Method for preparing CAR-T cells using dual AAV vectors for simultaneous site-directed gene editing

Abstract

The present invention relates to a method for preparing a chimeric antigen receptor (CAR) T cell, comprising introducing a first polynucleotide and a gene editing system targeting a region of interest in a T cell genome into a T cell, wherein the first polynucleotide comprises a first homology arm, a first expression cassette and a second homology arm in a 5' to 3' direction, the first expression cassette comprising a nucleotide sequence encoding the CAR operably connected to a first promoter sequence, and wherein the first and second homology arms target the region of interest. The present invention also relates to a combination or kit for preparing CAR T cells by the method of the present invention, and CAR T cells prepared by the method of the present invention.

Description

Technical Field

[0001] The present invention belongs to the field of immunotherapy. In particular, the present invention relates to methods, combinations and kits for preparing chimeric antigen receptor (CAR) T cells, wherein the CAR is integrated into a region of interest in the T cell genome, such as a locus encoding an inhibitory protein. Background Art

[0002] In recent years, CAR-T therapy has made breakthrough progress in blood tumors, and three blood tumor-targeted CAR-T therapies have been approved for marketing by the US FDA. In addition, research on CAR-T therapy for solid tumors has progressed rapidly, and there are dozens of CAR-T clinical trials targeting solid tumors registered on the US FDA clinical trial website.

[0003] CAR-T therapy is mainly divided into two categories according to the source of initial T cells: i) personalized CAR-T cell immunotherapy, in which the autologous T cells of tumor patients are used as initial cells to prepare CAR-T cells; and ii) universal CAR-T cell immunotherapy, in which γδT cell subtypes from healthy donors, or αβT cells with GVHD-related genes (TCR and B2M) knocked out, or T cells derived from UCB or iPSC stem cells are used as initial T cells to prepare CAR-T cells.

[0004] The preparation process of CAR-T includes viral transfection and non-viral transfection. Viral transfection is currently the most commonly used transfection method, among which the commonly used viral vectors are lentivirus (LV) vectors and retrovirus (RV) vectors. The main advantage of viral transfection is that the transfection efficiency is relatively high, and the CAR coding sequence can be integrated into the T cell chromosome to achieve stable expression of the CAR coding sequence, but its disadvantage is that the gene is integrated through random insertion, resulting in potential risks including gene mutation and secondary tumors, thus bringing clinical safety issues.

[0005] Therefore, there is a need to achieve site-specific integration of the CAR gene to reduce the risk of genetic mutations and secondary tumors that may be caused by random insertion. Summary of the invention

[0006] In a first aspect, the present invention provides a method for preparing a chimeric antigen receptor (CAR) T cell, comprising introducing a first polynucleotide and a gene editing system targeting a region of interest in the T cell genome into a T cell, wherein the first polynucleotide comprises a first homology arm, a first expression cassette and a second homology arm in a 5' to 3' direction, the first expression cassette comprises a nucleotide sequence encoding the CAR operably linked to a first promoter sequence, and wherein the first and second homology arms target the region of interest.

[0007] In some embodiments, the region of interest is a locus encoding an inhibitory protein. In some embodiments, the inhibitory protein is PD-1.

[0008] In some embodiments, the gene editing system is a CRISPR editing system. In some embodiments, the gene editing system comprises Cpf1 or a second expression cassette encoding Cpf1, the second expression cassette comprising a nucleotide sequence encoding the Cpf1 operably linked to a second promoter sequence; and a guide RNA (gRNA) or a third expression cassette encoding the gRNA, the third expression cassette comprising a nucleotide sequence selected from SEQ ID NO: 1, 2, 3 and 4 operably linked to a third promoter.

[0009] In some embodiments, the first polynucleotide and the gene editing system are introduced into T cells by recombinant adeno-associated virus (rAAV), and wherein the gene editing system comprises a second expression cassette encoding Cpf1 and a third expression cassette encoding the gRNA. In some embodiments, T cells are transfected with a first rAAV and a second rAAV, wherein the genome of the first rAAV comprises the first polynucleotide and the third expression cassette and the genome of the second rAAV comprises the second expression cassette.

[0010] In some embodiments, the T cells are γδ T cells.

[0011] In a second aspect, the present invention provides a combination comprising a first polynucleotide and a gene editing system targeting a region of interest in a genome, wherein the first polynucleotide comprises a first homology arm, a first expression cassette and a second homology arm in a 5' to 3' direction, the first expression cassette comprises a nucleotide sequence encoding a CAR operably linked to a first promoter sequence, and wherein the first and second homology arms target the region of interest.

[0012] In a third aspect, the present invention provides a kit for preparing CAR-T cells, comprising a first polynucleotide and a gene editing system targeting a region of interest in the T cell genome, wherein the first polynucleotide comprises a first homology arm, a first expression cassette and a second homology arm in a 5' to 3' direction, the first expression cassette comprises a nucleotide sequence encoding CAR operably linked to a first promoter sequence, and wherein the first and second homology arms target the region of interest.

[0013] In some embodiments, the region of interest is a locus encoding an inhibitory protein. In some embodiments, the inhibitory protein is PD-1.

[0014] In some embodiments, the gene editing system is a CRISPR editing system. In some embodiments, the gene editing system comprises Cpf1 or a second expression cassette encoding Cpf1, the second expression cassette comprising a nucleotide sequence encoding the Cpf1 operably linked to a second promoter sequence; and a guide RNA (gRNA), the gRNA comprising a nucleotide sequence selected from SEQ ID NO: 1, 2, 3 and 4, or a third expression cassette encoding the gRNA, the third expression cassette comprising a nucleotide sequence selected from SEQ ID NO: 1, 2, 3 and 4 operably linked to a third promoter.

[0015] In some embodiments, a combination or kit of the invention comprises a first rAAV and a second rAAV, the genome of the first rAAV comprising the first polynucleotide and the third expression cassette, and the genome of the second rAAV comprising the second expression cassette.

[0016] In a fourth aspect, the present invention provides a CAR-T cell prepared by the method of the present invention, or with a combination or kit of the present invention. The CAR-T cell of the present invention comprises a nucleotide sequence encoding a CAR in a region of interest integrated into the genome. In some embodiments, the region of interest is a locus encoding an inhibitory protein. In some embodiments, the inhibitory protein is PD-1. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The following drawings are only intended to make the present invention easier to understand, and are not intended to limit the scope of the present invention in any way.

[0018] Figure 1 The structure of the polynucleotide 19CAR encoding CAR targeting folate receptor (FR) α and chemokine CCL-19 is shown, wherein the nucleotide sequences of the elements IgGκ, VL, VH, CD8αHinge, CD8αTM, CD28, CD3ζ, F2A and CCL19 are shown in SEQ ID NO:9-17, and the Linker sequence is shown in SEQ ID NO:19.

[0019] Figure 2 A map of the donor plasmid donor-19CAR is shown.

[0020] Figure 3 A map of the donor plasmid donor-Cpf1 is shown.

[0021] Figure 4 A map of the helper plasmid pHelper is shown.

[0022] Figure 5A map of the packaging plasmid REP2-CAP6 is shown, which encodes the REP protein of AAV2 (REP2) and the CAP protein of AAV6 (CAP6).

[0023] Figure 6 Shows the changes in the abundance of γδT cells in the cell population after sorting with the γδT cell magnetic bead sorting kit.

[0024] Figure 7 The gRNA-mediated PD-1 knockout efficiency was identified by T7E1 test, and lanes 1-4 show the results from samples of γδ T cells transfected with recombinant adeno-associated viruses encoding gRNA1-4, respectively.

[0025] Figure 8 Shown is the expression of PD-1 in non-transfected and transfected γδ T cell populations.

[0026] Fig. 9 Expression of CAR targeting FRα in untransfected and transfected γδ T cell populations is shown.

[0027] Fig.10 T cell proliferation curves are shown.

[0028] Fig.11 ELISA analysis showing secretion of IFNγ and CCL-19 by various T cells.

[0029] Fig.12 Transwell analysis of immune cells showing various T cell recruitment.

[0030] Fig.13 The killing efficiency of various T cells against tumor cells with different FRα expression levels is shown, expressed as the percentage of lysis.

[0031] Fig.14 Shown are the growth curves of tumors in mice administered different therapies.

[0032] Fig.15 HE staining of tumor tissues in mice administered different therapies is shown.

[0033] Fig.16 Immunofluorescence staining of tumor tissues in mice administered different therapies is shown. DETAILED DESCRIPTION OF THE INVENTION

[0034] I. Definition

[0035] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms and laboratory operation procedures used herein are terms and routine procedures widely used in the corresponding fields. For example, the standard recombinant DNA and molecular cloning techniques used in the present invention are well known to those skilled in the art and are more fully described in the following documents: Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter referred to as "Sambrook"). At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0036] "Genome" when applied to eukaryotic cells encompasses not only the chromosomal DNA present in the nucleus, but also the organellar DNA present in subcellular components of the cell (eg, mitochondria, plastids).

