Rhodococcus etheriferus for degrading benzene series and its biological detoxifying agent and use
By screening out Rheumatoidus LH-HF0020, the detoxification and activated sludge treatment problems of benzene wastewater under high salt conditions were solved, and efficient benzene degradation, COD removal and total nitrogen degradation were achieved, which was suitable for bio-enhancing treatment of coking wastewater.
Patent Information
- Application Number
- CN202311061027.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-22
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2043-08-22
AI Technical Summary
The prior art is difficult to effectively remove the toxicity in benzene wastewater under high salt conditions, and it is difficult to bio-enhance COD removal and total nitrogen degradation of activated sludge. Especially in coking wastewater, existing strains are insufficient tolerate high salinity.
It provides a Rhodococcus aetherivorans LH-HF0020 (Rhodococcus aetherivorans). This strain has a growth ability in the range of 0 to 10% salinity, and can proliferate and degrade benzene with benzene as the only carbon source. The biological detoxifying agent produced achieves a benzene degradation rate of ≥93.51% at 3% salinity, and strengthens activated sludge to achieve a COD removal rate of ≥95.99% and a total nitrogen degradation rate of ≥96.57%.
Highly efficient degradation of benzene in a high-salt environment significantly improves the COD removal and total nitrogen degradation effect of activated sludge, and has good industrial application prospects.
Smart Images

Figure CN116925977B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and environmental protection, and specifically relates to a Rhodococcus etherivorans LH-HF0020 capable of degrading benzene, toluene, ethylbenzene, xylene and o-xylene, and its application in the enhanced detoxification treatment of high-salt wastewater rich in benzene series. Background Art
[0002] Benzene series compounds (BHCs) are a general term for organic compounds containing benzene rings, primarily including benzene, toluene, ethylbenzene, xylene, trimethylbenzene, styrene, phenol, aniline, chlorobenzene, and nitrobenzene. They are common substances in human life and are also common pollutants in the natural environment. Benzene series compounds are highly carcinogenic, teratogenic, and mutagenic, difficult to degrade, and have strong migration properties. These compounds have attracted significant attention in many countries and have been designated as priority pollutants. Short-term, high-dose exposure can cause anesthesia to the central nervous system, leading to significant irritation of the eyes and upper respiratory tract, such as conjunctival and pharyngeal congestion, as well as dizziness, headache, nausea, vomiting, chest tightness, weakness, and confusion. Long-term exposure can lead to neurasthenia. Because most BHCs (such as benzene and toluene) are highly volatile, they readily evaporate into gases at room temperature to form volatile organic compounds (VOCs), which are harmful to humans and the environment. VOC pollution, particularly BHC pollution, poses a significant threat to human life. Among wastewater pollution sources, benzene series compounds (BTEX) have a significant impact on wastewater treatment. Coking wastewater containing BTEX compounds primarily originates from: coal pyrolysis to produce coal gas, residual ammonia wastewater generated by cooling, wastewater from the final gas cooler and crude benzene separation tank during gas purification, refined benzene, and other petrochemical processes. BTEX-containing wastewater has complex and variable composition and contains many difficult-to-degrade aromatic organics, heterocyclic and polycyclic compounds, making it difficult to treat. It can also easily cause toxicity to the functional bacterial agents in biochemical treatment systems, affecting their effectiveness. Currently, the main methods for treating BTEX compounds include absorption, adsorption, condensation, combustion, photocatalytic oxidation, and biodegradation. Compared to other methods, biochemical methods have attracted considerable attention due to their mild treatment conditions and low application costs. Biological treatment methods mostly use activated sludge and biofilm methods. However, because the composition of wastewater containing benzene series is relatively complex and has strong biological toxicity, it often has a great impact on the functional microorganisms of the activated sludge system, resulting in the failure to achieve the target treatment effects such as COD removal and total nitrogen degradation, thereby affecting the compliance of the effluent with the standards.
[0003] How to effectively and economically achieve the detoxification of high-BTEX wastewater, system COD removal and total nitrogen degradation has become a technical problem that needs to be solved urgently, and the key to the problem is to find functional microorganisms with strong tolerance to the toxicity of BTEX. In recent years, microbial strains of different genera have been screened, and the reported BTEX-degrading bacteria mainly include Pseudomonas, Rhodococcs, Azoarcus, Alcaligenes, Bacillus, Burkholderia, etc. Many aerobic bacteria can degrade one or more BTEX compounds, etc., and have certain results in the treatment of BTEX wastewater. As disclosed in Chinese Patent Application No. 2021103196697, the present invention discloses an Enterobacter cloacae with the ability to degrade BTEX and its application in environmental remediation. The present invention screened and isolated a strain of Enterobacter cloacae GDUTAN7 with good degradation ability for benzene series from the leachate of a landfill in Guangzhou City, Guangdong Province, and deposited it in the China Center for Type Culture Collection (CCTCC) on January 18, 2021, at Wuhan University, Wuhan, China, with the deposit number CCTCC NO: M2021091. The Enterobacter cloacae GDUTAN7 obtained by the present invention has a good degradation effect on benzene series in the environment, and can be used to degrade benzene series in the environment to achieve the purpose of environmental remediation. Chinese Patent Application No. 2020103665676 discloses a microbial agent, particularly a composite microbial agent for treating petroleum hydrocarbons and benzene series, its preparation method, and application. The composite agent's active ingredients include Aspergillus oryzae, Neurospora, Pseudomonas putida, Pseudomonas alcaligenes, Brevibacterium epidermidis, and Erwinia species. The composite agent is particularly suitable for treating soil contaminated by petroleum hydrocarbons and benzene series. When added to soil contaminated by petroleum hydrocarbons and benzene series, the composite agent rapidly propagates the indigenous degrading bacteria, rapidly initiating the remediation process. During the remediation process, the indigenous degrading bacteria consistently dominate, and through the synergistic cooperation of the bacterial communities within the composite agent, a high degradation efficiency is maintained over a long period of time. Ultimately, the contaminated soil is completely remediated, with high degradation rates for petroleum hydrocarbons and benzene series, and removal rates of BTEX and TPH exceeding 98%.
