67%, the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 2 is 20%, and the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 3 is 13-14%.
[0017] Further, the molar ratio of the nucleotide sequences as shown in SEQ ID NO. 1-3 is 1:0.3:0.2.
[0018] The application also provides a preparation method of the small RNA composition, which comprises the following steps:
[0019] The nucleotide sequences shown in SEQ ID NO. 1-3 are mixed to obtain the small RNA composition.
[0020] The application also provides the use of the small RNA composition in the preparation of a medicine for preventing and / or treating non-alcoholic fatty liver.
[0021] Preferably, the medicine is a medicine for inhibiting the expression of PCK1, G6PC, PPARA and HNF4A genes.
[0022] Further, the medicine is a medicine for inhibiting fat accumulation.
[0023] And / or, the medicine is a medicine for inhibiting the levels of TG, ALT and AST.
[0024] And / or, the medicine is a medicine for inhibiting the expression levels of FFA and ROS.
[0025] The application also provides a medicine for preventing and / or treating non-alcoholic fatty liver, which is a preparation prepared from the small RNA or the small RNA composition as an active ingredient and a pharmaceutically acceptable adjuvant or auxiliary ingredient.
[0026] Compared with the prior art, the application has the following beneficial effects:
[0027] The three small RNAs are extracted from the traditional Chinese medicine Pianzhihuang, and the three small RNAs can inhibit the genes related to the occurrence and development of non-alcoholic fatty liver, and thus can play a role in preventing and / or treating non-alcoholic fatty liver. Moreover, the composition obtained by combining the three small RNAs can effectively inhibit fat accumulation, and has a good preventive and / or therapeutic effect on non-alcoholic fatty liver. Meanwhile, the sRNA of the application can be effectively absorbed through food, and stably exists, and is convenient and effective to use. The sRNA of the application can also be used as a marker for quality control of Pianzhihuang, and the Pianzhihuang with high content of sRNA has a better effect on preventing and / or treating non-alcoholic fatty liver. The application finds that the small RNAs in Pianzhihuang are beneficial to preventing and / or treating non-alcoholic fatty liver, which has important significance for further research and development and quality control of Pianzhihuang. According to the screened small RNA molecular pointer, the product quality of each batch of Pianzhihuang can be controlled.
[0028] Obviously, according to the above content of the application, according to the ordinary technical knowledge and common means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical idea of the application.
[0029] The above summary of the application will be further explained with the help of the following detailed description of specific embodiments. This should not be understood as limiting the scope of the above subject matter of the application to the following examples. Any technology based on the above summary of the application falls within the scope of the application. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 Flow chart of small RNA high-throughput sequencing experiment.
[0031] Figure 2 Copy number of Pianzhihuang small RNA obtained by Solexa sequencing.
[0032] Figure 3 Distribution of each Pianzhihuang small RNA in serum.
[0033] Figure 4 Distribution of each Pianzhihuang small RNA in liver.
[0034] Figure 5 Binding result of PTH-sRNA-37 and PCK1 gene mRNA.
[0035] Figure 6 Binding result of PTH-sRNA-37 and G6PC gene mRNA.
[0036] Figure 7 Binding result of PTH-sRNA-6 and PPARA gene mRNA.
[0037] Figure 8 Binding result of PTH-sRNA-24 and HNF4A gene mRNA.
[0038] Figure 9 Luciferase reporter experiment for verifying the binding ability of Pianzhihuang small RNA and target site.
[0039] Figure 10 TG level detection result.
[0040] Figure 11 Blood biochemical index detection result.
[0041] Figure 12 Liver FFA and ROS level detection.
[0042] Figure 13 Mouse liver H&E staining and oil red O staining scale: 100 μm. DETAILED DESCRIPTION
[0043] The raw materials and equipment used in the detailed description of the application are known products, which can be obtained by purchasing commercially available products.
[0044] The Pianzhihuang used in the present application is provided by Zhangzhou Pianzhihuang Pharmaceutical Co., Ltd.