[0037] "Exogenous" with respect to a sequence refers to a sequence that is from a foreign species, or, if from the same species, a sequence that has been significantly altered in composition and / or locus from its native form through deliberate human intervention.

[0038] "Gene editing", also known as genome editing, uses engineered nucleases or "molecular scissors" to insert, delete or replace DNA in the genome of an organism. Gene editing causes site-specific double-strand breaks (DSBs) at the desired location in the genome, and then introduces the desired DNA insertion, deletion or substitution during the repair of the DSB. Gene editing typically uses large-range nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR systems.

[0039] "Meganucleases" are a class of deoxyribonuclease endonucleases with large recognition sites (12-40 bp double-stranded DNA sequences) that typically occur only once in any given genome. For example, the 18 bp sequence recognized by the I-SceI meganuclease would need to occur once on average in a genome that is 20 times larger than the human genome.

[0040] "Zinc finger nuclease" is an artificial restriction enzyme made by fusing a zinc finger DNA binding domain to a DNA cleavage domain. The zinc finger DNA binding domain of a single ZFN typically contains 3-6 individual zinc finger repeat sequences, each of which can recognize, for example, 3 bp.

[0041] "Transcription activator-like effector nucleases" are restriction enzymes that can be engineered to cleave specific DNA sequences, typically made by fusing the DNA binding domain of a transcription activator-like effector (TALE) to a DNA cleavage domain. TALEs can be engineered to bind to almost any desired DNA sequence.

[0042] "Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)" are prokaryotic DNA segments containing short, repetitive sequences. The CRISPR system is a prokaryotic immune system that confers resistance to foreign genetic elements, such as those present in plasmids and bacteriophages, which provides acquired immunity. In this system, Cas proteins or similar proteins cut foreign nucleic acids under the guidance of RNA.

[0043] As used herein, the term "CRISPR nuclease" generally refers to a nuclease present in a naturally occurring CRISPR system, as well as a modified form thereof, a variant thereof (including a nickase mutant), or a catalytically active fragment thereof. CRISPR nucleases can recognize and / or cut target nucleic acid structures by interacting with guide RNAs (such as crRNA and optionally tracrRNA or artificial gRNAs (such as sgRNA)). The term encompasses any nuclease that can achieve gene editing in cells based on a CRISPR system.

[0044] “Cas9 nuclease” and “Cas9” are used interchangeably herein to refer to an RNA-guided nuclease that includes a Cas9 protein or a fragment thereof (e.g., a protein that includes an active DNA cleavage domain of Cas9 and / or a gRNA binding domain of Cas9).

[0045] “Cpf1 nuclease” and “Cpf1” are used interchangeably herein to refer to an RNA-guided nuclease that includes a Cpf1 protein or a fragment thereof (e.g., a protein that includes an active DNA cleavage domain of Cpf1 and / or a gRNA binding domain of Cpf1).

[0046] Cas9 and Cpf1 can be used as components of the CRISPR / Cas (clustered regularly interspaced short palindromic repeats and related systems) genome editing system, targeting and cutting DNA target sequences to form DNA double-strand breaks (DSBs) under the guidance of guide RNA.

[0047] "Guide RNA" and "gRNA" are used interchangeably herein. For example, Cas9, gRNA is generally composed of crRNA and tracrRNA molecules that are partially complementary to form a complex, wherein crRNA contains a sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is known in the art that a single guide RNA (sgRNA) can be designed that contains features of both crRNA and tracrRNA. For Cpf1, only one gRNA molecule is needed.

[0048] "T cell receptor (TCR)", also known as T cell antigen receptor, is a molecular structure that T cells specifically recognize and bind to antigen peptide-MHC molecules. It usually exists on the surface of T cells in the form of a complex with CD3 molecules. Most T cells' TCRs are composed of α and β peptide chains, known as αβT cells; a few T cells' TCRs are composed of γ and δ peptide chains, known as γδT cells.

[0049] "Chimeric antigen receptor (CAR)", also known as artificial T cell receptor, chimeric T cell receptor, chimeric immune receptor, is an artificially designed receptor that can give immune effector cells a certain specificity. Generally speaking, this technology is used to give T cells the ability to specifically recognize antigens on the surface of target cells. In this way, a large number of T cells with targeted killing capabilities can be generated.

[0050] As used in the present invention, T cell "inhibitory protein" refers to a protein associated with the inhibition of T cell activity, for example, immunosuppressive proteins include but are not limited to PD1, LAG-3, CTLA-4, Foxp3 and Tim3.

[0051] "Polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably herein and are single-stranded or double-stranded RNA or DNA polymers that optionally may contain synthetic, non-natural or altered nucleotide bases. Nucleotides are referred to by their single letter names as follows: "A" is adenosine or deoxyadenosine (RNA or DNA, respectively), "C" represents cytidine or deoxycytidine, "G" represents guanosine or deoxyguanosine, "U" represents uridine, "T" represents deoxythymidine, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "I" represents inosine, and "N" represents any nucleotide.

[0052] "Polypeptide", "peptide", and "protein" are used interchangeably in the present invention to refer to polymers of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modified forms, including but not limited to glycosylation, lipid attachment, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. The modifications also include modifications to the polypeptide sequence, including but not limited to substitution, deletion, insertion and / or addition of one or more amino acids.

[0053] As used herein, "expression construct" refers to a vector such as a recombinant vector suitable for expressing a nucleotide sequence of interest in a cell. "Expression" refers to the production of a functional product. For example, expression of a nucleotide sequence can refer to the transcription of the nucleotide sequence (such as transcription to generate mRNA or functional RNA) and / or translation of RNA into a precursor or mature protein.

[0054] The "expression construct" of the present invention can be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, can be an RNA (such as mRNA) that can be translated.

[0055] An "expression construct" of the present invention may comprise regulatory sequences and a nucleotide sequence of interest from different sources, or regulatory sequences and a nucleotide sequence of interest from the same source but arranged in a manner different from that normally found in nature.

[0056] "Regulatory sequence" and "regulatory element" are used interchangeably and refer to nucleotide sequences located upstream (5' non-coding sequence), in the middle or downstream (3' non-coding sequence) of a coding sequence and affecting the transcription, RNA processing or stability or translation of the relevant coding sequence. Expression regulatory elements refer to nucleotide sequences that can control the transcription, RNA processing or stability or translation of a nucleotide sequence of interest.

[0057] Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, enhancers, and polyadenylation recognition sequences.

[0058] "Promoter" refers to a nucleic acid fragment that is capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the present invention, the promoter is a promoter that is capable of controlling the transcription of a gene in a cell, whether or not it is derived from the cell.

[0059] As used herein, the term "operably linked" refers to the connection of a regulatory element (e.g., but not limited to, a promoter sequence, a transcription termination sequence, etc.) to a nucleic acid sequence (e.g., a coding sequence or an open reading frame) such that transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. Techniques for operably linking a regulatory element region to a nucleic acid molecule are known in the art.

[0060] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc. that are physiologically compatible. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).

[0061] As used herein, "therapeutically effective amount" or "therapeutically effective dose" or "effective amount" refers to an amount of a substance, compound, material or cell that is at least sufficient to produce a therapeutic effect after administration to a subject. Therefore, it is the amount necessary to prevent, cure, improve, block or partially block the symptoms of a disease or disorder.

[0062] For example, an "effective amount" of the cells or pharmaceutical compositions of the present invention preferably results in a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease asymptomatic periods, or prevents damage or disability caused by disease suffering. For example, for the treatment of tumors, an "effective amount" of the cells or pharmaceutical compositions of the present invention preferably inhibits tumor cell growth or tumor growth by at least about 10%, preferably at least about 20%, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, and more preferably at least about 80%, relative to an untreated subject. The ability to inhibit tumor growth can be evaluated in an animal model system that predicts efficacy against human tumors. Alternatively, it can also be evaluated by examining the ability to inhibit tumor cell growth, which inhibition can be determined in vitro by tests known to those skilled in the art.

[0063] In practice, the dosage level of the cells in the pharmaceutical composition of the present invention may be varied to obtain an amount of active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition and mode of administration without being toxic to the patient. The selected dosage level depends on a variety of pharmacokinetic factors, including the activity of the particular composition of the present invention being applied, the route of administration, the time of administration, the excretion rate of the particular compound being applied, the duration of treatment, other drugs, compounds and / or materials used in combination with the particular composition being applied, the age, sex, weight, condition, general health and medical history of the patient being treated, and similar factors well known in the medical field.