[0004] However, when these strains degrade benzene series, there is no mention of whether they can tolerate higher salinity. In actual coking wastewater, the salinity is generally between 1.5-5.5%, which is a high-salt industrial wastewater, and the salinity of concentrated coking wastewater is even higher. At the same time, while removing the toxicity of benzene series and assisting in the removal of COD indicators, if the functional strains have the ability to degrade related indicators such as ammonia nitrogen, total nitrogen, and nitrate nitrogen, it will be more helpful for the system effluent to meet the standards. Therefore, there is an urgent need to screen new strains with strong benzene degradation capabilities, salt tolerance, denitrification and other composite functions to expand their application salinity and enhance the range of assisting indicators. Summary of the Invention
[0005] A technical problem to be solved by the present invention is to address the deficiencies of the existing technology and provide a salt-tolerant functional bacterium, Rhodococcus etherivorans LH-HF0020, which can efficiently remove the toxicity of benzene series wastewater under high salt conditions and bioenhance the COD removal and total nitrogen degradation capabilities of activated sludge.
[0006] Another technical problem to be solved by the present invention is to provide a biological detoxifying bacterial agent made from the above-mentioned salt-tolerant benzene-degrading Rhodococcus etheriferus LH-HF0020.
[0007] Another technical problem to be solved by the present invention is to provide the use of the above-mentioned low-temperature resistant benzene-degrading Rhodococcus etheriferus LH-HF0020 and the salt-tolerant biological detoxifying agent prepared therefrom.
[0008] In order to achieve the above-mentioned purpose, the present invention is implemented through the following technical solutions:
[0009] The present invention provides Rhodococcus aetherivorans LH-HF0020, whose deposit number is CGMCC No. 27555. The Rhodococcus aetherivorans LH-HF0020 is deposited at the General Microbiology Center of the China Culture Collection Administration (CGMCC); Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; Deposit date: June 5, 2023.
[0010] The Rhodococcus etherivorans LH-HF0020 described in the present invention has orange, opaque, round colonies with neat edges, a smooth and moist surface, and a diameter of 0.5 mm after culturing on Lb medium for 24 hours. Microscopic examination of the bacteria is G+. Under a transmission electron microscope at 6000x magnification, the bacteria appear rod-shaped (1 μm × 3.2 μm) and lack flagella. The nucleotide sequence of the Rhodococcus etherivorans LH-HF0020 is shown in SEQ ID No. 1.
[0011] The growth salinity (calculated as NaCl) of the Rhodococcus etherivorans LH-HF0020 of the present invention ranges from 0 to 10%, and the optimal growth salinity (calculated as NaCl) of the Rhodococcus etherivorans LH-HF0020 is 1%.
[0012] The present invention also discloses a fermentation culture method for Rhodococcus etherivorans LH-HF0020. A single colony is picked from a plate and inoculated into 100 mL of 10% LB medium, cultured at 30°C and 180 rpm until the exponential phase, centrifuged at 6000 rpm for 5 minutes, the cells are collected, washed twice with 15 mL of sterile MM medium, and finally resuspended in 5 mL of MSM medium to obtain a seed solution. The seed solution is inoculated into 35 mL of MSM medium, the initial OD600 of the cells is adjusted to 0.1, and a benzene series compound is added at a final concentration of 400-450 mg / L. The culture is cultured for 48 hours at a shaker speed of 180 rpm. The benzene series compound is preferably a mixture of one or more of benzene, toluene, ethylbenzene, p-xylene, and o-xylene.
[0013] The Rhodococcus etherivorans LH-HF0020 of the present invention has the ability to achieve self-growth using benzene series as the sole carbon source while degrading and utilizing benzene series. In an MSM inorganic salt culture medium using benzene series as the sole carbon source, at a temperature of 30° C., a pH of 8, an inoculum size of 10%, an initial benzene series comprehensive concentration of 1500 ppm, and a salinity (calculated as NaCl) of ≤3%, the benzene series degradation rate of Rhodococcus etherivorans LH-HF0020 is ≥86.93%.
[0014] The present invention also provides a biological detoxifying agent for Rhodococcus etheriferus LH-HF0020, which is characterized in that the agent is prepared by the following method: after activating Rhodococcus etheriferus LH-HF0020 in LB culture medium, inoculating it into 100 mL of 10% LB culture medium, culturing it to the exponential phase under the conditions of 30°C and 180 rpm, centrifuging it at a speed of 6000 rpm for 5 minutes, collecting the bacteria, adding 15 mL of sterile MM culture medium to wash the bacteria twice, and finally adding 5 mL of MSM culture medium to resuspend it to obtain a seed liquid; inoculating the seed liquid into 35 mL of MSM culture medium, adjusting the initial OD600 of the bacteria to 0.1, adding a benzene series compound to a final concentration of 400-450 mg / L, and culturing it for 48 hours under the condition of a shaker speed of 180 rpm to obtain the biological detoxifying agent for Rhodococcus etheriferus LH-HF0020.
[0015] The Rhodococcus etherivorans LH-HF0020 of the present invention can be used in the preparation of a biological detoxifying agent for removing the toxicity of benzene series. The benzene series include benzene, toluene, ethylbenzene, p-xylene, and o-xylene. When used in the treatment of wastewater containing benzene series, the Rhodococcus etherivorans LH-HF0020 is prepared to have a bacterial content of 1.0 to 1.25×108 After diluting the bacterial solution with a concentration of 100 CFU / ml, the system was inoculated into the coking wastewater system at a ratio of 9%-11%. When the BTEX concentration in the system reached above 1500ppm, a BTEX degradation rate of ≥93.51% was still achieved at a salinity of 3%. The enhanced activated sludge achieved a COD removal rate of ≥95.99% and a total nitrogen degradation rate of ≥96.57%.
