A method for inhibiting Zika virus and its application

Abstract

This invention relates to the field of pharmaceutical technology, disclosing a method for inhibiting Zika virus and its application. The invention identifies CD104 as the binding receptor for Zika virus and demonstrates that CD104 participates in Zika virus invasion of host cells, assisting in the virus's entry into host cells. Therefore, CD104 can provide a new and important target for the development of drugs that inhibit Zika virus invasion. Thus, this invention provides the application of a specific inhibitor of the Zika virus receptor CD104 protein in the preparation of drugs for the prevention or treatment of diseases caused by Zika virus infection.

Description

Technical Field

[0001] This invention relates to the field of medical technology, specifically to a method for inhibiting Zika virus and its application. Background Technology

[0002] Zika virus (ZIKV) was first discovered in 1947 in rhesus monkeys in the Zika jungle of Uganda through the yellow fever surveillance network. Currently, there are no specific drugs or vaccines against ZIKV. Considering the transmission characteristics and harmfulness of ZIKV, we must be fully prepared for a potential ZIKV pandemic. Therefore, it is urgent to develop new and effective methods and means to prevent or treat ZIKV infection.

[0003] The greatest danger of Zika virus (ZIKV) lies in its ability to cause microcephaly in newborns. Evidence suggests that ZIKV can cross the blood-placental barrier and infect the fetus, with higher Zika virus copy numbers in the cerebrospinal fluid of infected fetuses compared to adult serum. Besides causing microcephaly, ZIKV can also attack the central nervous system, leading to Guillain-Barré syndrome (GBS). ZIKV can also cross the blood-testis barrier and infect testicular tissue, and the virus can persist in the semen of infected individuals for more than eight months. Because ZIKV is sexually transmitted, its persistent presence in testicular tissue poses a significant challenge to its control.

[0004] The interaction between ZIKV and its host cell receptor plays a crucial role in the virus's ability to effectively infect host cells. The host cell receptor for ZIKV has remained unidentified. Some studies, based on the way flaviviruses invade the host, hypothesize that after binding to the receptor, ZIKV primarily enters host cells via endocytosis. Within the endosome, as the pH decreases, its E-enveloping protein undergoes a conformational change, exposing a fusion peptide and leading to membrane fusion. Reports indicate that members of the TAM protein family, such as AXL and Tyro3, ​​as well as molecules like DC-SIGN and TIM-1, are involved in ZIKV invasion. In nerve cells, the distribution and expression levels of AXL are correlated with ZIKV infectivity, suggesting it might be the cellular receptor for ZIKV. However, the hypothesis that ZIKV uses AXL as its cellular receptor contradicts its differences from DENV in terms of pathogenicity and tissue tropism. Even after knocking out the AXL gene in neural progenitor cells, ZIKV can still effectively infect cells. Furthermore, the application of AXL antibodies cannot completely inhibit ZIKV infection, and the TAM protein is not essential for ZIKV infection. Our study found that ZIKV cannot effectively infect some cell lines with high AXL expression, while some cells without AXL expression can still be infected by ZIKV, indicating that AXL is likely not a functional cellular receptor for ZIKV. Research shows that the AXL molecule affects ZIKV replication by regulating the interferon pathway, rather than acting as a receptor. In summary, the specific cellular receptors used by ZIKV, how it invades host cells, and the mode and mechanism of invasion remain unclear. Since answering these scientific questions is crucial for further understanding the ZIKV invasion mechanism and developing more effective antiviral drugs, research on these issues will remain a hot topic in the field of ZIKV research. Summary of the Invention

[0005] This invention utilizes TAP purification and mass spectrometry to identify that ZIKV can bind to CD104, and subsequently verifies the interaction between ZIKV-E and CD104. Through recombinant protein inhibition experiments and CD104 knockout cell lines, it was demonstrated that CD104 is involved in ZIKV invasion of host cells and is a receptor for ZIKV, thus completing this invention.