[0064] As used herein, "subject" refers to an organism suffering from or susceptible to a disease (such as senile degenerative diseases and cancer) that can be treated by the method of the present invention or the pharmaceutical composition. Non-limiting examples include humans, mice, dogs, hares, birds, cattle, sheep, pigs and other primates, and other non-mammals. Exemplary non-human subjects include, for example, mice, rats, cattle, pigs, rabbits, chickens, yellow baboons, Sumatran orangutans, dogs, cats, horses, sheep, marmosets, rhesus monkeys, northern white-cheeked gibbons, and chimpanzees. In a preferred embodiment, the subject is a human.

[0065] As used herein, "autologous" means that the cell, cell line or cell population used to treat a subject originates from the subject.

[0066] "Adeno-associated virus (AAV)" is a member of the family of microviridae. The AAV genome consists of a linear single-stranded DNA molecule containing about 4.7 kilobases (kb) and two major open reading frames encoding nonstructural Rep (replication) and structural Cap (capsid) proteins. The AAV coding region is flanked by two cis-acting nucleotide inverted terminal repeat (ITR) sequences, which are about 145 nucleotides in length and have an interrupted palindromic sequence that can be folded into a hairpin structure, functioning as a primer during the initiation of DNA replication. In addition to their role in DNA replication, it has been confirmed that ITR sequences are necessary for viral integration, rescue from the host genome, and encapsidation of viral nucleic acids into mature virions (Muzyczka, (1992) Curr. Top. Micro. Immunol. 158: 97-129).

[0067] 2. Methods for preparing modified T cells

[0068] In one aspect of the present invention, a method for preparing modified T cells is provided, wherein an exogenous polynucleotide encoding a polypeptide of interest, such as a polynucleotide encoding a CAR or an exogenous TCR, is introduced into a region of interest in the T cell genome.

[0069] In some embodiments, the method of the present invention includes introducing a first polynucleotide and a gene editing system targeting a region of interest in a T cell genome into a T cell, wherein the first polynucleotide comprises a first homology arm, a first expression cassette and a second homology arm in a 5' to 3' direction, and the first expression cassette comprises a nucleotide sequence encoding a polypeptide of interest operably connected to a first promoter sequence, and wherein the first and second homology arms target the region of interest. In some embodiments, the first polynucleotide and the gene editing system are introduced into the T cell simultaneously. In some embodiments, the first polynucleotide and the gene editing system are introduced into the T cell one after another.

[0070] In some embodiments, the polypeptide of interest comprises an antigen binding domain, such as an extracellular antigen binding domain, to a tumor-associated antigen.

[0071] The tumor-associated antigens include, but are not limited to, CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123, CD138, ErbB2 (HER2 / neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), FRα, CD19, CD20, CD30, CD40, disialoganglioside GD2, ductal epithelial mucin, gp36, TAG-72, glycosphingolipids, glioma-associated antigens, β-human chorionic gonadotropin, alpha fetoprotein (AFP), exogenous lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CAIX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, mut hsp70-2, M-CSF, prostase, prostate enzyme-specific antigen (PSA), PAP, NY-ESO-1, LAGA-1a, p53, Prostein, PSMA, survival and telomerase, prostate cancer tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrin B2, CD22, insulin growth factor (IGF1)-I, IGF-II, IGF1 receptor, mesothelin, major histocompatibility complex (MHC) molecules presenting tumor-specific peptide epitopes, 5T4, ROR1, Nkp30, NKG2D, tumor stromal antigen, extra domain A (EDA) and extra domain B (EDB) of fibronectin, A1 domain of tenascin-C (TnC A1), fibroblast-associated protein (fap), CD3, CD4, CD8, CD24, CD25, CD33, CD34, CD133, CD138, Foxp3, B7-1 (CD80), B7-2 (CD86), GM-CSF, cytokine receptors, endoglin, major histocompatibility complex (MHC) molecules, BCMA (CD269, TNFRSF17), TNFRSF17 (UNIPROT Q02223), SLAMF7 (UNIPROT Q9NQ25), GPRC5D (UNIPROT Q9NZD1), FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708) and FCRL5 (UNIPROT Q68SN8). In one embodiment, the antigen is FRα.

[0072] In some embodiments, the polypeptide of interest comprises a CAR, and the antigen binding domain can be, for example, a monoclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, an antibody single chain variable region, and an antigen binding fragment thereof.

[0073] In a preferred embodiment, the antigen binding domain is a scFv against FRα.In a preferred embodiment, the antigen binding domain comprises a light chain variable region (VL) and a heavy chain variable region (VH) encoded by SEQ ID NO: 10 and 11, respectively.

[0074] In some embodiments, the CAR comprises a transmembrane domain, such as a CD8 transmembrane domain or a CD28 transmembrane domain, preferably a CD8α transmembrane domain encoded by SEQ ID NO:13.

[0075] In some embodiments, the CAR further includes a hinge region between the extracellular antigen binding domain and the transmembrane domain, for example, the hinge region is a CD8 hinge region, for example, a CD8α hinge region encoded by SEQ ID NO: 12.

[0076] In some embodiments, the CAR comprises a signal transduction domain that can be used for T cell activation, such as a signal transduction domain selected from TCR ζ, FcR γ, FcR β, FcR ε, CD3 γ, CD3 δ, CD3 ε, CD3 ζ, CD5, CD22, CD79a, CD79b and CD66d. In some preferred embodiments, the CAR comprises a CD3 ζ signal transduction domain, such as a CD3 ζ signal transduction domain encoded by SEQ ID NO: 15.

[0077] In some embodiments, the CAR further comprises one or more co-stimulatory domains selected from CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB and 4-1BBL. In some embodiments, the CAR comprises a CD28 co-stimulatory domain, such as a CD28 co-stimulatory domain encoded by SEQ ID NO: 14.

[0078] In a preferred embodiment, the CAR comprises, in order from N-terminus to C-terminus, a scFv for FRα, a CD8α hinge region, a CD8α transmembrane domain, a CD28 co-stimulatory domain, and a CD3ζ signal transduction domain. Preferably, the CAR comprises the amino acid sequence encoded by SEQ ID NO: 22.

[0079] In some embodiments, the first expression cassette further encodes a signal peptide that directs the polypeptide of interest to the cell membrane, for example, the signal peptide of IgGκ encoded by SEQ ID NO:9.

[0080] In some embodiments, the first expression cassette further comprises a nucleotide sequence encoding a chemokine, such as SEQ ID NO: 17 encoding CCL-19 (if there are other chemokines of interest, please inform), and the nucleotide sequence encoding the chemokine is operably linked to the nucleotide sequence encoding the CAR.

[0081] In some embodiments, the nucleotide sequence encoding the chemokine is connected to the nucleotide sequence encoding the CAR by a nucleotide sequence encoding a 2A-like peptide. In some embodiments, the 2A-like peptide is selected from foot-and-mouth disease virus (FMDV) 2A peptide, bright vein flat moth virus (TAV) 2A peptide, encephalomyocarditis virus (EMCV) 2A peptide, equine rhinitis A virus (ERAV) 2A peptide and porcine Teschen virus (PTV) 2A peptide. In some embodiments, the 2A-like peptide is SEQ ID NO: 16 encoded foot-and-mouth disease virus 2A peptide (F2A).

[0082] In some embodiments, the region of interest in the genome is a locus encoding an inhibitory protein. In some embodiments, the inhibitory protein is selected from PD-1, LAG-3, CTLA-4, Foxp3, Tim3, and any combination thereof. In some embodiments, the inhibitory protein is PD-1.

[0083] The gene editing system introduces a double-strand break (DB) in the region of interest, thereby inserting a polynucleotide encoding a polypeptide of interest into the region of interest by homology-mediated repair (HDR) based on the homology arms targeting the region of interest. Introducing DB and / or inserting a polynucleotide encoding a polypeptide of interest into a locus encoding an inhibitory protein reduces or eliminates inhibitory protein expression in T cells. In some embodiments, after the gene editing system of the present invention and the first polynucleotide are introduced into the T cell, the expression of the inhibitory protein is reduced or eliminated (knocked down or knocked out).

[0084] In the present invention, reducing or eliminating the expression of inhibitory proteins in T cells does not affect the expansion capacity of T cells and their basic immune characteristics, and can enhance their biological activities, such as anti-tumor activity, especially the activity of inhibiting or killing solid tumor cells, by relieving immunosuppression.

[0085] The gene editing system can be any suitable system known in the art, including but not limited to a system based on a meganuclease, a zinc finger nuclease, a transcription activator-like effector nuclease or CRISPR. Preferably, the gene editing system is a CRISPR gene editing system.