[0016] Compared with the prior art, the present invention has the following advantages and technical effects:
[0017] 1. The Rhodococcus etherivorans LH-HF0020 has the ability to use benzene series as the sole carbon source to achieve self-growth while degrading and utilizing benzene series. At a salinity of 3%, it can still achieve a benzene series degradation rate of ≥93.51%, and strengthen activated sludge to achieve a COD removal rate of ≥95.99% and a total nitrogen degradation rate of ≥96.57%.
[0018] 2. The growth salinity (calculated as NaCl) of the Rhodococcus etherivorans LH-HF0020 is in the range of 0-10%, with an optimum NaCl concentration of 1%, and the Rhodococcus etherivorans LH-HF0020 has a relatively wide salinity tolerance.
[0019] 3. The Rhodococcus etherivorans LH-HF0020 described in the present invention is used for the detoxification of benzene series for the first time.
[0020] 4. The Rhodococcus etherivorans LH-HF0020 of the present invention can simultaneously degrade benzene, toluene, ethylbenzene, p-xylene, and o-xylene, especially benzene, toluene, and ethylbenzene.
[0021] 5. The Rhodococcus etherivorans LH-HF0020 described in the present invention has both strong ability to degrade benzene series and the ability to reduce total nitrogen by denitrification, and can be used to remove multiple indicators such as total benzene series, COD, and total nitrogen in sewage and wastewater.
[0022] 6. The Rhodococcus etherivorans LH-HF0020 of the present invention is isolated from coking wastewater and then applied to the detoxification and bioaugmentation treatment of coking wastewater rich in benzene series, thus having a strong in situ adaptation effect.
[0023] 7. The preparation method of the fermentation broth of Rhodococcus etheriferus described in the present invention is simple, reasonable, and quick to operate. It can significantly improve the COD removal, total nitrogen and other effects of the biochemical system without changing the structure. It has strong benzene detoxification ability and high-salt COD removal and total nitrogen degradation effects, and has good prospects for industrial implementation. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 This is the enrichment and acclimation diagram of the dominant BTEX-degrading bacteria;
[0025] Figure 2This is the FPLC spectrum of BTEX degradation by Rhodococcus etherivorans LH-HF0020;
[0026] Figure 3 This is a colony photo of Rhodococcus etherovorans LH-HF0020;
[0027] Figure 4 This is a transmission electron microscope photo of Rhodococcus etherovorans LH-HF0020;
[0028] Figure 5 This is the neighbor-joining phylogenetic tree of Rhodococcus etherivorans LH-HF0020;
[0029] Figure 6 This is the growth-BTEX degradation curve of Rhodococcus etherivorans LH-HF0020;
[0030] Figure 7 The results of the resistance of Rhodococcus etherivorans LH-HF0020 to 8 antibiotics;
[0031] Figure 8 The effect of different conditions on the degradation rate of benzene series by Rhodococcus etheriferus LH-HF0020. DETAILED DESCRIPTION
[0032] The technical solution of the present invention is further described in detail with reference to the following specific examples.
[0033] In the following examples, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.
[0034] The culture medium or test reagent formulas required in the following examples are as follows:
[0035] Mineral salt medium (MSM): K2HPO4·3H2O 1g, KH2PO4 1g, (NH4)2SO4 0.5g, MgSO4·7H2O0.36g, KNO3 0.5g, CaCl2 0.001g, 1mL trace element stock solution, 1000mL distilled water, solid medium plus 1.5% agar.
[0036] Acclimation medium: KH2PO4 338.8 mg, Na2HPO4·12H2O 890.7 mg, (NH4)2SO4 234 mg, Na2CO3 100 mg, MgSO4·7H2O 59.3 mg, CaCl2·2H2O 5.16 mg, FeSO4·7H2O 0.37 mg, 1 mL of trace element stock solution, 1000 mL of distilled water, solid culture medium plus 1.5% agar.
[0037] Trace element mother solution: FeCl2·4H2O 1500 mg, Na2MoO4·2H2O 24 mg, ZnCl2 70 mg, MnCl2·4H2O 6 mg, CoCl2·6H2O 190 mg, MnSO4·7H2O 100 mg, CuCl2·2H2O 2 mg, NiCl2·6H2O 24 mg, distilled water 1000 mL.
[0038] LB medium: peptone 10g, yeast extract 5g, NaCl 10g, distilled water 1000mL,
[0039] Solid medium plus 1.5% agar.
[0040] 10% high salt LB medium: peptone 1g, yeast extract 0.5g, NaCl 50g, distilled water 1000
[0041] mL, solid medium plus 1.5% agar.
[0042] All the above culture media must be sterilized at 116°C for 30 minutes before use.
[0043] Example 1: Screening, Identification and Preservation of Rhodococcus etherivorans LH-HF0020
[0044] 1. Acclimation, isolation and screening of Rhodococcus etherivorans LH-HF0020
[0045] (1) Sample and index determination: The purity of benzene, toluene, ethylbenzene, p- / m-, and o-xylene was ≥98%. Detection instrument: The benzene series detection instrument was a headspace gas chromatograph GC-2010 Plus (Shimadzu, Japan), detector: FID, chromatographic column: Agilent J&W HP-PLOT / Q+PT (30 m × 0.53 mm × 40 μm).
[0046] (2) Sample preparation: Weigh 10 g of soil labeled 6, 7A, 7B, and 7C in Table 1, add them to 100 mL of MSM culture medium, and shake at 30°C and 180 rpm for 4 h. Pipette 5 mL of each of the four bacterial suspensions and the samples labeled 1A aerobic sludge, 2 activated sludge NY, 3 activated sludge S0, 4 activated sludge S1, 5 activated sludge TN, and coking wastewater into 50 mL of MSM culture medium, add 4 μL of a 1:1 volume ratio of benzene series mixture, and incubate in a shaker at 30°C and 180 rpm. The experimental bottles are serum bottles sealed with blue rubber stoppers. The density of benzene series is similar, so the final concentration of each substance is approximately 10 ppm. The obtained bacterial suspension is called the first generation of bacteria.
