Pepper leaf color molecular marker and application thereof in detecting pepper leaf color

By designing primer pairs and using enzyme digestion technology to detect pepper genomic DNA, the problem of identifying pepper cotyledon color in pepper breeding was solved, achieving efficient detection of pepper cotyledon color and control of F1 hybrid seed purity.

CN116926231BActive Publication Date: 2026-06-05CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2023-08-21
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

There is a lack of effective methods in the current technology to detect the color of pepper cotyledons, especially for the purity control of F1 hybrid seeds in pepper breeding.

Method used

This study provides a molecular marker for the color of pepper cotyledons. By designing specific primer pairs (dCAPs-BsmAI-F and dCAPs-BsmAI-R) and the restriction endonuclease BsmAI, combined with PCR amplification and enzyme digestion techniques, a specific nucleotide site (position 123 of SEQ ID No. 1) in the pepper genomic DNA is detected to determine the color of pepper cotyledons.

Benefits of technology

It enables accurate identification of the color of pepper cotyledons, improves the purity control of F1 hybrid seeds in pepper breeding, and the test results are consistent with the actual cotyledon color at a rate of 98.11%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004404262760000051
    Figure BDA0004404262760000051
  • Figure BDA0004404262760000061
    Figure BDA0004404262760000061
  • Figure HDA0004404262770000011
    Figure HDA0004404262770000011
Patent Text Reader

Abstract

The application discloses a pepper cotyledon color molecular marker and application thereof in detecting pepper cotyledon color. The pepper cotyledon color molecular marker disclosed by the application is a nucleotide corresponding to the 123th nucleotide of SEQ ID No. 1 in the sequence listing in the pepper genome, which is A or G. Experiments prove that in a pepper population of 548 strains, the cotyledon of 147 homozygous peppers with the nucleotide corresponding to the 123th nucleotide of SEQ ID No. 1 in the sequence listing in the genome DNA being A is purple, the cotyledon of 277 heterozygous peppers with the nucleotide corresponding to the 123th nucleotide of SEQ ID No. 1 in the sequence listing being A and G is purple, and the cotyledon of 124 homozygous peppers with the nucleotide corresponding to the 123th nucleotide of SEQ ID No. 1 in the sequence listing being G is green. It is shown that the pepper cotyledon color molecular marker of the application can be used for identifying pepper cotyledon color and hybrid breeding of peppers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to molecular markers for the color of pepper cotyledons and their application in detecting the color of pepper cotyledons. Background Technology

[0002] Chili pepper (Capsicum annuum L.) belongs to the genus Capsicum in the family Solanaceae. It is an important vegetable crop widely cultivated around the world and is also the vegetable crop with the largest planting area and highest output value in my country.

[0003] Most current research on anthocyanins in chili peppers focuses on materials with purple fruits. Virus-induced gene silencing (VIGS) technology silences CaMYB, leading to downregulation of structural genes and reduced anthocyanin content in purple leaves and immature fruits. The gene encoding the R2R3-MYB transcription factor CaMYBA, located on chromosome 10, promotes anthocyanin biosynthesis in purple flowers, leaves, and immature fruits by activating the expression of late-stage structural genes. Ca3GT, located on chromosome 10, promotes the accumulation of anthocyanins in immature fruits, resulting in purple fruit. In purple-leaved and immature-fruited chili peppers, CaMYC and CaMYB can respond to low-temperature signals by upregulating the expression of anthocyanin synthesis structural genes, promoting anthocyanin accumulation. CaHY5, located on chromosome 8, directly regulates anthocyanin biosynthesis and transport, thereby controlling anthocyanin accumulation in the hypocotyl of chili peppers.

[0004] Seedling morphological markers are useful indicators for screening F1 hybrid seeds. Pepper is a versatile global vegetable, and F1 hybrids are highly sought after in the pepper industry. Cotyledon color can serve as a useful marker for identifying F1 hybrid seeds; therefore, developing molecular markers closely linked to purple cotyledons in peppers is of great significance for controlling the purity of hybrid pepper seeds. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to detect the color of chili seed leaves.

[0006] To solve the above-mentioned technical problems, the present invention first provides the application of a molecular marker for the color of chili cotyledons or a substance that detects the molecular marker for the color of chili cotyledons in the detection or auxiliary detection of the color of chili cotyledons;

[0007] The color molecular marker for the cotyledons of the chili pepper is the nucleotide in the chili pepper genome corresponding to position 123 of SEQ ID No. 1 in the sequence listing, which is either A or G.