[0086] In some embodiments, a CRISPR gene editing system comprising at least one of the following i) to v):

[0087] i) a CRISPR nuclease, and at least one guide RNA;

[0088] ii) an expression construct comprising a nucleotide sequence encoding a CRISPR nuclease, and at least one guide RNA;

[0089] iii) a CRISPR nuclease, and an expression construct comprising a nucleotide sequence encoding at least one guide RNA;

[0090] iv) an expression construct comprising a nucleotide sequence encoding a CRISPR nuclease, and an expression construct comprising a nucleotide sequence encoding at least one guide RNA;

[0091] v) an expression construct comprising a nucleotide sequence encoding a CRISPR nuclease and a nucleotide sequence encoding at least one guide RNA.

[0092] In some embodiments, the nuclease (CRISPR nuclease) used in the CRISPR system can be selected from, for example, Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3 or C2c2 proteins, or functional variants of these nucleases. In some specific embodiments, the CRISPR system is a CRISPR / Cas9 system or a CRISPR / Cpf1 system.

[0093] In some embodiments, the gene editing system comprises

[0094] Cpf1 or a second expression cassette encoding Cpf1, the second expression cassette comprising a nucleotide sequence encoding the Cpf1 operably linked to a second promoter sequence; and

[0095] A guide RNA (gRNA) or a third expression cassette encoding the gRNA, the third expression cassette comprising a nucleotide sequence selected from SEQ ID NO: 1, 2, 3 and 4 operably linked to a third promoter.

[0096] The CRISPR system of the present invention can be transferred into T cells by methods known in the art, such as calcium phosphate transfection, protoplast fusion, electroporation, liposome transfection, microinjection, viral infection (such as baculovirus, vaccinia virus, adenovirus, lentivirus and other viruses), etc.

[0097] In some embodiments, the first polynucleotide is introduced into T cells via a non-integrating viral vector, such as a recombinant adeno-associated virus (rAAV) vector.

[0098] In some embodiments, the first polynucleotide and gene editing system are introduced into T cells via rAAV, and wherein the gene editing system comprises a second expression cassette encoding a CRISPR nuclease, such as Cpf1, and a third expression cassette encoding the gRNA. In some embodiments, T cells are transfected with a first rAAV and a second rAAV, wherein the genome of the first rAAV comprises the first polynucleotide and the third expression cassette and the genome of the second rAAV comprises the second expression cassette.

[0099] In the method of the present invention, T cells can be activated and amplified before or after any modification step. T cells can be amplified in vitro or in vivo. Generally, the T cells of the present invention can be amplified, for example, by contacting with a reagent that stimulates the CD3 TCR complex and the co-stimulatory molecules on the T cell surface to produce T cell activation signals. For example, chemicals such as calcium ion carrier A23187, phorbol 12-myristate 13-acetate (PMA) or mitotic lectins such as phytohemagglutinin (PHA) can be used to produce activation signals of T cells. In some embodiments, T cell colonies can be activated by contacting with, for example, anti-CD3 antibodies or their antigen-binding fragments, or anti-CD2 antibodies fixed on the surface in vitro, or by contacting with protein kinase C activators (e.g., bryostatin) together with calcium ion carriers. For example, under conditions suitable for stimulating T cell proliferation, T cell colonies can be contacted with anti-CD3 antibodies and anti-CD28 antibodies. Conditions suitable for T cell culture include suitable culture media (e.g., Minimal Essential Media or RPMI Media 1640, or X-vivo 5, (Lonza)) that may contain factors necessary for proliferation and viability, wherein the necessary factors include serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-2, IL-15, TGFp and TNF, or additives for cell growth known to those skilled in the art. Other additives for cell growth include, but are not limited to, surfactants, human plasma protein powder, and reducing agents such as N-acetyl-cysteine ​​and 2-mercaptoacetic acid. The culture medium may include RPMI1640, A1M-V, DMEM, MEM, a-MEM, F-12, X-Vivo 1 and X-Vivo 20, Optimizer, amino acids, sodium pyruvate and vitamins, serum-free or appropriately supplemented serum (or plasma) or a set of defined hormones, and / or a certain amount of cytokines sufficient to grow and expand T cells. Target cells may be maintained under conditions necessary to support growth, such as appropriate temperature (e.g., 37° C.) and environment (e.g., air plus 5% CO 2 ).

[0100] The methods of the present invention can be used to modify any known T cell. In some embodiments, the T cell is a γδ T cell.

[0101] The rAAV used in the present invention can be any known serotype suitable for infecting T cells. For example, in some embodiments, the T cells are human T cells, such as human γδ T cells, and the rAAV is human serotype 6 AAV (hAAV6 or AAV6).

[0102] Modified T cells

[0103] In another aspect of the present invention, a modified T cell is provided, which comprises an exogenous polynucleotide encoding a polypeptide of interest integrated into a region of interest in the T cell genome, such as a polynucleotide encoding a CAR or an exogenous TCR.

[0104] In some embodiments, the polypeptide of interest comprises an antigen binding domain, such as an extracellular antigen binding domain, to a tumor-associated antigen.

[0105] The tumor-associated antigens include, but are not limited to, CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123, CD138, ErbB2 (HER2 / neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), FRα, CD19, CD20, CD30, CD40, disialoganglioside GD2, ductal epithelial mucin, gp36, TAG-72, glycosphingolipids, glioma-associated antigens, β-human chorionic gonadotropin, alpha fetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, mut hsp70-2, M-CSF, prostase, prostate enzyme-specific antigen (PSA), PAP, NY-ESO-1, LAGA-1a, p53, Prostein, PSMA, survival and telomerase, prostate cancer tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrin B2, CD22, insulin growth factor (IGF1)-I, IGF-II, IGF1 receptor, mesothelin, major histocompatibility complex (MHC) molecules presenting tumor-specific peptide epitopes, 5T4, ROR1, Nkp30, NKG2D, tumor stromal antigen, extra domain A (EDA) and extra domain B (EDB) of fibronectin, A1 domain of tenascin-C (TnC A1), fibroblast-associated protein (fap), CD3, CD4, CD8, CD24, CD25, CD33, CD34, CD133, CD138, Foxp3, B7-1 (CD80), B7-2 (CD86), GM-CSF, cytokine receptors, endoglin, major histocompatibility complex (MHC) molecules, BCMA (CD269, TNFRSF17), TNFRSF17 (UNIPROT Q02223), SLAMF7 (UNIPROT Q9NQ25), GPRC5D (UNIPROT Q9NZD1), FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708) and FCRL5 (UNIPROT Q68SN8). In one embodiment, the antigen is FRα.

[0106] In some embodiments, the polypeptide of interest comprises a CAR, and the antigen binding domain can be, for example, a monoclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, an antibody single chain variable region, and an antigen binding fragment thereof.

[0107] In a preferred embodiment, the antigen binding domain is a scFv against FRα.In a preferred embodiment, the antigen binding domain comprises a light chain variable region (VL) and a heavy chain variable region (VH) encoded by SEQ ID NO: 10 and 11, respectively.

[0108] In some embodiments, the CAR comprises a transmembrane domain, such as a CD8 transmembrane domain or a CD28 transmembrane domain, preferably a CD8α transmembrane domain encoded by SEQ ID NO:13.

[0109] In some embodiments, the CAR further includes a hinge region between the extracellular antigen binding domain and the transmembrane domain, for example, the hinge region is a CD8 hinge region, for example, a CD8α hinge region encoded by SEQ ID NO: 12.

[0110] In some embodiments, the CAR comprises a signal transduction domain that can be used for T cell activation, such as a signal transduction domain selected from TCR ζ, FcR γ, FcR β, FcR ε, CD3 γ, CD3 δ, CD3 ε, CD3 ζ, CD5, CD22, CD79a, CD79b and CD66d. In some preferred embodiments, the CAR comprises a CD3 ζ signal transduction domain, such as a CD3 ζ signal transduction domain encoded by SEQ ID NO: 15.

[0111] In some embodiments, the CAR further comprises one or more co-stimulatory domains selected from CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB and 4-1BBL. In some embodiments, the CAR comprises a CD28 co-stimulatory domain, such as a CD28 co-stimulatory domain encoded by SEQ ID NO: 14.

[0112] In a preferred embodiment, the CAR comprises, in order from N-terminus to C-terminus, a scFv for FRα, a CD8α hinge region, a CD8α transmembrane domain, a CD28 co-stimulatory domain, and a CD3ζ signal transduction domain. Preferably, the CAR comprises the amino acid sequence encoded by SEQ ID NO: 22.

[0113] In some embodiments, the first expression cassette further encodes a signal peptide that directs the polypeptide of interest to the cell membrane, for example, the signal peptide of IgGκ encoded by SEQ ID NO:9.