[0047] (3) Culture and subculture: The first generation of bacteria was sampled regularly to test the concentration of pollutants and injected with 20 mL of air. After feeding the BTEX twice, the second generation of bacteria was subcultured at 10% (v / v) and 4 μL of BTEX was added. The target concentration of each BTEX was 20 ppm. Other procedures were the same as for the first generation of bacteria. Subculture was continued until the third generation, and the concentration of each BTEX pollutant was 30 ppm.
[0048] (4) Isolation and purification: The 10 third-generation bacterial cultures were serially diluted in a test tube to obtain dilutions of 10-1, 10-2, 10-3, 10-4, 10-5, and 10-6. 100 μL of each of the three serial dilutions (10-2, 10-4, and 10-6) was spread onto MSM solid plates containing 30 ppm of each BTEX concentration using a coating rod. Three replicates were made for each dilution. Wrap the plates with breathable sealing film for two weeks and place them in an anaerobic bag. Incubate them upside down in a 30°C incubator. Single colonies with different morphologies were selected from the culture dishes and inoculated into 2 mL of 10% LB medium containing 30 ppm of each BTEX concentration. Culture was continued overnight. The cultures were then streaked onto the plates for further purification. This was repeated three times to obtain pure strains of single morphology. Single colonies from the plates were selected and cultured in 10% LB tubes containing 30 ppm of each BTEX concentration until the exponential phase. The resulting bacterial suspension was then inoculated into MSM supplemented with BTEX and cultured at 30°C and 180 rpm to verify whether each single colony had BTEX degradation capabilities.
[0049] (5) The degradation effects of BTEX in several enrichment cultures are as follows: Figure 1 As shown in the figure, the orange, red, green, blue, and black curves represent benzene, toluene, ethylbenzene, para- / meta-xylene, and o-xylene, respectively. The concentration of each pollutant in the 1st generation of bacteria was gradually increased to 30 ppm in the 3rd generation of bacteria. The degradation rates of BTEX in the 3rd generation of bacteria are shown in Table 1. The degradation rates of benzene, toluene, and ethylbenzene in most of the bacteria cultures (activated sludge NY, S0, TN, PAHs A, and coking wastewater) were all >85%. The degradation rate of para- / meta-xylene in the activated sludge NY, TN, and PAHs contaminated site A bacteria culture was >85%. Only the degradation rate of o-xylene in the coking wastewater bacteria culture exceeded 85%.
[0050] Table 1: Degradation rate of benzene series in the third generation bacterial solution (unit: %)
[0051]
[0052] The enriched solutions of the above 7 samples were diluted in a gradient manner (10 -2 , 10 -4 , 10 -6), picked out 22 single colonies, and there are 2 single bacteria with obvious degradation effects, which are named LH-HF0020 and LH-HF0023 respectively. Under the condition of feeding the total concentration of each benzene series pollutant of about 200-250ppm, the degradation rates of LH-HF0020 and LH-HF0023 after 4 days of cultivation are shown in Table 3. The degradation rate of benzene, toluene and ethylbenzene by LH-HF0020 bacteria reached 100% within 4 days; LH-HF0023 bacteria were isolated from the coking wastewater of a petrochemical base in Yinchuan, and the degradation rate of toluene, ethylbenzene and o-xylene was 100% within 4 days, and the degradation rate of para / m-xylene was 98%. LH-HF0020 bacteria were isolated from the coking activated sludge NY of a chemical base in Xuyang, Hebei. Compared with the comprehensive degradation rate of the five types of benzene series, it is higher, at 89.8%. Its specific degradation data are shown in Table 3, and its degradation FPLC spectrum is shown in Table 3. Figure 2 shown.
[0053] Table 2: Degradation rates of BTEX by pure strains LH-HF0020 and LH-HF0023
[0054]
[0055] Table 3: BTEX degradation results of pure strain LH-HF0020
[0056]
[0057] 2. Morphology and transmission electron microscopy results of Rhodococcus etherivorans LH-HF0020
[0058] The colonies of the strain LH-HF0020 cultured on Lb medium for 24 hours are as follows Figure 3 As shown, it is orange, opaque, round, with neat edges, smooth and moist surface, 0.5mm in diameter, and the bacteria are G + .
[0059] The strain LH-HF0020 was streaked on a 10% LB solid agar medium containing 300ppm of complex benzene series (50ppm each of benzene, toluene, ethylbenzene, p-xylene, m-xylene, and o-xylene) and cultured for 36h. The colonies were then picked, diluted into a suspension by adding ultrapure water, and dropped onto a dry glass slide. A copper mesh with a support membrane was then placed on the liquid beads of the suspension to float and pick up the sample. The excess suspension on the copper mesh was then absorbed with filter paper, and the copper mesh was then floated on the dye drop beads for 1-2 minutes. The dye was finally absorbed with filter paper and then observed using a transmission electron microscope. Under a transmission electron microscope at 6000 times magnification, the LH-HF0020 bacteria were rod-shaped, 1μm×3.2μm, without flagella, as shown in the following example. Figure 4 shown.
[0060] 3. 16S rRNA sequence determination of Rhodococcus etherivorans LH-HF0020
[0061] The DNA of the strain LH-HF0020 was used as a template, and 16S rDNA universal primers were used for amplification and sequence determination. The sequence is shown in SEQ ID No. 1. The 16S universal gene primers are: 27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT. The 16S rDNA sequencing results of the strain LH-HF0020 were entered into the NCBI database for BLAST comparison to obtain related model strains. After preliminary processing of the target sequence and the model strain sequence using ClustalX1.81, MEGA4.0 was used to construct a phylogenetic tree according to the Neighbor-joining method. The results are shown in FIG. Figure 5 As shown, the 16S rRNA gene of strain LH-HF0020 was highly similar to that of Rhodococcus aetherivorans strain DSM44752, so strain LH-HF0020 was identified as Rhodococcus aetherivorans.