[0006] The study showed that: (1) CD104 molecules can effectively bind to the E envelope protein of ZIKV. (2) In vitro recombinant expression of CD104 can effectively inhibit ZIKV infection of Vero, LLC-MK2, HeLa, Hu7, hNPC, and 293T cells transfected with CD104 (MOI=0.5). Moreover, this inhibitory effect is concentration-dependent, and the inhibitory effect is significantly enhanced with the increase of CD104 protein concentration. (3) Using CRISP-Cas9 technology, sgRNA targeting CD104 was designed and constructed into a retroviral vector. The stable cell line A549 with CD104 KO was screened to verify the effect of CD104 on ZIKV viral replication. The results showed that ZIKV replication was significantly reduced in CD104 KO cells.

[0007] This invention provides the application of a specific inhibitor of the Zika virus receptor CD104 protein in the preparation of drugs for the prevention or treatment of diseases caused by Zika virus infection.

[0008] Specifically, the diseases caused by Zika virus infection are selected from neonatal microcephaly and Guillain-Barré syndrome.

[0009] Preferably, the specific inhibitor of CD104 protein is an inhibitor that reduces the mRNA level of CD104 protein, the level of CD104 protein, and the function of CD104 protein.

[0010] More preferably, the specific inhibitor of the CD104 protein is a specific antibody against the CD104 protein.

[0011] In particular, the specific inhibitor of the CD104 protein is a monoclonal antibody. More specifically, the monoclonal antibody is a murine antibody or a humanized antibody.

[0012] Preferably, the specific inhibitor of the CD104 protein is a nucleic acid molecule that targets the CD104 protein gene for gene editing, and further includes reagents for gene editing operations.

[0013] Specifically, the target DNA for gene editing is the extracellular region of the CD104 protein gene (28-710 amino acids).

[0014] More specifically, the nucleotide sequence targeting the DNA is the 3-12bp region of the CD104 protein gene, and more specifically, its nucleotide sequence is ggca gggccacgc.

[0015] The sgRNA sequence designed for the target DNA is GTGGCAGTGGTCTCGCCGTG or

[0016] GAAGAGAGCTCGTAAATGCA.

[0017] This invention identifies CD104 as a binding receptor for ZIKV and demonstrates that CD104 participates in ZIKV invasion of host cells, assisting ZIKV in this process. This provides a new and important target for the development of ZIKV invasion-inhibiting drugs. Based on the characteristics of the binding mechanism between ZIKV and its receptor, highly efficient and specific ZIKV-inhibiting peptides or antibodies can be developed. Attached Figure Description

[0018] Figure 1 Image of ZIKV-E protein molecular sieve purification and SDS-PAGE electrophoresis results.

[0019] Figure 2 Immunoprecipitation of ZIKV-E with Hun-7 cells (a) and peptides obtained by mass spectrometry analysis (b).

[0020] Figure 3 Results of molecular sieve purification of CD104 and SDS-PAGE electrophoresis identification.

[0021] Figure 4 Biacore was used to detect the binding of CD104 to the E protein.

[0022] Figure 5 CD104 molecules inhibit ZIKV infection in a variety of sensitive cell lines.

[0023] Figure 6 Detection of the infection effect of ZIKV in CD104 KO cell line. Detailed Implementation

[0024] The present invention will be further described below through specific embodiments in order to provide a better understanding of the present invention, but this does not constitute a limitation thereof.

[0025] Materials used in the embodiments

[0026] 1. Laboratory animals, cells, plasmids

[0027] Female BALB / c mice (6-8 weeks) (Vitalliwa).

[0028] Vero, LLC-MK2, HeLa, Hun7, HEK 293T, A594, Vero, and DH10Bac cell lines were all preserved in our laboratory. DH5α competent cells (Beijing Bomaide Biotechnology Co., Ltd.)

[0029] pET21a and pFastBac1 are preserved in this laboratory.

[0030] 2. Experimental reagents and consumables

[0031] Protein-G affinity chromatography column (GE), HRP-labeled goat anti-mouse IgG (Thermo), TMB (Solepro), penicillin antibody (Gibico), serum (Gibico-148), serum (Sigma), PEG (Sigma), mouse monoclonal antibody Ig class / subclass identification reagent (Bio-Lon), DMEM medium (Kccell), viral RNA extraction kit (Tiangen), RevertAid First Strand cDNA Synthesis Kit (Thermo), plasmid miniprep kit (Tiangen), Easysee Western Blot Kit (TransGold), SDS-PAGE sample buffer (Sangon Biotech), DMSO (Innovent).