[0114] In some embodiments, the first expression cassette further comprises a nucleotide sequence encoding a chemokine, such as SEQ ID NO: 17 encoding CCL-19 (if there are other chemokines of interest, please inform), and the nucleotide sequence encoding the chemokine is operably linked to the nucleotide sequence encoding the CAR.

[0115] In some embodiments, the nucleotide sequence encoding the chemokine is connected to the nucleotide sequence encoding the CAR by a nucleotide sequence encoding a 2A-like peptide. In some embodiments, the 2A-like peptide is selected from foot-and-mouth disease virus (FMDV) 2A peptide, bright vein flat moth virus (TAV) 2A peptide, encephalomyocarditis virus (EMCV) 2A peptide, equine rhinitis A virus (ERAV) 2A peptide and porcine Teschen virus (PTV) 2A peptide. In some embodiments, the 2A-like peptide is SEQ ID NO: 16 encoded foot-and-mouth disease virus 2A peptide (F2A).

[0116] In some embodiments, the region of interest in the genome is a locus encoding an inhibitory protein. In some embodiments, the inhibitory protein is selected from PD-1, LAG-3, CTLA-4, Foxp3, Tim3, and any combination thereof. In some embodiments, the inhibitory protein is PD-1.

[0117] In some embodiments, in the modified T cells of the present invention, the expression of the inhibitory protein is reduced or eliminated (knocked down or knocked out).

[0118] In the present invention, reducing or eliminating the expression of inhibitory proteins in T cells does not affect the expansion capacity of T cells and their basic immune characteristics, and can enhance their biological activities, such as anti-tumor activity, especially the activity of inhibiting or killing solid tumor cells, by relieving immunosuppression.

[0119] In some embodiments, the T cells are γδ T cells.

[0120] IV. Combinations and Kits

[0121] In another aspect of the present invention, a combination or kit for preparing, for example, preparing by the method of the present invention, a modified T cell is provided.

[0122] In some embodiments, the combination or kit comprises a first polynucleotide and a gene editing system targeting a region of interest in a genome, wherein the first polynucleotide comprises a first homology arm, a first expression cassette, and a second homology arm in a 5' to 3' direction, the first expression cassette comprising a nucleotide sequence encoding the polypeptide of interest operably linked to a first promoter sequence, and wherein the first and second homology arms target the region of interest.

[0123] In some embodiments, the polypeptide of interest comprises an antigen binding domain, such as an extracellular antigen binding domain, to a tumor-associated antigen.

[0124] The tumor-associated antigens include, but are not limited to, CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123, CD138, ErbB2 (HER2 / neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), FRα, CD19, CD20, CD30, CD40, disialoganglioside GD2, ductal epithelial mucin, gp36, TAG-72, glycosphingolipids, glioma-associated antigens, β-human chorionic gonadotropin, alpha fetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, mut hsp70-2, M-CSF, prostase, prostate enzyme-specific antigen (PSA), PAP, NY-ESO-1, LAGA-1a, p53, Prostein, PSMA, survival and telomerase, prostate cancer tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrin B2, CD22, insulin growth factor (IGF1)-I, IGF-II, IGF1 receptor, mesothelin, major histocompatibility complex (MHC) molecules presenting tumor-specific peptide epitopes, 5T4, ROR1, Nkp30, NKG2D, tumor stromal antigen, extra domain A (EDA) and extra domain B (EDB) of fibronectin, A1 domain of tenascin-C (TnC A1), fibroblast-associated protein (fap), CD3, CD4, CD8, CD24, CD25, CD33, CD34, CD133, CD138, Foxp3, B7-1 (CD80), B7-2 (CD86), GM-CSF, cytokine receptors, endoglin, major histocompatibility complex (MHC) molecules, BCMA (CD269, TNFRSF17), TNFRSF17 (UNIPROT Q02223), SLAMF7 (UNIPROT Q9NQ25), GPRC5D (UNIPROT Q9NZD1), FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708) and FCRL5 (UNIPROT Q68SN8). In one embodiment, the antigen is FRα.

[0125] In some embodiments, the polypeptide of interest comprises a CAR, and the antigen binding domain can be, for example, a monoclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, an antibody single chain variable region, and an antigen binding fragment thereof.

[0126] In a preferred embodiment, the antigen binding domain is a scFv against FRα.In a preferred embodiment, the antigen binding domain comprises a light chain variable region (VL) and a heavy chain variable region (VH) encoded by SEQ ID NO: 10 and 11, respectively.

[0127] In some embodiments, the CAR comprises a transmembrane domain, such as a CD8 transmembrane domain or a CD28 transmembrane domain, preferably a CD8α transmembrane domain encoded by SEQ ID NO:13.

[0128] In some embodiments, the CAR further includes a hinge region between the extracellular antigen binding domain and the transmembrane domain, for example, the hinge region is a CD8 hinge region, for example, a CD8α hinge region encoded by SEQ ID NO: 12.

[0129] In some embodiments, the CAR comprises a signal transduction domain that can be used for T cell activation, such as a signal transduction domain selected from TCR ζ, FcR γ, FcR β, FcR ε, CD3 γ, CD3 δ, CD3 ε, CD3 ζ, CD5, CD22, CD79a, CD79b and CD66d. In some preferred embodiments, the CAR comprises a CD3 ζ signal transduction domain, such as a CD3 ζ signal transduction domain encoded by SEQ ID NO: 15.

[0130] In some embodiments, the CAR further comprises one or more co-stimulatory domains selected from CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB and 4-1BBL. In some embodiments, the CAR comprises a CD28 co-stimulatory domain, such as a CD28 co-stimulatory domain encoded by SEQ ID NO: 14.

[0131] In a preferred embodiment, the CAR comprises, in order from N-terminus to C-terminus, a scFv for FRα, a CD8α hinge region, a CD8α transmembrane domain, a CD28 co-stimulatory domain, and a CD3ζ signal transduction domain. Preferably, the CAR comprises the amino acid sequence encoded by SEQ ID NO: 22.

[0132] In some embodiments, the first expression cassette further encodes a signal peptide that directs the polypeptide of interest to the cell membrane, for example, the signal peptide of IgGκ encoded by SEQ ID NO:9.

[0133] In some embodiments, the first expression cassette further comprises a nucleotide sequence encoding a chemokine, such as SEQ ID NO: 17 encoding CCL-19 (if there are other chemokines of interest, please inform), and the nucleotide sequence encoding the chemokine is operably linked to the nucleotide sequence encoding the CAR.

[0134] In some embodiments, the nucleotide sequence encoding the chemokine is connected to the nucleotide sequence encoding the CAR by a nucleotide sequence encoding a 2A-like peptide. In some embodiments, the 2A-like peptide is selected from foot-and-mouth disease virus (FMDV) 2A peptide, bright vein flat moth virus (TAV) 2A peptide, encephalomyocarditis virus (EMCV) 2A peptide, equine rhinitis A virus (ERAV) 2A peptide and porcine Teschen virus (PTV) 2A peptide. In some embodiments, the 2A-like peptide is SEQ ID NO: 16 encoded foot-and-mouth disease virus 2A peptide (F2A).

[0135] In some embodiments, the region of interest in the genome is a locus encoding an inhibitory protein. In some embodiments, the inhibitory protein is selected from PD-1, LAG-3, CTLA-4, Foxp3, Tim3, and any combination thereof. In some embodiments, the inhibitory protein is PD-1.

[0136] The gene editing system can be any suitable system known in the art, including but not limited to a system based on a meganuclease, a zinc finger nuclease, a transcription activator-like effector nuclease or CRISPR. Preferably, the gene editing system is a CRISPR gene editing system.

[0137] In some embodiments, a CRISPR gene editing system comprising at least one of the following i) to v):

[0138] i) a CRISPR nuclease, and at least one guide RNA;

[0139] ii) an expression construct comprising a nucleotide sequence encoding a CRISPR nuclease, and at least one guide RNA;

[0140] iii) a CRISPR nuclease, and an expression construct comprising a nucleotide sequence encoding at least one guide RNA;

[0141] iv) an expression construct comprising a nucleotide sequence encoding a CRISPR nuclease, and an expression construct comprising a nucleotide sequence encoding at least one guide RNA;

[0142] v) an expression construct comprising a nucleotide sequence encoding a CRISPR nuclease and a nucleotide sequence encoding at least one guide RNA.

[0143] In some embodiments, the nuclease (CRISPR nuclease) used in the CRISPR system can be selected from, for example, Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3 or C2c2 proteins, or functional variants of these nucleases. In some specific embodiments, the CRISPR system is a CRISPR / Cas9 system or a CRISPR / Cpf1 system.

[0144] In some embodiments, the gene editing system comprises

[0145] Cpf1 or a second expression cassette encoding Cpf1, the second expression cassette comprising a nucleotide sequence encoding the Cpf1 operably linked to a second promoter sequence; and

[0146] A guide RNA (gRNA) or a third expression cassette encoding the gRNA, the third expression cassette comprising a nucleotide sequence selected from SEQ ID NO: 1, 2, 3 and 4 operably linked to a third promoter.