[0062] 4. Preservation of Rhodococcus etherivorans LH-HF0020
[0063] The screened strain LH-HF0020 was deposited. The depository unit of the Rhodococcus aetherivorans LH-HF0020 is the General Microbiology Center of the China Culture Collection Administration (CGMCC); address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; deposit date: June 5, 2023; the deposit number of Rhodococcus aetherivorans is: CGMCC No. 27555.
[0064] Example 2: Growth and degradation curve of Rhodococcus etherivorans LH-HF0020
[0065] (1) Preparation of seed solution
[0066] A single colony was picked from the plate and inoculated into 100 mL of 10% LB medium. The culture was cultured at 30°C and 180 rpm until the exponential phase. The cells were centrifuged at 6000 rpm for 5 min, and the cells were collected and washed twice with 15 mL of sterile MM medium. Finally, 5 mL of MSM medium was added to resuspend the cells to obtain seed solution.
[0067] (2) Adjust OD600
[0068] The seed liquid was inoculated into 35 mL of MSM medium, the initial OD600 of the bacteria was adjusted to 0.1, and a BTEX mixture with a final concentration of 400 mg / L was added and cultured at 30°C and 180 rpm. Samples were taken regularly, and samples were taken every 12 hours to detect the BTEX concentration (HJ 1067-2019 Determination of BTEX in Water Quality by Headspace Gas Chromatography) and microbial growth (OD600 detection). When the BTEX degradation was complete, a strain growth-BTEX degradation curve was drawn, as shown in Figure 2. Figure 6 shown.
[0069] Rhodococcus etheriferus LH-HF0020 can tolerate 400ppm of comprehensive benzene series, and degrade 100% of benzene, toluene and ethylbenzene in the system within 35-50h, and degrade ≥82% of para- / meta-xylene and o-xylene within 60-100h; in the first 15h, the growth of Rhodococcus etheriferus LH-HF0020 is in a stagnant period, and in 15h-40h, the strain growth enters the logarithmic growth period, and gradually stabilizes from 45h to 100h, with the highest OD value reaching 0.81, indicating that the strain can make good use of benzene series as carbon and energy sources, and while carrying out its own bacterial proliferation, it also achieves the degradation of toxic substrate benzene series.
[0070] Example 3: Physiology, biochemistry and antibiotic resistance of Rhodococcus etherivorans LH-HF0020
[0071] 1. Physiological and biochemical characteristics of Rhodococcus etherivorans LH-HF0020
[0072] After culturing Rhodococcus etherivorans LH-HF0020 on a modified nutrient agar medium, the physiological and biochemical characteristics of the bacterium were determined according to the physiological and biochemical detection methods in the "Berger's Manual of Bacterial Identification" and the "Handbook of Common Bacterial System Identification". The results are shown in Table 4:
[0073] Table 4. Physiological and biochemical characteristics of Rhodococcus etherivorans LH-HF0020
[0074]
[0075] Note: “+” indicates that the biochemical reaction or Gram staining is positive; “-” indicates that the biochemical reaction or Gram staining is negative.
[0076] Rhodococcus aetherivorans LH-HF0020 can grow and reproduce in temperatures ranging from 20°C to 50°C, with an optimal growth temperature of 30°C. It can grow and reproduce in a pH range of 3.5 to 9.6, with an optimal growth pH of 8. The strain can grow normally in a range of 0% to 10% NaCl, with an optimal growth salinity of 1%, indicating that it has strong salinity tolerance (measured in NaCl). Other physiological and biochemical characteristics of Rhodococcus aetherivorans LH-HF0020 include: aerobicity, lack of flagella, positive indole reaction, positive nitrate reduction test, catalase and oxidase activity, inability to oxidize glucose to produce acid, and the ability to produce acid from a variety of carbohydrates, including inositol, ethanol, ethyl ether, butanediol, sodium acetate, and sodium butyrate.
[0077] 2. Antibiotic resistance of Rhodococcus etherivorans LH-HF0020
[0078] The susceptibility test of the degrading strain to antimicrobial drugs was conducted according to the instructions for use of antibiotic susceptibility paper discs. Each disc contained 10-3030 μg / tablet of antibiotics, including kanamycin (K), erythromycin (E), streptomycin (S), ampicillin (AM), tetracycline (TE), chloramphenicol (C), penicillin (P) and gentamicin (GM). The results are shown in Table 5 and Figure 7 :
[0079] Table 5 Antibiotic resistance results of Rhodococcus etherivorans LH-HF0020
[0080]
[0081] Note: (+ represents that the bacteria are tolerant to the corresponding antibiotics; - represents that the bacteria are not tolerant to the corresponding antibiotics) Figure 7 The results showed that Rhodococcus etherovorans LH-HF0020 was not resistant to any of the eight antibiotics.