[0032] T25 cell culture flasks (CORNING), PVDF membranes (Millipore), cell cryopreservation tubes (CORNING), 20mL and 50mL sterile centrifuge tubes (CORNING), 6, 24, and 96-well cell culture plates (COSTAR). Ni column (Qiagen), Hiload 16 / 60 Superdex 200GL (GE).

[0033] 3. Solution preparation

[0034] Washing buffer: 50mM Tris-HCl (pH 8.0), 300mM NaCl, 10mM EDTA, 10mM DTT, 0.5% Triton X-100.

[0035] Resuspension buffer: 50mM Tris-HCl (pH 8.0), 100mM NaCl, 10mM EDTA, 10mDTT, 0.5% Triton X-100.

[0036] Dissolution buffer: 8M Urea, 50mM Tris-HCl (pH 8.0), 100mM NaCl, 10mMEDTA.

[0037] Refolding buffer: 100mM Tris-HCl (pH 8.0), 400mM L-Arg, 2mM EDTA, 5mM / 1mM GSH / GSSG.

[0038] HEPES-EP buffer contains 10 mM HEPES-HCl, 300 mM NaCl, 0.005% Tween-20, and pH 7.4.

[0039] Blocking buffer (5% skim milk powder, ELISA diluent): Weigh 5g of skim milk powder and dissolve it in PBST buffer. Prepare fresh before use and dissolve thoroughly.

[0040] PBS (phosphate buffer): Weigh 8g NaCl, 0.2g KCl, 3.58g Na2HPO4·12H2O, and 0.24g KH2PO4, dissolve them in 800mL ddH2O with concentrated HCl, adjust the pH to 7.4, and bring the volume to 1L.

[0041] PBST: Add 500 μL of Tween 20 to 1 L of PBS and mix well.

[0042] 2% BSA: Weigh 2g of albumin BSA and dissolve it in ddH2O to bring the volume to 100ml.

[0043] Incomplete culture medium: DMEM serum-free medium.

[0044] HAT selective medium solution: Dilute 50×HAT to 1×HAT with DMEM medium containing 20% ​​Sigma serum.

[0045] Cryopreservation solution: 90% Sigma serum, 10% DMSO.

[0046] LB liquid medium: Weigh 10g NaCl, 5g yeast extract, and 10g peptone, dissolve them in 800mL ddH2O, and bring the volume up to 1L.

[0047] LB solid medium: Add 1.5g agar to every 100mL of liquid LB.

[0048] Protein-G purification binding buffer: Weigh out NaH2PO4 4 1.47 g, Na₂HPO₄ 4 Add 1.1 g of 12H2O to a final volume of 1L, adjust the pH to 7.0, and filter.

[0049] Protein-G purification elution buffer: Weigh 7.507g of Glycine, bring the volume to 1L, adjust the pH to 2.7 with concentrated HCl, and filter.

[0050] 1M pH 7.9 Tris-HCl buffer: Weigh 12.11g of Tris-Base, dissolve in ddH2O and bring the volume to 100mL, then adjust the pH to 9.0 with concentrated HCl.

[0051] DMEM cell culture medium: DMEM medium is supplemented with 10% Sigma serum and 1% penicillin antibiotics.

[0052] 10× Transfer Buffer: Weigh 29g of glycine, 58g of Tris-Base, and 3.7g of SDS, dissolve in ddH2O, and bring the volume to 1L.

[0053] 1× Transfer Buffer: Measure 100 mL of 10× transfer buffer, add 200 mL of methanol, and then adjust the volume to 1 L with ddH2O.

[0054] The flow cytometry method used in this embodiment to detect ZIKV infection rate is as follows:

[0055] (1) Digest cells with trypsin, centrifuge at 1000g for 8 minutes at 4℃, wash three times with serum-free DMEM, and then resuspend in serum-free DMEM.

[0056] (2) Pre-cool the cells on ice for 15 minutes, then add 0.1% Triton X100 to permeate the membrane for 10 minutes, followed by centrifugation at 1000g for 8 minutes.