[0147] In some embodiments, the combination or kit comprises a first rAAV and a second rAAV, wherein the genome of the first rAAV comprises the first polynucleotide and the third expression cassette and the genome of the second rAAV comprises the second expression cassette.

[0148] The rAAV used in the present invention can be any known serotype suitable for infecting T cells. For example, in some embodiments, the combination or kit is used to prepare modified human T cells, such as human γδ T cells, and the rAAV is AAV of human serotype 6 (hAAV6 or AAV6).

[0149] In some embodiments, the kit may further comprise reagents for detecting T cells, isolating T cells, activating T cells and / or expanding T cells. In some embodiments, the kit may further comprise instructions for implementing the methods of the invention.

[0150] 5. Pharmaceutical Composition and Application

[0151] In another aspect of the present invention, a pharmaceutical composition for treating cancer is provided, comprising the modified T cells of the present invention and a pharmaceutically acceptable carrier. In addition, the present invention also provides the use of the modified T cells of the present invention in preparing a drug for treating cancer.

[0152] In another aspect of the present invention, a method for treating cancer is also provided, comprising administering a therapeutically effective amount of the modified T cells of the present invention or the pharmaceutical composition of the present invention to a subject in need thereof. In some embodiments, the modified T cells are prepared from autologous T cells from the subject in need thereof. In some embodiments, the modified T cells are prepared from T cells (such as γδ T cells) from a healthy donor.

[0153] In some embodiments, the method further comprises administering to the subject radiation therapy and / or chemotherapy and / or additional tumor-targeted drugs (eg, monoclonal antibodies or small molecule compounds targeting other antigens).

[0154] Non-limiting examples of cancers that can be treated by the cells or pharmaceutical compositions of the invention include lung cancer, ovarian cancer, colon cancer, rectal cancer, melanoma, kidney cancer, bladder cancer, breast cancer, liver cancer, lymphoma, hematological malignancies, head and neck cancer, glioma, stomach cancer, nasopharyngeal cancer, laryngeal cancer, cervical cancer, uterine body tumors, and osteosarcoma. Other examples of cancers that can be treated by the methods or pharmaceutical compositions of the invention include: bone cancer, pancreatic cancer, skin cancer, prostate cancer, cutaneous or intraocular malignant melanoma, uterine cancer, anal cancer, testicular cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic or acute leukemia (including acute myeloid leukemia), leukemia, ... , chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia), solid tumors in children, lymphocytic lymphoma, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal tumors, brain stem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers, including asbestos-induced cancers, and combinations of said cancers. Preferably, the cancer is a solid tumor cancer.

[0155] In some embodiments, the cancer is breast cancer, such as FRα-positive breast cancer. Example

[0156] Example 1. Preparation of rAAV

[0157] The construction of the rAAV donor plasmid encoding CAR and gRNA includes the following steps: i) the polynucleotide DR-CR-gRNA-DR-LHA-CMVpromoter-19CAR-PA-RHA (whose nucleotide sequence is SEQ ID NO: 23-26) is synthesized by Sangon Biotech (Shanghai) Co., Ltd., wherein 19CAR encodes CAR targeting FRα and CCL-19, and its structure is as follows Figure 1 As shown in SEQ ID NO: 5; DR is the RNA cutting recognition region of Cas12a, as shown in SEQ ID NO: 5; CR handle is the "handle" of Cas12a protein, that is, it provides a binding site for Cas12a to cut downstream gRNA, as shown in SEQ ID NO: 6; gRNA is the sequence gRNA1-4 encoding the gRNA targeting the PD1 locus, as shown in SEQ ID NO: 1-4, respectively; LHA and RHA are homologous arms targeting the PD-1 locus, as shown in SEQ ID NO: 7 and 18, respectively; CMV promoter is a promoter from cytomegalovirus, as shown in SEQ ID NO: 8; PA is a polyadenylation signal sequence, as shown in SEQ ID NO: 20; and ii) cloning the synthesized DR-CR-gRNA-DR-LHA-CMVpromoter-19CAR-PA-RHA into the AAV6 vector backbone (pDGM6, purchased from Addgene) to obtain the rAAV donor plasmid donor-19CAR1-4 (plasmid map as shown in Figure 2 shown).

[0158] The construction of the rAAV plasmid encoding LbCpf1 comprises the following steps: i) synthesizing a polynucleotide encoding LbCpf1 (SEQ ID NO: 21); and ii) cloning the synthesized polynucleotide into the AAV6 vector backbone (pDGM6) to obtain the rAAV donor plasmid donor-Cpf1 (plasmid map as shown in Figure 3 shown).

[0159] As described in the article by Dai X et al. (Dai X, et al. One-step generation of modular CAR-Tcells with AAV-Cpf1. Nat Methods. 2019; 16(3): 247-254), the donor plasmid was separately combined with the auxiliary plasmid pHelper (see Figure 4 ) and packaging plasmid REP2-CAP6 (see Figure 5) were co-transfected into HEK293FT cells for packaging, and the recombinant AAV (i.e., AAV6-Cpf1 and AAV6-19CAR1-4) viral particles were harvested after concentration and purification, and quantitative PCR (using the QuickTiter TM AAV Quantitation Kit, purchased from Cell Biolabs, the kit includes primers) to measure the virus titer (1x10 13 GC / ml, the total number of genome copies contained in each ml of virus particle suspension).

[0160] Example 2: Preparation of CAR-T cells with site-specific integration of CAR coding sequences into the PD-1 locus

[0161] According to the instructions, peripheral blood was collected from healthy volunteers using COBE Spectra blood component separator, and anticoagulant ACD-A (22 g / L hydrated sodium citrate (clinical grade ACD-A, purchased from Sichuan Nanger Biotechnology Co., Ltd.)), 7.3 g / L anhydrous citric acid, 24.5 g / L anhydrous glucose in water) was used to obtain PBMC in the buffy coat by Ficoll gradient density centrifugation, and γδ positive T cells (γδT cells) were obtained by sorting using γδT cell magnetic bead sorting kit (Anti-TCRγ / δMicroBead Kit, human, purchased from Miltenyi, lot: 130-050-701). Flow cytometric analysis (using antibody TCRγ / δAntibody, anti-human, FITC, purchased from Miltenyi, lot: 130-113-503 and BD-FACS101 flow cytometer) showed that before magnetic bead sorting, the proportion of γδT in PBMC was about 3.21% ( Figure 6 , left panel); and after magnetic bead sorting, the proportion of γδT cells was 99.2% ( Figure 6 , right panel).

[0162] The γδT cells were cultured in a culture medium containing zoledronic acid (ZOL) (X-VIVO 15, purchased from LONZA; ZOL, zoledronic acid for injection, trade name Zometa, purchased from Novartis), the culture medium containing ZOL (5 μM), IL-2 (purchased from Peprotech) (200 U / ml), IL-15 (purchased from Peprotech) (10 ng / ml). The γδT cells were cultured at 37°C for 12 days to expand the cell number from the initial 3-4×10 6 Increase to 1-2×10 8 .

[0163] AAV6-Cpf1 and AAV6-19CAR1-4 (Dual-AAV) were co-cultured with γδ T cells at an MOI of 10,000 in X-VIVO 15 medium (purchased from LONZA) at 37°C for 24-48 hr.

[0164] DNA from the above-mentioned γδT cells and untransfected γδT cells was extracted (using DNAzol reagent purchased from ThermoFisher, extracted according to the manufacturer's instructions) as templates for PCR amplification and recovery of PCR products (Tiangen Plasmid Extraction Kit (DP103)). PCR was performed using the forward primer PD-1F:tagtaggaaatcagggagacc and the reverse primer PD-1R:cctgagccgtgctcctaggt synthesized by Shanghai Bio-Tech. The PCR reaction system included: 2×Taq mix (purchased from Novoprotein), 5μl; PD-1-F (10μM), 0.3μl; PD-1-R (10μM), 0.3μl; ddH2O, 4μl (reaction conditions: 96℃, 3min; 94℃, 30s, 53℃, 30s, 72℃, 10s, a total of 32 cycles; 72℃, 2min).

[0165] The PCR product (100 ng / μl, 5 μl), 10x Buffer (1 μl), ddH2O (4 μl) and T7E1 enzyme (0.5 μl, purchased from NEB) were mixed and incubated at 37°C for 30 min for digestion. The digestion product was subjected to 2% agarose gel electrophoresis. The electrophoresis results were as follows: Figure 7 The electrophoresis results were analyzed using Image J software, showing that all four gRNAs mediated significant knockout of PD-1, among which gRNA2 mediated the most efficient PD-1 knockout.