[0045] In the previous study, total RNA of Pianzhihuang is extracted and subjected to small RNA high-throughput sequencing. Then, the mice are gavaged with Pianzhihuang, and the RNA of the serum of the mice is extracted and subjected to small RNA high-throughput sequencing to screen Pianzhihuang drug-derived small RNAs. The small RNAs with copy number greater than 100 are selected for research, and finally three small RNAs related to non-alcoholic fatty liver are found.
[0046] Example 1, verification of small RNA in Pianzhihuang
[0047] 1. Extraction of total RNA in Pianzhihuang
[0048] An appropriate amount of Pianzhihuang is ground into 100-mesh powder at room temperature or low temperature, and then total RNA of the sample is extracted by Trizol reagent. The specific method is as follows:
[0049] 1) The Pianzhihuang is ground into powder using a low-temperature grinder, 50 mg is weighed into a 1.5 ml centrifuge tube, 1 ml of trizol is added and vortexed, and then placed on ice for 10 min;
[0050] 2) 200 μl of chloroform is added, and it is mixed by vigorous shaking, and then it is placed for 5 min;
[0051] 3) 4℃, 14000g centrifugation for 20 min;
[0052] 4) The supernatant is transferred to a new 1.5 ml centrifuge tube, 1-2 times the volume of isopropanol is added, and then it is mixed and placed in -20℃ for 1 h or more;
[0053] 5) 4℃, 14000g centrifugation for 20 min;
[0054] 6) Discard the supernatant and add 1 ml of 75% alcohol prepared with DEPC water and blow;
[0055] 7) 4℃, 14000g centrifugation for 20 min;
[0056] 8) Discard the supernatant, and dry the alcohol by inverting the 1.5 ml centrifuge tube for about 5-10 min;
[0057] 9) Add DEPC water to dissolve and store at -80℃.
[0058] 2. Detection of the content of three small RNAs in the present application
[0059] After total RNA extraction of Piancizhu, high-throughput sequencing technology, reverse transcription PCR (RT-PCR), real-time fluorescence quantitative PCR (qPCR), RNA chip, Northern Blotting, in situ hybridization and other techniques can be used for detection. The specific method of this embodiment is as follows:
[0060] After total RNA extraction of Piancizhu, PAGE electrophoresis is performed to recover 18-45 nt RNA molecules, a 3' adapter is added, and a RT primer with UMI is added to the system to perform reverse transcription extension to synthesize a cDNA chain. Through small RNA high-throughput sequencing technology (the experimental process is shown in Figure 1 ), three small RNA sequences and contents of the present application are detected (Table 1). The RT primer with UMI is provided by a sequencing company (Shenzhen Huada Gene Company Limited).
[0061] Table 1. Name and sequence of small RNA
[0062]
[0063] The copy number of the above three small RNAs is shown in Figure 2 . From Table 1 and Figure 2 , it can be seen that the three Piancizhu small RNAs of the present application have a high content in Piancizhu.
[0064] The beneficial effects of the present application are demonstrated by the following specific test examples.
[0065] Test Example 1, Stability study of Piancizhu small RNA of the present application entering the body through ingestion
[0066] 1. Experimental method
[0067] RT-qPCR method is used to detect Piancizhu small RNA entering the animal body through ingestion and stably existing. Male C57 mice are randomly divided into PBS control group, single-dose Piancizhu administration group and multiple-dose Piancizhu administration group. After fasting for 12 h, Piancizhu is ground into 100 mesh powder, which is used to prepare a suspension with PBS for gavage administration. The single-dose administration group is administered only once, and the multiple-dose administration group is administered once every 3 h, a total of three times. The amount of Piancizhu administered each time is 0.1 g / 100 g. The PBS control group is administered with the same amount of PBS. The mouse blood is taken 6 h after the last gavage, and the liver tissue is taken. RNA is extracted from the serum and liver tissue, and the content of each Piancizhu small RNA (PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37) is detected by Real-time PCR. The primers for reverse transcription PCR and qPCR detection of Piancizhu small RNA are shown in Table 2.