[0082] Example 4: Comparison of the comprehensive ability of Rhodococcus etherivorans LH-HF0020 to degrade a series of benzene series under different conditions
[0083] A single colony was picked from the plate and inoculated into 100mL of 10% LB culture medium. The culture was cultured at 30℃ and 180rpm until the exponential phase. The culture was centrifuged at 6000rpm for 5min, and the bacteria were collected. 15ml of sterile MM culture medium was added to wash the bacteria twice, and finally 5mL of MSM culture medium was added to resuspend the bacteria to obtain the seed solution. The seed solution was inoculated into 35mL of MSM culture medium, the initial OD600 of the bacteria was adjusted to 0.1, and a benzene series mixture with a final concentration of 400-450mg / L was added. The shaking speed was 180rpm and cultured for 48h. The final concentration of benzene series was detected (gas chromatography) to obtain the degradation rate of benzene series. The first batch of experiments explored the effects of factors such as temperature at 20℃, 25℃, 30℃, 35℃, 40℃, and 47℃; pH at 5, 6, 7, 8, and 9; and inoculation size at 1%, 3%, 5%, 8%, and 10% on the degradation rate of benzene series. The results are as follows. Figure 8 .A (temperature) shows that 30℃ is the most suitable temperature for the degradation of benzene series by Rhodococcus etheriferus LH-HF0020. 8.B (pH) shows that when the pH is 8, and 8.C (inoculation size) shows that when the inoculation size is 10%, the effect of Rhodococcus etheriferus LH-HF0020 on the degradation of benzene series is stronger, both ≥89.51%.
[0084] At a temperature of 30°C, a pH of 8, and an inoculum size of 10%, the effect of increasing the initial BTEX concentration from 400 to 3000 ppm on the BTEX degradation rate of Rhodococcus etheriferus LH-HF0020 was further investigated. Figure 8 The results showed that under optimal culture conditions, the BTEX degradation rate of Rhodococcus aetherivorans LH-HF0020 reached 96.64% at an initial BTEX concentration of 400 ppm. This rate decreased with increasing initial BTEX concentration. When the initial BTEX concentration was ≤2000 ppm, the BTEX degradation rate of Rhodococcus aetherivorans LH-HF0020 was ≥88.15%. At an initial BTEX concentration of 3000 ppm, the BTEX degradation rate reached 84.36%.
[0085] To further investigate the effect of system salinity on the degradation of BTEX by Rhodococcus etheriferus LH-HF0020, NaCl was added to the MSM medium with salinity (calculated as NaCl) ranging from 1% to 10%, and the initial BTEX concentration was increased to 2000 ppm to investigate the effect of different salinities on the degradation rate of high-concentration BTEX. Figure 8The results showed that the degradation rate of high-concentration BTEX by Rhodococcus aetherivorans LH-HF0020 gradually decreased with increasing salinity. The overall trend was that when salinity (as NaCl) was ≤1%, the BTEX degradation rate remained essentially unchanged. At salinity (as NaCl) ≤3%, the BTEX degradation rate by Rhodococcus aetherivorans LH-HF0020 was ≥86.93%. At salinity (as NaCl) ≤5%, the BTEX degradation rate by Rhodococcus aetherivorans LH-HF0020 was ≥85.74%. At salinity (as NaCl) ≤9%, the BTEX degradation rate by Rhodococcus aetherivorans LH-HF0020 was ≥62.52%. This experiment demonstrates that Rhodococcus aetherivorans LH-HF0020 has strong salinity tolerance and can achieve over 85% degradation of high-concentration BTEX at salinity (as NaCl) ≤5%.
[0086] Example 5: Test on the detoxification of coking wastewater containing benzene series by Rhodococcus etherivorans LH-HF0020 at different salinities
[0087] Rhodococcus etherivorans LH-HF0020 preserved in 10% high-salt LB medium was inoculated into 10% LB medium and cultured at 30°C and 180 rpm until the exponential phase. The bacterial content of the fermentation liquid was not less than 250×10 8 CFU / ml. After Rhodococcus etherivorans LH-HF0020 was diluted 200-250 times with blank fermentation medium, the bacterial count was 1.0-1.25×10 8CFU / ml of diluted bacterial solution. Shougang coking wastewater rich in benzene series was used as experimental water for dilution, with an initial benzene series content of 1499.06~21500.38ppm, COD 4998.61~5002.15ppm, and total nitrogen 399.89~400.17ppm; NaCl was then added to prepare different salinities of 1%~5% (in terms of NaCl). The benzene series-rich coking wastewater with gradient salinity was used as the research object of this experiment, and a 250ml sealed blue-mouth bottle was used as the experimental system. The activated sludge from the aerobic O tank of the coking wastewater was used as the experimental sludge, with a sludge concentration of 6852ppm. After washing twice with distilled water, the experimental wastewater was resuspended in equal amounts for later use. The control group added only activated sludge, with a sludge dosage of 3 ml / group. The experimental group added an equal amount of activated sludge and also added Rhodococcus etherivorans LH-HF0020 at a ratio of 0.9%-1.1%. The reaction conditions were 180 rpm / min, 30°C, initial pH = 8, and 48 h. The final concentration of benzene series was determined using HJ 1067-2019, the COD content of the system was determined using the dichromate method (HJ 828-2017) for chemical oxygen demand, and the total nitrogen content was determined using the alkaline potassium persulfate digestion UV spectrophotometry method (HJ636-2012) for total nitrogen. The ability of Rhodococcus etherivorans LH-HF0020 to degrade benzene series, system COD, and total nitrogen in the enhanced sludge at different salinities was investigated. The results are shown in Table 6:
[0088] Table 6 The ability of Rhodococcus etheriferus LH-HF0020 to enhance the sludge degradation of benzene series, system COD and total nitrogen at different salinities
[0089]
[0090] As shown in Table 6, when the treatment salinity gradually increased from 1% to 5%, the effluent BTEX content of the sludge-only control group gradually increased, while the COD and total nitrogen removal rates also gradually decreased. This indicates that in a high-salinity environment, the activated sludge, already under BTEX toxicity stress, has a poorer ability to remove COD and total nitrogen, with removal rates for both pollutants being ≤78.61% and ≤81.29%, respectively. In contrast, the Rhodococcus etherivorans LH-HF0020 strain described in the present invention can degrade high-concentration BTEX and has strong salinity tolerance. When the treatment salinity gradually increased from 1% to 5%, its BTEX degradation rate for coking wastewater containing high BTEX concentrations remained ≥91.83%, its COD removal rate remained ≥96.09%, and its strong denitrification activity enabled the activated sludge to achieve ≥96.58% total nitrogen removal. Compared to the activated sludge-only control group, bioaugmentation increased COD removal by 17.87%-32.27%, and total nitrogen removal by 15.64%-28.23%. The higher the salinity, the more pronounced the biodetoxification enhancement. This suggests that Rhodococcus etheriferus LH-HF0020 has strong high-salinity tolerance, can degrade benzene series, and promotes COD and total nitrogen removal in the system. Its technical performance is superior to existing technologies.