[0166] The expression of PD-1 in transfected γδT cells was detected by flow cytometry (using the antibody anti-human g / d purchased from Miltenyi Biotec and BD-FACS101 flow cytometer). The results are shown in Figure 8 As shown, the PD-1 expression rate in non-transfected γδT cells was 23.1%, while the PD-1 expression rate in transfected γδT cells was 7.9% (gRNA2), and the PD-1 knockout efficiency was as high as 65.8%.

[0167] After culturing with the aforementioned culture medium containing ZOL at 37°C for 14 days, the expression of 19CAR in the transfected γδT cells was detected by flow cytometry (using antibody FITCCD279 / FITC anti-human CD279 (PD-1), purchased from biolegend and BD-FACS101 flow cytometer). The results are as follows: Fig. 9As shown, the CAR expression rate was as high as 33.4% (gRNA2).

[0168] In addition, transfected γδT cells (19CAR-γδT) and untransfected γδT cells were cultured with the aforementioned culture medium containing ZOL for 12 days at 37°C, and untransfected αβT cells were cultured with culture medium X-VIVO15 containing CD3 / 28 (both purchased from Peprotech, 1 μg / ml each) and IL-2 (purchased from Peprotech, 500 U / ml) for 12 days. Fig.10 As shown, both 19CAR-γδT and γδT cells expanded by about 160 times, while αβT cells expanded by about 200 times, indicating that knocking out PD-1 and introducing 19CAR had no significant effect on cell growth.

[0169] Example 3: 19CAR-γδT cells effectively kill FRα-positive tumors

[0170] 3.1、19CAR-γδT cells can recognize and kill FRα-positive tumor cells in vitro and recruit immune cells

[0171] First, effector cells (19CAR-γδT cells, common CAR-γδT cells (same as 19CAR-γδT cells except that they do not express CCL-19)) and target cells (breast cancer cell lines MCF-7, MDA-MB-231 and C30, which express high, moderate and low FRα, respectively) were mixed at a ratio of 10:1 (effect-target ratio, E:T) and cultured in a 96-well plate at 37°C for 24 hours. The supernatant was collected and IFN-γ and CCL-19 were detected by ELISA.

[0172] Specifically, the effector cells were placed in X-VIVO 15 medium without IL-2, and the cells were kept in a resting state at 37°C overnight. The target cells were cultured at 2×10 5 The number of cells / well was added to two 24-well plates, the volume of the culture medium was adjusted to 1 ml, and the plates were incubated at 37°C and 5% CO2 for 2 h. After the tumor cells adhered to the wall under a microscope, 2×10 5 The effector cells were cultured in the incubator for 24 hours. 500 μl / well of the culture supernatant was taken and centrifuged at 4000 rpm for 10 minutes to remove particulate matter and polymers. Then, the secretion levels of IFN-γ and CCL19 were detected using human interferon γ (IFN-γ) and CCL19 ELISA kits (the kit for detecting IFN-γ was purchased from Beijing Solebao, and the kit for detecting CCL19 was purchased from EIAab) according to the instructions.

[0173] The results are as follows Fig.11As shown in the figure, the amount of IFN-γ secreted by 19CAR-γδT cells is positively correlated with the expression of FRα. MCF-7 cells with high FRα expression stimulate 19CAR-γδT cells to secrete high concentrations of IFN-γ. In addition, 19CAR-γδT cells also secrete high concentrations of CCL-19.

[0174] Furthermore, the ability of 19CAR-γδT cells to recruit immune cells was tested by Transwell assay. 5 MCF-7 cells were seeded at the bottom of a 24-well plate (used as the lower chamber of the Transwell assay) and cultured for 4 hours to allow them to adhere to the plate. They were then pretreated with mitomycin C. The tumor cell culture medium was discarded and 1×10 6 / 500 μl of the above effector cells. A Transwell upper chamber (5 μm, purchased from Corning) was placed in each well, and 1×10 5 DC cells / 200 μl, 5×10 5 T cells / 200 μl were added to different upper chambers of Transwell. After incubation at 37°C for 24 h, the number of CFSE-positive cells in the lower chamber of the 24-well plate was detected by flow cytometry using a BD-FACS101 flow cytometer.

[0175] Specifically, MCF-7 cells in the logarithmic growth phase were digested and centrifuged, and the cell concentration was adjusted to 2x10 5 / ml. Prepare effector cell suspension: 19CAR-γδT, CAR-T or γδT cells, adjust the cell concentration to 2x10 6 After pre-labeling αβT cells or DCs with CFSE, the cell concentration was adjusted to 1x10 6 / ml.

[0176] Add 1 ml of MCF-7 cell suspension (2x10 5 / well), and cultured overnight at 37°C, 5% CO2. Mitomycin-C was added to each well at a final concentration of 100 μg / ml, and treated at 37°C, 5% CO2 for 90 min. The culture medium was discarded and the cells were divided into 19CAR-γδT, CAR-T, and γδT groups, with 9 wells in each group.

[0177] According to the grouping, 600 μl of 19CAR-γδT, CAR-T or γδT cell suspension was added to each well and cultured at 37°C, 5% CO2 for 12 h. 100 μl of CFSE pre-stained αβT cells or DCs were added to the upper chamber of each group of Transwells, placed on top of the 24-well plate to avoid bubbles, and cultured at 37°C, 5% CO2 for 4 h, n = 3. The cells in the lower chamber of the 24-well plate were collected, and the number of CFSE-positive cells was detected by flow cytometry.

[0178] The results are as follows Fig.12 The results showed that the DC cells and T cells recruited in the wells containing 19CAR-γδT cells were significantly higher than those in the wells containing CAR-γδT cells and unmodified γδT cells, indicating that 19CAR-γδT cells can recruit a large number of DC cells and T cells to the tumor site through chemotaxis.

[0179] In addition, the ability of 19CAR-γδT cells to kill tumor cells in vitro was detected by CCK-8 assay. The effector cells (19CAR-γδT, negative control γδT and positive control FRα-CAR-αβT (prepared by transfecting αβT cells with lentivirus expressing FRα-CAR, i.e., 19CAR without CCL-19) were incubated overnight in a 37°C 5% CO2 incubator in X-VIVO15 medium without IL-2, and the effector cell concentration was adjusted to 1×10 6 / ml. Add 1×10 5 / ml tumor cell (C30, MDA-MB-231 and MCF-7) suspension, 100μl / well, incubated in a 37℃ 5% CO2 incubator for 4hrs, after confirming that the tumor cells adhered to the wall by microscopic observation, the original culture medium was discarded, and effector cells were added at effector-target ratios of 1:1, 5:1 and 10:1, respectively, and incubated in a 37℃ 5% CO2 incubator for 12hrs. Washed twice with PBS to remove the non-adherent suspended cells, then added complete culture medium (DMEM+10% FBS, culture medium and serum were purchased from Gibco), and then added 10μl CCK-8 solution (purchased from Japan Tongren), incubated in a 37℃ 5% CO2 incubator for 2hrs, and then measured the absorbance at 450nm with an enzyme marker within 10min.

[0180] The killing efficiency is calculated as follows:

[0181] Killing efficiency % = (1-OD 450 E+T / OD 450T )×100%,

[0182] OD 450 E+Tis the absorbance of the wells containing effector and target cells, OD 450T is the absorbance of the control wells to which only target cells were added.

[0183] The results are as follows Fig.13 As shown, the targeted killing efficiency of 19CAR-γδT and FRα-CAR-αβT is comparable, and the killing efficiency is positively correlated with the expression level of FRα in target cells (P<0.001). When E:T=10:1, the targeted killing efficiency of MDA-231 with moderate expression of FRα is about 70%, while the targeted killing efficiency of MCF-7 with high expression of FRα is higher than 90%, while unmodified γδT cells have no obvious targeted killing function. The results showed that at an effect-target ratio of 10:1, there was a significant statistical difference in the killing efficiency of 19CAR-γδT against the three tumor cells (P<0.001).

[0184] The above results show that 19CAR-γδT cells can recognize FRα, secrete IFN-γ cytokines, and exert targeted killing function; they can also secrete CCL-19 chemokines to recruit other immune cells to tumors and achieve a synergistic killing effect of multiple immune cells.