[0068] Table 2. List of primers for reverse transcription PCR and qPCR detection
[0069]
[0070] The QIAamp Viral RNA Mini Kit was used to extract the sRNA of Qiancile from the serum and liver tissue of the mice, and the sRNA was reverse transcribed by using the system shown in Table 3 (10 μl).
[0071] Table 3. sRNA reverse transcription reaction system
[0072]
[0073] After the system was configured, it was mixed and placed in a PCR instrument for reaction, and the reaction procedure was as shown in Table 4.
[0074] Table 4. sRNA reverse transcription procedure
[0075]
[0076] After the reverse transcription was completed, the qPCR primer was used for quantitative detection. The qPCR system was as shown in Table 5, and the reaction procedure was as shown in Table 6.
[0077] Table 5. sRNA fluorescence quantitative PCR reaction system
[0078]
[0079] Table 6. Fluorescence quantitative PCR reaction procedure
[0080]
[0081] 2. Experimental results
[0082] The relative concentration results of the above three Qiancile small RNAs in the serum and liver tissue were as shown in Table 7. Figure 3 and Figure 4 The results showed that the three Qiancile small RNAs of the application could be absorbed through the digestive tract and reached the serum and liver tissue. The experimental results showed that the three Qiancile sRNAs could enter the animal body through ingestion and stably exist.
[0083] Test Example 2, analysis of the binding of Qiancile small RNA and target gene by bioinformatics means
[0084] 1. Experimental method
[0085] Whether the Qiancile small RNA could be combined with the PCK1, G6PC, PPARA and HNF4A target genes was studied, and the therapeutic value of the Qiancile small RNA on non-alcoholic fatty liver was exerted by inhibiting the expression of the target genes. The combination of the three Qiancile small RNAs and the PCK1, G6PC, PPARA and HNF4A target genes was analyzed by using the bioinformatics means (RNA hybrid).
[0086] 2. Experimental results
[0087] The binding ability of PTH-sRNA-37 to PCK1 gene mRNA is shown in Figure 5 The figure shows the binding mode, binding site and binding free energy of PTH-sRNA-37 to PCK1 gene mRNA. PTH-sRNA-37 has four binding modes to PCK1.
[0088] The binding ability of PTH-sRNA-37 to G6PC gene mRNA is shown in Figure 6 The figure shows the binding mode, binding site and binding free energy of PTH-sRNA-37 to G6PC gene mRNA. PTH-sRNA-37 has four binding modes to G6PC.
[0089] The binding ability of PTH-sRNA-6 to PPARA gene mRNA is shown in Figure 7 The figure shows the binding mode, binding site and binding free energy of PTH-sRNA-6 to PPARA gene mRNA. PTH-sRNA-6 has one binding mode to PPARA.
[0090] The binding ability of PTH-sRNA-24 to HNF4A gene mRNA is shown in Figure 8 The figure shows the binding mode, binding site and binding free energy of PTH-sRNA-24 to HNF4A gene mRNA. PTH-sRNA-24 has three binding modes to HNF4A.
[0091] It is generally believed that the minimum free energy (mfe) less than -20 has an inhibitory effect, so according to the analysis results shown, these three small RNAs have the function of specifically binding to PCK1, G6PC, PPARA, HNF4A target gene mRNA and inhibiting gene expression.
[0092] PCK1, G6PC, PPARA, HNF4A genes play a promoting role in the occurrence and development of non-alcoholic fatty liver, PCK1 and G6PC are two key enzymes for de novo glucose synthesis, which is an extremely important pathway in the development of non-alcoholic fatty liver, the inhibition of PPARA expression will activate lipid oxidation to relieve liver steatosis, and HNF4A is a key transcription factor that controls liver steatosis by regulating lipid catabolism. Therefore, inhibiting PCK1, G6PC, PPARA, HNF4A genes can play a therapeutic role in non-alcoholic fatty liver.
[0093] PTH-sRNA-6 can inhibit PPARA gene, PTH-sRNA-24 can inhibit HNF4A gene, PTH-sRNA-37 can inhibit PCK1 gene and G6PC gene, so PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 can be used for preventing and / or treating non-alcoholic fatty liver. PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 combination can simultaneously inhibit the expression of PCK1, G6PC, PPARA and HNF4A four genes, further play the role of preventing and / or treating non-alcoholic fatty liver.