[0008] In the above applications, the substance for detecting the color molecular marker of the pepper cotyledons may include a primer pair capable of amplifying the DNA fragment shown at position 123 of SEQ ID No. 1 in the sequence listing.

[0009] In the above applications, the primer pair may consist of two single-stranded DNA molecules as shown in SEQ ID No. 3 and 4 of the sequence listing.

[0010] In the above applications, the substance used to detect the color molecular markers of the pepper cotyledons may also include the restriction endonuclease BsmAI.

[0011] Specifically, the substance used to detect the color molecular marker of the pepper cotyledons may consist solely of the primer pair, or it may consist of the primer pair and the restriction endonuclease BsmAI.

[0012] The present invention also provides a method for detecting the color of cotyledons of chili peppers, the method comprising: detecting the nucleotide corresponding to position 123 of SEQ ID No. 1 in the genomic DNA of the chili pepper to be tested; the cotyledons of homozygous chili peppers whose genomic DNA corresponds to nucleotide A at position 123 of SEQ ID No. 1 in the genomic DNA are purple or candidate purple; the cotyledons of heterozygous chili peppers whose genomic DNA corresponds to both A and G at position 123 of SEQ ID No. 1 in the genomic DNA are purple or candidate purple; and the cotyledons of homozygous chili peppers whose genomic DNA corresponds to nucleotide G at position 123 of SEQ ID No. 1 in the genomic DNA are green or candidate green.

[0013] The present invention also provides a method for detecting the cotyledon color of peppers, the method comprising: using the genomic DNA of the pepper to be tested as a template, performing PCR amplification using the primer pair to obtain PCR products; digesting the PCR products with BsmAI to obtain digested products; detecting the size of the digested products; wherein the cotyledon color of the pepper to be tested is purple or a candidate for purple if the digested product is a single DNA fragment of 146 bp; the cotyledon color of the pepper to be tested is purple or a candidate for purple if the digested product is a triple DNA fragment of 146 bp, 115 bp, and 31 bp; and the cotyledon color of the pepper to be tested is green or a candidate for green if the digested product is a double DNA fragment of 115 bp and 31 bp.

[0014] Among them, the 115bp DNA fragment and the 31bp DNA fragment obtained after enzyme digestion are the enzyme digestion products of the PCR product when position 123 of SEQ ID No.1 is G.

[0015] In the above method, the PCR amplification system using the primer pair can be as follows: 1 μl genomic DNA, 2 μl 10× Buffer, 0.8 μl dNTPs, 0.4 μl DNA polymerase, and 0.2 μl each of dCAPs-BsmAI-F and dCAPs-BsmAI-R (all at a concentration of 10 μM in the reaction system), with the total volume brought to 20 μl using ddH2O. The 10× Buffer, dNTPs, and DNA polymerase are all products of Kangwei Century, catalog number CW0690.

[0016] In the above method, the conditions for PCR amplification using the primer pair can be: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min.

[0017] In the above method, the size of the enzyme digestion product can be detected by electrophoresis or by other methods such as sequencing, as long as the size of each DNA fragment of the enzyme digestion product can be detected.

[0018] The substance used to detect the color molecular markers of the pepper cotyledons is also within the scope of protection of this invention.

[0019] The application of the substance that detects the molecular marker of pepper cotyledon color in the preparation of products for detecting or assisting in the detection of pepper cotyledon color is also within the scope of protection of this invention.

[0020] The application of the substance used to detect the color molecular markers of pepper cotyledons in pepper breeding is also within the scope of protection of this invention.

[0021] The application of the molecular markers for cotyledon color in chili pepper breeding is also within the scope of protection of this invention.

[0022] Experiments showed that in a population of 548 chili peppers, the cotyledons of 147 homozygous chili peppers with nucleotide A corresponding to position 123 of SEQ ID No. 1 in the genomic DNA were purple; the cotyledons of 277 heterozygous chili peppers with nucleotides A and G corresponding to position 123 of SEQ ID No. 1 in the genomic DNA were purple; and the cotyledons of 124 homozygous chili peppers with nucleotide G corresponding to position 123 of SEQ ID No. 1 in the genomic DNA were green. This indicates that the chili pepper cotyledon color molecular marker of the present invention can be used to identify chili pepper cotyledon color and for chili pepper hybridization breeding.

[0023] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0024] Figure 1 The amplification results of dCAPs-BsmAI-F and dCAPs-BsmAI-R in the population are shown. Note: A: Cotyledon purple (one band of 146bp enzyme digestion product); B: Cotyledon green (two bands of 115bp and 31bp enzyme digestion product); H: Cotyledon purple (three bands of 146bp, 115bp, and 31bp enzyme digestion product). The 31bp band is not shown in this figure because it is very small.