[0185] 3.2. 19CAR-γδT cells can recognize and kill FRα-positive tumors in vivo and recruit immune cells

[0186] Take MDA-MB-231 cells in the logarithmic growth phase and adjust the cell density to 6×10 6 After 14 days of adaptive feeding (D14, the date of adaptive feeding after the purchase of mice was recorded as D1), 3×10 MDA-MB-231 cells were injected subcutaneously on the back of NSG immunodeficient mice (6-8 weeks old, female, purchased from Vital River). 6 / 0.5ml for modeling. The subcutaneous tumor was observed every three days, and the long diameter (a) and short diameter (b) were measured with a vernier caliper. According to the formula: volume (v) = 1 / 2 (a×b 2 ) Calculate the volume of the tumor. Mice were fed for 12-14 days, and the tumor grew to 100-150mm 3 , the mice were divided into five groups (n=5): γδT group, CAR-T group, 19CAR-γδT group, CAR-T+human PBMC group, 19CAR-γδT+human PBMC group. Effector cells were administered by tail vein injection 14 days after modeling (D28), and the same dose of effector cells was administered 7 days later (D35) (as shown in Table 1, CAR-T is the same as in Example 3.1).

[0187] Table 1

[0188] Group Administered cells (cell number / total volume) γδT group <![CDATA[γδT(2×10 7 / 0.2ml)]]> CAR-T group <![CDATA[CAR-T(2×10 7 / 0.2ml)]]> 19CAR-γδT group <![CDATA[19CAR-γδT(2×10 7 / 0.2ml)]]> CAR-T+PBMC group <![CDATA[CAR-T and PBMC (2×10 7 and 2×10 7 / 0.2ml)]]> 19CAR-γδT+PBMC group <![CDATA[19CAR-γδT and PBMC (2×10 7 and 2×10 7 / 0.2ml)]]>

[0189] The mice were observed every three days during the treatment period. All mice showed no adverse reactions such as allergic reactions, hair loss, diarrhea, and irritability.

[0190] Tumors were measured and their volumes were calculated every 3-5 days as described above, and tumor growth curves were plotted. Fig.14 As shown in the data, after treatment, the tumors in the γδT group continued to grow, while the tumors in the CAR-γδT, 19CAR-γδT, and CAR-γδT+PBMC groups grew significantly slower. The tumors in the 19CAR-γδT+PBMC group were significantly reduced (vs.CAR-γδT group, P<0.001; vs.CAR-γδT+PBMC group, P<0.05), and some tumors almost disappeared.

[0191] Mice were sacrificed 38 days after the first administration (D66), and tumors were harvested and their volumes were measured.

[0192] Tumor tissue samples were fixed in 4% paraformaldehyde for 24 hours, routinely paraffin-embedded, and serially sectioned at 4 μm for HE and human CD3 / S100 immunofluorescence staining.

[0193] A. HE staining:

[0194] The sections were sequentially soaked in xylene I (15min), xylene II (10min), anhydrous alcohol I (2min), anhydrous alcohol II (2min), 95% alcohol (2min), and 80% alcohol (2min) for wax removal; then washed with PBS 3 times, 3min each time. The sections were transferred to hematoxylin (Hematoxylin and eosin staining kit, HE kit, purchased from Wuhan Boster Biotechnology Co., Ltd.) and soaked for 5min; then washed with running water for 2min. Differentiate with 1% hydrochloric acid ethanol for 2s (the sections are reddish brown); then wash with running water for about 5min, observe the sections under a microscope during the washing process, and stop when the cell nucleus is blue-purple. Soak the sections in eosin staining solution (Hematoxylin and eosin staining kit, HE kit, purchased from Wuhan Boster Biotechnology Co., Ltd.) for 30s; then dehydrate the sections in 80% alcohol (10s), 95% alcohol I (3min), 95% alcohol II (3min), anhydrous alcohol I (3min), and anhydrous alcohol II (3min). The dehydrated sections were immersed in xylene I and xylene II for 5 min respectively for transparency, and then sealed with neutral gum and observed and photographed under a microscope.

[0195] The results are as follows Fig.15 As shown, more and larger vacuolar necrotic foci appeared in the tumor tissue of the 19CAR-γδT+PBMC group than in the other groups, indicating that the killing efficiency was significantly better than that of the other groups.

[0196] B. Human CD3 / S100 immunofluorescence staining:

[0197] The sections were sequentially soaked in xylene I (15min), xylene II (10min), anhydrous alcohol I (2min), anhydrous alcohol II (2min), 95% alcohol (2min), and 80% alcohol (2min) for wax removal; then washed 3 times with PBS, 3min each time. 1% Triton X-100 was added to the sections and incubated at room temperature for 15min; then washed 3 times with PBS, 5min each time. Incubated with immunofluorescence staining blocking solution (purchased from Beyotime) at room temperature for 1h for blocking. The primary antibody for immunofluorescence staining (purchased from Wuhan Sanying) was diluted with diluent (PBS, purchased from Gibco) according to the following ratios: Human CD3 (1:500), Human S100 (1:500), and the sections were placed in a wet box containing antibody diluent and incubated overnight at 4°C. The primary antibody diluent was removed and the sections were washed 3 times with PBS, 5min each time. The secondary antibody for immunofluorescence staining (purchased from Wuhan Mitaka) was diluted with diluent according to the following ratio: FITC (1:1000) (green fluorescence, for DC cells), PE-Cy5 (1:1000) (red fluorescence, for T cells), and the sections were placed in the secondary antibody diluent and incubated at room temperature in the dark for 1 hour. The secondary antibody diluent was removed and washed 3 times with PBS in the dark for 5 minutes each time. The sections were sealed with a three-in-one sealing agent containing DAPI (purchased from Invitrogen) in the dark and observed and photographed under a fluorescence microscope.

[0198] The results are as follows Fig.16 As shown, there were significantly more DC cells (green) and T cells (red) infiltrating in the tumors of the 19CAR-γδT+PBMC treatment group, indicating that DC cells and T cells were recruited into the tumor tissue.

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

Claims

1. A method for preparing a chimeric antigen receptor (CAR) T cell, comprising introducing a first polynucleotide and a gene editing system targeting a region of interest in a T cell genome into a T cell, wherein the first polynucleotide comprises a first homology arm, a first expression cassette, and a second homology arm in a 5' to 3' direction, the first expression cassette comprising a nucleotide sequence encoding the CAR operably linked to a first promoter sequence, and wherein the first and second homology arms target the region of interest, wherein the region of interest is a locus encoding an inhibitory protein, The first polynucleotide and the gene editing system are introduced into T cells by recombinant adeno-associated virus (rAAV), and the gene editing system comprises a second expression cassette encoding Cpf1 and a third expression cassette encoding a guide RNA (gRNA), wherein the gRNA comprises the nucleotide sequence of SEQ ID NO: 2, and the method comprises T cells are transfected with a first rAAV and a second rAAV, wherein the genome of the first rAAV comprises the first polynucleotide and the third expression cassette and the genome of the second rAAV comprises the second expression cassette.

2. The method of claim 1, wherein the inhibitory protein is PD-1.

3. The method of claim 1 or 2, wherein the gene editing system is a CRISPR editing system.

4. The method of claim 1 or 2, wherein the second expression cassette comprises a nucleotide sequence encoding the Cpf1 operably linked to a second promoter sequence; and The third expression cassette comprises the nucleotide sequence of SEQ ID NO: 2 operably linked to a third promoter.

5. The method of claim 1 or 2, wherein the T cells are γδ T cells.

6. An rAAV combination comprising a first rAAV and a second rAAV, wherein the genome of the first rAAV comprises a first polynucleotide and a third expression cassette encoding a gRNA targeting a region of interest in the genome, wherein the first polynucleotide comprises a first homology arm, a first expression cassette, and a second homology arm in a 5' to 3' direction, the first expression cassette comprises a nucleotide sequence encoding a CAR operably linked to a first promoter sequence, and wherein the first and second homology arms target the region of interest, wherein the region of interest is a locus encoding an inhibitory protein, wherein the gRNA comprises the nucleotide sequence of SEQ ID NO: 2, and The genome of the second rAAV encodes a second expression cassette of Cpf1.

7. A kit for preparing a CAR-T cell, comprising a first rAAV and a second rAAV, wherein the genome of the first rAAV comprises a first polynucleotide and a third expression cassette encoding a gRNA targeting a region of interest in a T cell genome, wherein the first polynucleotide comprises a first homology arm, a first expression cassette, and a second homology arm in a 5' to 3' direction, the first expression cassette comprises a nucleotide sequence encoding a CAR operably linked to a first promoter sequence, and wherein the first and second homology arms target the region of interest, wherein the region of interest is a locus encoding an inhibitory protein, wherein the gRNA comprises the nucleotide sequence of SEQ ID NO: 2, and The genome of the second rAAV encodes a second expression cassette of Cpf1.

8. The combination of claim 6 or the kit of claim 7, wherein the inhibitory protein is PD-1.

9. The combination of claim 6 or the kit of claim 7, wherein the gene editing system is a CRISPR editing system.

10. The combination of claim 6 or the kit of claim 7, wherein the second expression cassette comprises a nucleotide sequence encoding the Cpf1 operably linked to a second promoter sequence.

Images