[0094] Test Example 3, Inhibition Effect of Pian Jie Yuan Small RNA on Target Gene
[0095] 1. Experimental method
[0096] PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 three Pian Jie Yuan small RNAs are obtained from Pian Jie Yuan by the method described in Example 1, and can also be directly synthesized by conventional techniques.
[0097] The inhibition effect of Pian Jie Yuan small RNA on target gene is proved by luciferase reporter experiment:
[0098] The segment sequence fragment of PCK1, G6PC, PPARA and HNF4A target genes combined with PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 three Pian Jie Yuan small RNAs (molar ratio of PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 is 1:0.3:0.2) is inserted into pMIR-REPORT Luciferase plasmid to construct luciferase reporter plasmid of each gene. Positive clones are screened and verified by sequencing, and clones are amplified and plasmid is purified.
[0099] Segment sequence fragment of PCK1 target gene combined with small RNA:
[0100] ACTGGCCCTGCAACCCGGAGCTGACGCTCATCGCCCACCTGCCTGACC
[0101] GCAGAGAGATCATCTCCTTTGGCAGTGGGTACGGCGGGAACTCGCTGC
[0102] TCGGGAAGAAGTGCTTTGCTCTCAGGATGGCCAGCCGGCTGGCCAAGG
[0103] AGGAAGGGTGGCTGGCAGAGCACATGCTGATTCTGGGTATAACCAACCCTGAGGGTGAGAAGA (SEQ ID NO. 13)
[0104] Segment sequence fragment of G6PC target gene binding with small RNA:
[0105] TTCGCTTACCAGCCTCCTGTCGGATACAGAAGAGCAAGCCCAGGCTAG
[0106] AGATCCCAACTGAGAATGCTCTTGCGGTGCAGAATCTTCCGGCTGGGA
[0107] AAAGGAAAAGAGCACCATGCATTTGCCAGGAAGAGAAAGAAGGATCAGGAGGAGGGAGAGTGTTTTATG (SEQ ID NO. 14)
[0108] Segment sequence fragment of PPARA target gene binding with small RNA:
[0109] GTCTTCATAGCCTGGGCTGGGTGGGAGCCAGTCACCCTGCGGATCGAG
[0110] AGAGGGGGTAGAGTCTTCTTCAAATGGCAGTTTTACTTCAAATGGCAGA
[0111] TTTCACAAGAGTTGGTTATTTTTTACAATGGTTTAGGTTGTTAAGTCTCCTTTGTATGTAAGGTAGTTTTT (SEQ ID NO. 15)
[0112] Segment sequence fragment of HNF4A target gene binding with small RNA:
[0113] ACGAGCTGGTGCTGCCCTTCCAGGAGCTGCAGATCGATGACAATGAGT
[0114] ATGCCTACCTCAAAGCCATCATCTTCTTTGACCCAGATGCCAAGGGGCT
[0115] GAGCGATCCAGGGAAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAGGACTACATCAACGACCGCCA (SEQ ID NO. 16)
[0116] The related cells are cultured and inoculated in 24-well plates, and after 12-16 hours, the luciferase expression plasmid carrying the predicted target gene to be detected is co-transfected into the cells with the Pianzhiyu small RNA plasmid (PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 three sRNAs). After 24 hours, the cells are collected and lysed, and the luciferase substrate is added. The luciferase reacts with the substrate to produce luciferin. By detecting the intensity of the fluorescence, the activity of the luciferase can be determined compared with the nonsense small RNA group, so as to determine whether the predicted target can be inhibited by the Pianzhiyu small RNA. The nonsense small RNA is a meaningless small RNA sequence and cannot be combined with the target gene.
[0117] The nonsense small RNA sequence is GUCUCGCGUAUACCUCUGACCUCA (SEQ ID NO. 17).