[0025] Figure 2 The results are for the validation of 53 pepper inbred lines. Note: A: Purple cotyledon parent 17C1288; B: Green cotyledon parent 17C1279; 1-53: 53 inbred line materials. Detailed Implementation

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are all commercially available. All quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0027] Example 1: Obtaining molecular markers for color in pepper cotyledons

[0028] 1. Construction of segregated populations

[0029] In this embodiment, the self-pollinated second-generation F2 population of pepper with purple cotyledons 17C1288 and green cotyledons 17C1279 was used as the experimental material. The size of the F2 population was 548 plants. The cotyledon color of each plant was counted. In the F2 population, there were 424 plants with purple cotyledons and 124 plants with green cotyledons.

[0030] Both the purple cotyledon parent 17C1288 and the green cotyledon parent 17C1279 of pepper are described in the following literature: Wu, L., Wang, P., Wang, Y., Cheng, Q., Lu, Q., Liu, J., Li, T., Ai, Y., Yang, W., Sun, L., & Shen, H. (2019). Genome-Wide Correlation of 36 Agronomic Traits in the 287 Pepper (Capsicum) Accessions Obtained from the SLAF-seq-Based GWAS. International Journal of Molecular Sciences, 20(22), 5675.

[0031] 2. Obtaining molecular markers

[0032] After obtaining the initial localization region through initial localization, the inventors obtained molecular markers related to the cotyledon color of peppers based on the parental resequencing results, denoted as pepper cotyledon color molecular markers. Pepper cotyledon color molecular markers exist in two forms in peppers: either A or G at position 123 of SEQ ID No. 1 in the pepper genomic DNA sequence.

[0033] Primers for amplifying dCAPS containing the color marker of pepper cotyledons were designed based on this molecular marker. The primers are as follows:

[0034] dCAPs-BsmAI-F:TCTAGGCAACAGATGGTCACTTA (SEQ ID No. 3);

[0035] dCAPs-BsmAI-R:TCTTGAGGGCAGTATTGTACTGT (SEQ ID No. 4, underlined is the introduced mutation site).

[0036] 3. Correlation analysis between molecular markers and cotyledon color

[0037] Genomic DNA was extracted from 548 strains of the F2 population and amplified by PCR using dCAPs-BsmAI-F and dCAPs-BsmAI-R, respectively.

[0038] PCR amplification system: 1 μl genomic DNA, 2 μl 10× Buffer, 0.8 μl dNTPs, 0.4 μl DNA polymerase, and 0.2 μl each of dCAPs-BsmAI-F and dCAPs-BsmAI-R (all at 10 μM). The total volume was brought to 20 μl with ddH2O. The 10× Buffer, dNTPs, and DNA polymerase were all products of Kangwei Century, catalog number CW0690.

[0039] PCR amplification conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min.

[0040] The obtained PCR amplification product was digested with the restriction endonuclease BsmAI. The digestion system was as follows: 5 μl PCR amplification product, 0.2 μl BsmAI, and 1.5 μl CutSmart Buffer. Both CutSmart Buffer and BsmAI were NEBiolabs products, catalog number #R0529V.

[0041] The enzyme digestion system was digested at 55°C for 2 hours.

[0042] The obtained enzyme digestion products were subjected to 7% non-denaturing polyacrylamide gel electrophoresis, stained with silver nitrate, and then observed and photographed. Figure 1 The results showed three band patterns: one band of 146 bp, two bands of 115 bp and 31 bp, and three bands of 146 bp, 115 bp, and 31 bp. Sequencing of the PCR products before enzyme digestion revealed that the 146 bp band had the same pre-digestion sequence as SEQ ID No. 1, the 115 bp and 31 bp bands had the same pre-digestion sequence as SEQ ID No. 2, and the 146 bp band had two pre-digestion sequences, namely SEQ ID No. 1 and SEQ ID No. 2.

[0043] Analysis of the relationship between pepper cotyledon color and enzyme digestion products showed that peppers with a single band of 146 bp enzyme digestion product had purple cotyledons; peppers with two bands of 115 bp and 31 bp enzyme digestion products had green cotyledons; and peppers with three bands of 146 bp, 115 bp, and 31 bp enzyme digestion products had purple cotyledons. In the F2 population, 147 pepper plants had a single band of 146 bp enzyme digestion product and purple cotyledons, 124 pepper plants had two bands of 115 bp and 31 bp enzyme digestion products and green cotyledons, and 277 pepper plants had three bands of 146 bp, 115 bp, and 31 bp enzyme digestion products and purple cotyledons. The pepper cotyledon color molecular marker of this invention co-segregated with cotyledon color, with a phenotypic concordance rate of 100%. This indicates that the pepper cotyledon color molecular marker of this invention can be used to identify pepper cotyledon color and for pepper hybridization breeding.