[0057] (3) Add paraformaldehyde to a final concentration of 0.01%, fix at room temperature for 10-15 minutes, and then wash three times with PBS.

[0058] (4) Add PBS containing 5% BSA, resuspend the cells, block at room temperature for two hours, and wash three times with PBS. This study investigated the cryo-electron microscopy structure of adenovirus type 55 and identified the host receptor for Zika virus.

[0059] (5) Dissolve the FITC-labeled Z6 antibody in 1% BSA PBS solution to a final concentration of 1 μg ml-1, add it to the cells and incubate at room temperature for 1 hour, then wash three times with PBS.

[0060] (6) Cells were resuspended in 300 μl PBS solution and analyzed by flow cytometry.

[0061] Example 1: Cloning, expression, isolation and purification of ZIKV envelope protein (ZIKV-E)

[0062] (1) The extracellular segment 1-409aa codon of the Envelope protein of ZIKV SZ_SMGC-1 strain (GeneBank:KU866423) was optimized and cloned into pET21a, and the expression vector pET21a-E was successfully constructed.

[0063] (2) pET21a-E was transformed into expression strain BL21(DE3), and cultured in shake flasks at 37°C until OD was reached. 600When the concentration reaches 0.4–0.6, IPTG is added to a final concentration of 1 mM. The cells are then incubated at 37°C for 4–6 hours, followed by centrifugation at 6000g for 10 minutes to collect the bacterial cells. The cells are resuspended in 50 mL of PBS and thoroughly mixed using a vortex mixer. The small beaker containing the bacterial culture is placed in an ice-water mixture, and the cells are lysed using an ultrasonic homogenizer (4 seconds sonication, 8 seconds pause, 99 cycles, 300 W). After centrifugation at 12000 rpm for 10 minutes, the supernatant is discarded. A large amount of dense white precipitate is observed at the bottom of the centrifuge tube, indicating that the E protein is expressed as inclusion bodies in the prokaryotes.

[0064] (3) The inclusion bodies were washed twice with washing buffer, washed once with resuspension buffer, and finally dissolved in disolve buffer at a concentration of 30 mg / ml.

[0065] (4) Take 2 ml of denatured E protein solution and slowly add it dropwise to 500 mL of renaturation buffer at a rate of about 5 μl per minute. Renaturate for 24-48 hours.

[0066] (5) Concentrate the E protein in the refolding solution to 2 mL.

[0067] (6) The E protein was separated and purified using Superdex 200 molecular sieve. The buffer used was (20mM Tris-HCl, pH 8.0, 150mM NaCl, 10% glycerol).

[0068] Inclusion bodies of ZIKV-E were extracted using the above method, then diluted and refolded. The refolded protein was then purified using a Hiload 16 / 60 Superdex 200GL molecular sieve. Figure 1 When ZIKV-E protein was purified by molecular sieve, the elution peak was located at approximately 16 ml, corresponding to a molecular weight of about 45 kDa. SDS-PAGE electrophoresis showed a ZIKV-E protein band, and the protein size was correct. Therefore, this should be the monomeric elution peak of ZIKV-E.

[0069] Example 2: Immunoprecipitation of ZIKV-E protein with HUN-7 cells

[0070] (1) Wash the Flag beads three times with PBS, then resuspend them with PBS, add ZIKV-E protein to the beads, and incubate at 4°C for 30 minutes.

[0071] (2) Centrifuge at 4°C, discard the supernatant, and add ice-cold cell lysis buffer.

[0072] (3) Add the supernatant of the cell lysate after centrifugation and incubate at 4°C for 2 hours.

[0073] (4) Wash three times with cell lysis buffer to remove non-specific binding proteins.

[0074] (5) Then add 100 μl of 0.2 mg / ml FLAG peptide solution and incubate at 4°C for 5 minutes; after centrifugation, transfer the eluent to a new EP tube and freeze or boil it.

[0075] (6) Centrifuge at 12000g for 2 minutes, then perform SDS-PAGE, followed by couscous or silver staining analysis.