[0118] 2. Experimental results
[0119] The PCK1, G6PC, PPARA and HNF4A target gene segments combined with the Pianzhiyu small RNA are inserted into the pMIR-REPORT Luciferase plasmid to construct the luciferase reporter plasmid of each gene. The luciferase reporter experiment results show that Figure 9 ), and the three Pianzhiyu small RNA compositions of the present application have inhibitory effects on the four target genes PCK1, G6PC, PPARA and HNF4A. The nonsense small RNA does not have an inhibitory effect on the four target genes.
[0120] Test Example 4, verification of the inhibition of Pianzhiyu sRNA on fat accumulation at the cellular level
[0121] 1. Experimental method
[0122] The PTH-sRNA-6, PTH-sRNA-24 and PTH-sRNA-37 Pianzhiyu small RNAs are directly synthesized by conventional techniques.
[0123] The HepG2 cells are cultured according to 2x10^ 6Cells / well were plated in 6-well plates. When HepG-2 cells reached 70% density, FFA was added to induce lipid droplet accumulation (FFA dose of 1 mmol FFA / well). Pien Tze Huang sRNA (composed of PTH-sRNA-6, PTH-sRNA-24, and PTH-sRNA-37 in a molar ratio of 1:0.3:0.2) was added at the same time. The Pien Tze Huang sRNA dose was 0.16 nmol / g. After incubation for 24 hours, TG levels were detected. A normol group and a control group were set up at the same time. The normal group was cells that were not induced with FFA and not treated with Pien Tze Huang sRNA. The control group refers to a cell model of non-alcoholic fatty liver disease established by FFA induction without Pien Tze Huang sRNA intervention.
[0124] Scramble RNA is a nonsense small RNA, the sequence of which is shown in SEQ ID NO.17.
[0125] 2. Experimental results
[0126] The results show that ( Figure 10 ), cells were induced by FFA, and TG levels increased significantly, but after Pien Tze Huang sRNA treatment, TG levels were suppressed. Therefore, it can be explained that Pien Tze Huang sRNA plays an important role in inhibiting fat accumulation.
[0127] Experimental Example 5: Establishing a non-alcoholic liver injury model and administering treatment
[0128] 1. Experimental methods
[0129] The three Pien Tze Huang small RNAs, PTH-sRNA-6, PTH-sRNA-24, and PTH-sRNA-37, were directly synthesized using conventional techniques.
[0130] (1) Construction of non-alcoholic liver injury model:
[0131] Six-week-old male SD rats weighing 180 ± 20 g were prepared and divided into a normal group, a model group, and a treatment group. Normal rats were fed a normal diet (normol), while the model group (control) and the drug-treated group (PTH sRNA) were fed a high-fat diet. After 8 weeks of continuous feeding, the drug-treated group was gavaged with a mixture of three sRNAs (composed of PTH-sRNA-6, PTH-sRNA-24, and PTH-sRNA-37 in a molar ratio of 1:0.3:0.2 and suspended in DEPC water). The three sRNAs were administered at a dose of 0.16 nmol / g, once daily for a total of 10 treatments. The other two groups remained unchanged. During this period, the animals had free access to food and water and were housed in a clean laboratory.
[0132] After 2 weeks, the rats were sacrificed, and the whole blood was separated to obtain serum for detection of blood biochemical indicators. Meanwhile, the liver at the same site was fixed in 4% paraformaldehyde, and the rest of the liver was stored in a -80°C refrigerator for later use.
[0133] Scramble RNA is nonsense small RNA, and the sequence is shown in SEQ ID NO. 17.