[0044] Specifically, the method for identifying the cotyledon color of peppers based on molecular markers of cotyledon color is as follows: PCR amplification of the genomic DNA of the pepper sample is performed using dCAPs-BsmAI-F and dCAPs-BsmAI-R. The resulting PCR amplification is digested with the restriction endonuclease BsmAI, and the size of the digestion products is detected. Peppers with a single 146 bp band have purple cotyledons; peppers with two bands (115 bp and 31 bp) have green cotyledons; and peppers with three bands (146 bp, 115 bp, and 31 bp) have purple cotyledons.

[0045] Example 2: Application of color molecular markers in pepper cotyledons

[0046] 1. Experimental Materials

[0047] In this embodiment, 45 green cotyledon pepper inbred lines and 8 purple cotyledon pepper inbred lines were used to verify the pepper cotyledon color molecular markers of Example 1.

[0048] Table 1. Phenotypes of 53 chili inbred lines and molecular markers for cotyledon color.

[0049]

[0050]

[0051] In Table 1, H represents three bands of enzyme digestion products of 146bp, 115bp, and 31bp, A represents one band of enzyme digestion product of 146bp, and B represents two bands of enzyme digestion products of 115bp and 31bp.

[0052] 2. Experimental Methods

[0053] Following the method in step 3 of Example 1, the genomic DNA of the above experimental materials was detected using primer pairs composed of dCAPs-BsmAI-F and dCAPs-BsmAI-R. The PCR amplification system and procedure, and the enzyme digestion system and conditions were the same as in Example 1.

[0054] The obtained enzyme digestion products were subjected to 7% non-denaturing polyacrylamide gel electrophoresis, stained with silver nitrate, and observed and photographed.

[0055] 3. Experimental Results

[0056] The results showed that the consistency between the cotyledon color of the 53 inbred lines and the molecular markers for pepper cotyledon color identification was 98.11%. Figure 2 This indicates that the molecular marker for pepper cotyledon color of the present invention has strong applicability and can be used to identify pepper cotyledon color, and can further be used for pepper hybridization breeding.

[0057] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Application of molecular markers for pepper cotyledon color or substances that detect the molecular markers for pepper cotyledon color in the detection of pepper cotyledon color; The color molecular marker for the cotyledons of the chili pepper is the nucleotide in the chili pepper genome corresponding to position 123 of SEQ ID No. 1 in the sequence listing, which is either A or G.

2. The application according to claim 1, characterized in that: The substance used to detect the color molecular marker of the pepper cotyledons includes a primer pair capable of amplifying the DNA fragment shown at position 123 of SEQ ID No. 1 in the sequence listing.

3. The application according to claim 2, characterized in that: The primer pair consists of two single-stranded DNA molecules as shown in SEQ ID No. 3 and 4 in the sequence listing.

4. The application according to any one of claims 1-3, characterized in that: The substance used to detect the color molecular markers of the pepper cotyledons also includes the restriction endonuclease BsmAⅠ.

5. Methods for detecting the color of chili pepper cotyledons include: The cotyledons of chili peppers homozygous for nucleotide A corresponding to position 123 of SEQ ID No. 1 in the genomic DNA of the tested chili peppers are purple. The cotyledons of chili peppers heterozygous for nucleotides A and G corresponding to position 123 of SEQ ID No. 1 in the genomic DNA of the tested chili peppers are purple. The cotyledons of chili peppers homozygous for nucleotide G corresponding to position 123 of SEQ ID No. 1 in the genomic DNA of the tested chili peppers are green.

6. Methods for detecting the color of chili pepper cotyledons include: Using the genomic DNA of the pepper to be tested as a template, PCR amplification was performed using the primer pair described in claim 3 to obtain the PCR product; The PCR product was digested with BsmAⅠ enzyme to obtain the digested product. The size of the digested product was detected. The cotyledons of the pepper sample containing a single DNA fragment of 146 bp were purple. The cotyledons of the pepper sample containing three DNA fragments of 146 bp, 115 bp, and 31 bp were purple. The cotyledons of the pepper sample containing two DNA fragments of 115 bp and 31 bp were green.

7. The use of the substance for detecting the molecular marker of pepper cotyledon color as described in any one of claims 1-4 in the preparation of a product for detecting pepper cotyledon color.