[0076] Following the above method, Flag beads, ZIKV-E, and JEV-E proteins were added to the Flag beads and incubated at 4°C for 30 minutes. Vero E6 cells were then added for lysis and incubated at 4°C for 2 hours. The cells were washed three times with cell lysis buffer to remove non-specifically bound proteins. Then, 80 μl of 0.1 M glycine (pH=3) was added, and the mixture was incubated at 4°C for 5 minutes. After centrifugation, the supernatant was transferred to a new EP tube, and 20 μl of 1 M Tris-HCl (pH=9) was added for neutralization. The sample was then added to 5× loading buffer, boiled in water for 10 minutes, and subjected to SDS-PAGE followed by staining. A specific band was observed near 200 kDa. Mass spectrometry detected four membrane proteins, including CD104 (…). Figure 2 ).

[0077] Example 3: Expression and purification of CD104 in an insect expression system

[0078] (1) The extracellular region 28-710aa of CD104 (NCBI accession number NM_000213) was linked to the vector pFastBac1.

[0079] (2) After the pFastbac1-CD104 plasmid containing the target gene was transformed into the DH10Bac strain, the CD104 gene located on the vector was transposed into the Bacmid of the strain by homologous recombination. The recombinant Bacmid was selected by blue-white screening and resistance screening and extracted. Since the Bacmid contains the modified baculovirus genome, the recombinant Bacmid was used to transfect insect cells to package the recombinant baculovirus containing the target gene. The recombinant baculovirus carrying the foreign gene was used to infect insect cells sf9 and the foreign gene was expressed in insect cells Hi5.

[0080] (3) High Five cells were selected for CD104 protein expression. The cell density was 2.0-2.5 × 10⁶ cells / year. 6 When the cell count is 400 mL, add 50 mL of P4 virus to 400 mL of cells, incubate at 27°C with shaking for 48 h, and then collect the cell supernatant.

[0081] (4) Ni column affinity purification of CD104: CD104 protein was eluted under the conditions of 20 mM Tris-HCl, pH 8.0, 150 mM NaCl, and 100 mM imidazole.

[0082] (5) CD104 was further purified using a Hiload 16 / 60 Superdex 200pg molecular sieve chromatography column. The buffer solution used was 20mM Tris-HCl, pH 8.0, and 150mM NaCl.

[0083] Based on the above method, the extracellular domain of CD104, amino acid positions 1-710, was constructed into the pFasBac1 vector, containing a His tag at the C-terminus, with an estimated molecular weight of 82 kDa. After infecting Hi5 cells with the recombinant virus containing the CD104 gene, the CD104 protein was expressed in a soluble form in the cell supernatant. After filtration, the cell supernatant was passed through a HisTrap column. Due to the His tag, the target protein could bind to Ni ions on the column. After eluting the column with different concentrations of imidazole, the elution peaks were identified by reducing gel electrophoresis. The protein eluted with 10 mM imidazole was not the target protein, while the elution buffer with 150 mM imidazole was CD104. The eluted protein was concentrated and further purified using a Hiload 16 / 60 Superdex 200GL molecular sieve and identified by SDS-PAGE. Figure 3 ).

[0084] Example 4: CD104 and ZIKV-E Affinity Detection

[0085] (1) The CD104 and ZIKV-E proteins were exchanged into HEPES-EP buffer (10 mM HEPES-HCl, 300 mM NaCl, 0.005% Tween-20, pH 7.4) through a molecular sieve chromatography column. Before use, the buffer was filtered through a 0.22 μm filter membrane and degassed by sonication.

[0086] (2) The instrument used in this experiment was a Biacore 8k. The mobile phase protein ZIKV-E was diluted to a concentration of 4 μM and flowed through the chip surface to confirm that there was no non-specific binding.

[0087] (3) The stationary phase protein CD104 is passed through the sensor chip. By analyzing the sensor image, it is determined that CD104 can be coupled to the chip surface. The stationary protein CD104 in this step can be eluted with 0.1M Gly pH=3.0.

[0088] (4) Dilute the mobile phase protein ZIKV-E with buffer to 0.125 μM, 0.25 μM, 0.5 μM, 1 μM, 2 μM, and 4 μM, and flow them through the chip respectively. It is generally necessary to ensure that the final calculated affinity value is in the middle or slightly lower of the concentration gradient. Use KINJECT mode for injection, with a flow rate of 30 μL / min, and both binding and dissociation times are 60 s.