[0134] 2. Experimental results
[0135] The results of blood biochemical indicators show that the levels of ALT, AST, and TG in the model group increased sharply compared with the normal group, while the blood biochemical indicators of the Pianzaiyuan sRNA administration group (PTH sRNA) were inhibited. Figure 11
[0136] The levels of FFA and ROS in the rat liver were then detected. Abnormal fat metabolism, oxidative stress, and lipid peroxidation can promote abnormal accumulation of liver fat, and free fatty acids and active oxygen will abnormally increase in this process. The results of liver FFA and ROS detection show that the levels of FFA and ROS in the liver of the model group increased sharply compared with the normal group, while the administration of Pianzaiyuan sRNA can inhibit the increase of the levels. Figure 12
[0137] HE staining showed that the morphology and structure of the liver tissue of the normal group of rats were normal; while in the liver of the model group, obvious fatty degeneration appeared, the liver cells were swollen and round, the volume was significantly higher than that of the normal group, and a large number of fat vacuoles existed in the cytoplasm. After treatment with Pianzaiyuan sRNA, the fat vacuoles and balloon-like changes in the liver of NAFLD rats were improved. The results of oil red O staining show that there were few lipid droplets in the liver tissue of the normal group, and a large number of lipid droplets accumulated in the liver tissue of the model group, indicating that the lipid droplets infiltrated into the liver cells and fused into fragments. In the liver tissue of the treatment group of rats, there were also lipid droplet accumulations, but the accumulation degree was significantly lower than that of the model group. Figure 13
[0138] In conclusion, three kinds of small RNAs are extracted from traditional Chinese medicine Pianzaihuan, and the three kinds of small RNAs can inhibit genes related to the occurrence and development of non-alcoholic fatty liver, and thus can play a role in preventing and / or treating non-alcoholic fatty liver. Moreover, the composition obtained by combining the three kinds of small RNAs can effectively inhibit fat accumulation and has a good preventive and / or therapeutic effect on non-alcoholic fatty liver. Meanwhile, the sRNAs of the present application can be effectively absorbed by ingestion and stably exist, and are convenient and effective to use. The sRNAs of the present application can also be used as markers for quality control of Pianzaihuan, and Pianzaihuan with high sRNA content has a better effect on preventing and / or treating non-alcoholic fatty liver. The present application finds small RNAs in Pianzaihuan that are beneficial to preventing and / or treating non-alcoholic fatty liver, which has important significance for further research and development and quality control of Pianzaihuan. According to the small RNA molecular pointer screened, the product quality of each batch of Pianzaihuan can be controlled.
Claims
1. A small RNA composition for preventing and / or treating non-alcoholic fatty liver disease, characterized by: The small RNA composition is composed of three small RNA components with nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.
3.
2. The small RNA composition according to claim 1, characterized in that: The molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO.1 is 40-80%, the molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO.2 is 10-40%, and the molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO.3 is 10-30%.
3. The small RNA composition according to claim 2, characterized in that: The molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO.1 is 66-67%, the molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO.2 is 20%, and the molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO.3 is 13-14%.
4. The small RNA composition according to any one of claims 1 to 3, characterized in that: The molar ratio of the three small RNAs whose nucleotide sequences are shown in SEQ ID NOs. 1 to 3 is 1:0.3:0.
2.
5. The method for preparing the small RNA composition according to any one of claims 1 to 4, characterized in that: The steps include: The three small RNAs with nucleotide sequences as shown in SEQ ID NO. 1 to 3 are mixed to obtain the product.
6. Use of the small RNA composition according to any one of claims 1 to 4 in the preparation of a medicament for preventing and / or treating non-alcoholic fatty liver disease.
7. The use according to claim 6, characterized in that: The drug is a drug that inhibits the expression of PCK1, G6PC, PPARA and HNF4A genes.
8. The use according to claim 6, characterized in that: The drug is a drug that inhibits fat accumulation; and / or, the drug is a drug that suppresses TG, ALT and AST levels; And / or, the drug is a drug that inhibits the expression levels of FFA and ROS.
9. A drug for preventing and / or treating non-alcoholic fatty liver disease, characterized in that: The drug is a preparation prepared by using the small RNA composition according to any one of claims 1 to 4 as an active ingredient and adding pharmaceutically acceptable excipients.
Citation Information
Patent Citations
Application of Chinese herb Pien Tze Huang and preparation thereof in preparation of drugs for treating non-alcoholic fatty liver disease (NAFLD)
CN104042655A
Application of CTRP6 gene in preparation of medicine for preventing, treating or relieving non-alcoholic fatty liver disease
CN115845058A
Treatment Of Non-Alcoholic Fatty Liver Disease, Non-Alcoholic Steatohepatitis, And Liver Fibrosis
US20210301287A1