[0091] Example 6: Bioaugmentation treatment of benzene-containing coking wastewater by Rhodococcus etherivorans LH-HF0020 at 3% salinity
[0092] Rhodococcus etherivorans LH-HF0020 preserved in 10% high-salt LB medium was inoculated into 10% LB medium and cultured at 30°C and 180 rpm until the exponential phase. The bacterial content of the fermentation liquid was not less than 250×10 8 CFU / ml. After Rhodococcus etherivorans LH-HF0020 was diluted 200-250 times with blank fermentation medium, the bacterial count was 1-1.25×10 8CFU / ml of diluted bacterial solution. Experimental water was diluted with Shougang coking wastewater rich in benzene series, with an initial benzene series content of 1499.72-3000.65ppm, COD of 4999.65-10000.63ppm, and total nitrogen of 399.97-800.17ppm. NaCl was then added to achieve a salinity of 3%. This experiment used coking wastewater rich in benzene series concentrations ranging from 2000-4000ppm, with 250ml sealed blue-mouth bottles as the experimental system. Activated sludge from the aerobic O2 tank of this coking wastewater was used as the experimental sludge, with a sludge concentration of 6852ppm. After washing twice with distilled water, an equal amount of the experimental wastewater was resuspended and set aside. The control group added only activated sludge, with a sludge dosage of 3 ml / group. The experimental group added an equal amount of activated sludge and an additional 0.9%-1.1% dilution of Rhodococcus etherivorans LH-HF0020. The reaction conditions were 180 rpm / min, 30°C, initial pH = 8, and 48 h. The final concentration of benzene series was determined using HJ 1067-2019, the COD content of the system was determined using the dichromate method (HJ 828-2017), and the total nitrogen content was determined using the alkaline potassium persulfate digestion UV spectrophotometry method (HJ636-2012). The ability of Rhodococcus etherivorans LH-HF0020 to degrade benzene series, system COD, and total nitrogen in the enhanced sludge at different salinities was investigated. The results are shown in Table 7.
[0093] Table 7. Bioaugmentation treatment of BTEX-containing coking wastewater by Rhodococcus etherivorans LH-HF0020 at 3% salinity
[0094]
[0095] As can be seen from Table 7, when the BTEX concentration gradually increased from 2000ppm to above 3000ppm, the gradually increasing BTEX toxicity stress and 3% high salt environment conditions severely limited the biochemical removal of COD and total nitrogen degradation effects of the activated sludge. In the control group with only mud, the BTEX degradation rate gradually decreased from 63.57% to 50.06%, the COD removal rate also gradually decreased from 75.24% to 57.44%, and the total nitrogen removal rate also gradually decreased from 78.33% to 62.76%. This shows that the gradually increasing BTEX concentration brought greater toxic stress to the activated sludge, resulting in a more obvious sludge poisoning phenomenon, resulting in COD and total nitrogen removal rates of <80%, seriously affecting the effluent standard. In contrast, the ethereal Rhodococcus LH-HF0020 described in the present invention can exert its salt-tolerant detoxification effect at 5% salinity, achieving better detoxification and strengthening effects. Even when the BTEX concentration gradually increased from 2000 ppm to over 3000 ppm, the BTEX degradation rate in the experimental group was generally ≥91.56%, and the COD and total nitrogen removal rates were both ≥96.01% and ≥96.51%. After bioaugmentation, the COD removal rate increased by 20.77%-38.13%, and the total nitrogen degradation rate increased by 18.18%-33.36%. The bioaugmentation effect was more pronounced at higher BTEX concentrations. This suggests that Rhodococcus etherivorans LH-HF0020, even in a 5% high-salinity environment, can still assist the activated sludge system in removing the increasing BTEX toxicity and restore the biochemical system's ability to degrade organic substrates, thereby improving the system's COD removal rate. It also exerts its strong denitrification effect to promote total nitrogen degradation, making it a functional strain with strong biodetoxification and enhancement technical effects, and its technical results are superior to the existing state of the art.
[0096] Example 7: Experiment on bioaugmentation treatment of high-salt coking wastewater containing benzene series by Rhodococcus etherivorans LH-HF0020
[0097] Initial BTEX content ranged from 1500.20 to 1502.66 ppm, COD from 4499.00 to 4500.82 ppm, and total nitrogen from 368.03 to 372.35 ppm. NaCl was then added to create a 3% salinity coking wastewater for this experiment. Using Bluestar Dongda POP wastewater at various dilution ratios, POP diluted wastewater with gradient BTEX and COD concentrations was prepared for this study. 250ml sealed blue-mouth bottles served as the experimental system. Activated sludge from a coking O tank at a chemical base in Xuyang, Hebei, with a sludge concentration of 7425 mg / L, was washed twice with distilled water and then resuspended in an equal amount of experimental wastewater for later use. The control group only added this activated sludge, with a sludge dosage of 3 ml / group. The experimental group, in addition to the same amount of activated sludge of the same type, also added a 0.9%-1.1% dilution of Rhodococcus etherivorans LH-HF0020 from Example 6. The reaction conditions were 180 rpm / min, 30°C, initial pH = 8, and 48 h. The final concentration of benzene series was determined using the HJ 1067-2019 method, the COD content was determined using the dichromate method (HJ 828-2017) for chemical oxygen demand, and the total nitrogen content was determined using the alkaline potassium persulfate digestion UV spectrophotometry method (HJ 636-2012) for total nitrogen. The ability of Rhodococcus etherivorans LH-HF0020 to biodetoxify and enhance sludge degradation of benzene series, COD, and total nitrogen at 5% salinity was evaluated.