[0089] (5) Use Biacore8k software to analyze dynamic parameters and calculate affinity.

[0090] Using CD104 as the stationary phase, ZIKV-E protein at different concentrations (0.125 μM, 0.25 μM, 0.5 μM, 1 μM, 2 μM, 4 μM) was flowed through it. Kinetic parameters and affinity were analyzed using Biacore 8K software according to the 1:1 Langmuir binding model, yielding the binding constant (ka), dissociation constant (kd), and affinity (K). D (Results are shown in) Figure 4 (and Table 1).

[0091] Table 1

[0092] Combining the constant (ka) Dissociation constant (kd) <![CDATA[Affinity (K D )]]> 1.87E+4 6.28E-3 3.36E-7

[0093] Example 5: CD104 protein molecules inhibit ZIKV infection in its sensitive cell lines

[0094] To demonstrate that CD104 can participate in ZIKV infection, a competitive inhibition experiment was first performed. This involved incubating recombinant CD104 protein with ZIKV virus, followed by infecting host cells with the treated virus, and then detecting replication within the host cells. The procedure was as follows:

[0095] (1) Divide the cells into 6-well plates and culture for 12-24 hours. The cell confluence is about 70%.

[0096] (2) Take a certain amount of ZIKV and incubate it with a certain concentration of CD104 protein molecules at 4℃ for 60 minutes.

[0097] (3) Add the incubated ZIKV to the cells at a certain ratio of PFU and incubate at 4℃ or 37℃ for 2 hours.

[0098] (4) Aspirate the supernatant and wash three times with PBS.

[0099] (5) Cells are directly treated for experimental analysis, or cultured for a specific time for experimental analysis.

[0100] Based on the above method, ZIKV was incubated with different concentrations of recombinant CD104 protein (80, 160, 240 μg / ml) or BSA (240 μg / ml) at 4℃ for 1 hour. Subsequently, Vero-E6, LLC-MK2, HeLa, Hu7, hNPC, and 293T cells transfected with CD104 (MOI = 0.5) were infected at 4℃. After 1 hour, the cells were washed three times with pre-cooled medium, and then cultured in DMEM containing 10% FBS for 24 hours. Flow cytometry was used to detect the replication of ZIKV within the cells. The results showed ( Figure 5 Compared with BSA, recombinant CD104 protein can effectively inhibit ZIKV infection of sensitive cell lines, and this inhibitory effect is concentration-dependent, with the inhibitory effect significantly increasing as the protein concentration increases.

[0101] Example 6: Recombinant CD104 protein molecules effectively inhibit ZIKV replication in KO cell lines.

[0102] Using CRISP-Cas9 technology, sgRNAs targeting CD104 were designed with sequences GTGGCAGTGGTCTCGCCGTG and GAAGAGAGCTCGTAAATGCA. These sgRNAs were then constructed into a retroviral vector, and the stable A549 cell line, which exhibits CD104 knockout, was screened to verify the effect of CD104 on ZIKV viral replication.

[0103] To further verify that CD104 on the cell surface is involved in ZIKV virus infection, ZIKV (MOI = 0.5) virus was incubated at 4°C in CD104 KO cell lines and normal A549 cell lines. After 1 hour of incubation, the cells were washed three times with pre-cooled DMEM and cultured at 37°C for 24 hours. Flow cytometry was used to detect viral replication in the host cells. The results showed that ZIKV virus replication was significantly reduced in CD104 KO cells. Figure 6 This also shows that CD104 is an essential molecule for mediating ZIKV infection of host cells.

Claims

1. The application of a specific inhibitor of the Zika virus receptor CD104 protein in the preparation of drugs for the prevention or treatment of diseases caused by Zika virus infection; The specific inhibitor of the CD104 protein is a nucleic acid molecule sgRNA that targets the CD104 protein gene for gene editing, with the sequence GTGGCAGTGGTCTCGCCGTG or GAAGAGAGCTCGTAAATGCA.

2. The application as described in claim 1, characterized in that, The diseases caused by Zika virus infection are selected from neonatal microcephaly and Guillain-Barré syndrome.

3. The application as described in claim 1, characterized in that, It also includes reagents used for gene editing operations.

Images