[0098] The results showed that in the control group with only activated sludge, the degradation rate of benzene series was between 63.26-63.39%, the COD removal rate was between 74.68-75.24%, and the total nitrogen degradation rate was between 76.59-76.97%. The sludge showed signs of floating, poor settling, poisoning, and disintegration, indicating that the poisoning was severe and that it was no longer possible to achieve effluent standards. In contrast, in the experimental group with the addition of salt-tolerant Rhodococcus etherivorans LH-HF0020, which has the function of degrading benzene series, the degradation rate of benzene series was between 93.51-93.57%, the COD removal rate was between 95.99-96.15%, and the total nitrogen degradation rate was between 96.57-96.61%, indicating that the sludge was in good condition. From the above comparative tests, it can be seen that the ether-eating Rhodococcus ethereal LH-HF0020, which is salt-tolerant, has the characteristics of benzene detoxification and denitrification, has a strong detoxification and bio-enhancement effect in the treatment of high-salt benzene-containing wastewater, and can assist in COD removal and total nitrogen degradation, which is better than the existing technical level.
[0099] In summary, the Rhodococcus etherivorans LH-HF0020 strain described in the present invention was isolated from activated sludge from a coking plant at a chemical base in Xuyang, Hebei Province, and exhibits strong detoxification capabilities for benzene compounds. It can grow normally in a NaCl range of 0% to 10%, with an optimal growth salinity of 1%, demonstrating strong salinity tolerance (measured in NaCl). Other physiological and biochemical characteristics of Rhodococcus etherivorans LH-HF0020 include: aerobicity, lack of flagella, positive indole reaction, positive nitrate reduction test, catalase and oxidase activity, inability to oxidize glucose to produce acid, and the ability to produce acid from a variety of carbohydrates, including inositol, ethanol, ethyl ether, butanediol, sodium acetate, and sodium butyrate. Rhodococcus etherivorans LH-HF0020 can aid in the degradation of BTEX, COD removal, and total nitrogen degradation in a 3% high-salinity environment. Even at a BTEX concentration exceeding 1500 ppm, it can still achieve a BTEX degradation rate of ≥93.51% at 3% salinity. Furthermore, it can enhance activated sludge to achieve a COD removal rate of ≥95.99% and a total nitrogen degradation rate of ≥96.57%. Multiple tests have demonstrated the bacterium's strong BTEX detoxification capabilities and its ability to maintain its biological detoxification and enhancement effects at higher salinities, assisting in the removal of COD and total nitrogen from coking wastewater systems.
[0100] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.
Claims
1. A method for degrading benzene series by using Rhodococcus etheriferus ( Rhodococcus aetherivorans ) LH-HF0020, characterized in that, Its deposit number is CGMCC No. 27555.
2. A fermentation culture method of Rhodococcus etherovorans LH-HF0020 according to claim 1, characterized in that: Pick a single colony from the plate and inoculate it into 100 mL of 10% LB medium. Cultivate at 30°C and 180 rpm until the exponential phase. Centrifuge at 6000 rpm for 5 min to collect the bacteria. Add 15 mL of sterile MM medium to wash the bacteria twice. Finally, resuspend in 5 mL of MSM medium to obtain seed solution. The seed liquid was inoculated into 35 mL of MSM medium, the initial OD600 of the bacteria was adjusted to 0.1, and a final concentration of 400-450 mg / L of benzene series was added. The culture was carried out at a shaking speed of 180 rpm for 48 h.
3. The fermentation and culture method of Rhodococcus etherivorans LH-HF0020 according to claim 2, characterized in that: The benzene series is selected from a mixture of one or more of benzene, toluene, ethylbenzene, p-m-xylene and o-xylene.
4. A biological detoxifying agent comprising the Rhodococcus etherivorans LH-HF0020 according to claim 1, characterized in that: The bacterial agent was prepared by the following method: after activating Rhodococcus etherivorans LH-HF0020 in LB medium, the culture was inoculated into 100 mL of 10% LB medium and cultured at 30°C and 180 rpm until the exponential phase, the culture was centrifuged at 6000 rpm for 5 minutes, the cells were collected, washed twice with 15 mL of sterile MM medium, and finally resuspended in 5 mL of MSM medium to obtain a seed solution; The seed liquid was inoculated into 35 mL of MSM culture medium, the initial OD600 of the bacteria was adjusted to 0.1, and a final concentration of 400-450 mg / L of benzene series was added. The culture was carried out under the condition of a shaker speed of 180 rpm for 48 hours to obtain the biological detoxification agent of Rhodococcus etherevus LH-HF0020.
5. The use of Rhodococcus etherovorans LH-HF0020 according to claim 1, characterized in that The application is to use Rhodococcus etherivorans LH-HF0020 or its fermentation culture liquid in the preparation of a biological detoxifying agent for removing the toxicity of benzene series.
6. The use according to claim 5, characterized in that The benzene series is selected from one or more of benzene, toluene, ethylbenzene, p-m-xylene and o-xylene.
7. The use according to claim 5, characterized in that Rhodococcus etherivorans LH-HF0020 has the ability to achieve self-proliferation with benzene series as the sole carbon source while degrading and utilizing benzene series. In the MSM inorganic salt medium with benzene series as the sole carbon source, the culture temperature is 30°C, the pH is 8, and the inoculation amount is 1%.
8. The use according to claim 5, characterized in that When used, the Rhodococcus etherivorans LH-HF0020 is prepared into a bacterial content of 1.0-1.25×10 8 After diluting the bacterial solution with a CFU / ml, it was inoculated into the coking wastewater system at a ratio of 0.9-1.1%.
Citation Information
Patent Citations
Composite biological detoxification strengthening microbial inoculum as well as preparation method and application thereof
CN117004599A