Solid support for enzymatic DNA synthesis and methods of making and using the same

Abstract

The embodiment of the present application provides a solid phase carrier for enzymatic DNA synthesis and a preparation method and application thereof. The solid phase carrier comprises a hydrogel skeleton material, a functional material, a crosslinking agent, an additive and an initiation chain; the hydrogel skeleton material comprises an acrylate polymer material; the additive comprises a reinforcing agent, a plasticizer and a photoinitiator; wherein the hydrogel skeleton material accounts for 10-35% of the total mass of each component. Compared with the prior art, the present application has at least one of the following beneficial effects: strong stretching ability, low steric hindrance and high synthesis efficiency.

Description

Technical Field

[0001] This application relates to the field of biotechnology, specifically to a solid-phase carrier for enzymatic DNA synthesis, its preparation method, and its uses. Background Technology

[0002] Enzymatic DNA synthesis is a process based on terminal deoxynucleotidyl transferases. Enzymatic DNA synthesis is a next-generation DNA synthesis technology. Compared to traditional chemical DNA synthesis methods, enzymatic DNA synthesis is more environmentally friendly and has the potential for longer synthesis lengths. Similar to traditional chemical DNA synthesis, the enzymatic DNA synthesis process requires washing away the reaction solution from the previous step to ensure the subsequent reaction can proceed. Therefore, a solid-phase support surface is needed to couple the initiating chain. In the presence of the initiating chain, a base monomer blocking the 3'-OH end is added. Based on the action of terminal deoxynucleotidyl transferase, single-base coupling is achieved and terminated. Then, through the deprotection effect of nitrite, the next base is extended, resulting in free base extension and combination, ultimately completing DNA synthesis. To ensure the operation of the terminal deoxynucleotidyl transferase on the solid-phase support surface and improve coupling efficiency, the solid-phase support needs low reaction steric hindrance and strong spreading ability. However, the existing solid-phase supports have high reaction steric hindrance and poor spreading ability.

[0003] Therefore, the solid-phase carriers currently used for enzymatic DNA synthesis still need improvement. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a solid-phase carrier for enzymatic DNA synthesis, its preparation method, and its applications, thereby resolving the problems mentioned in the background section.

[0005] In one aspect of the present invention, a solid-phase carrier for enzymatic DNA synthesis is provided, the solid-phase carrier comprising a hydrogel framework material, a functional material, a crosslinking agent, an additive, and an initiating chain; the hydrogel framework material comprises an acrylate polymer; the additive comprises a reinforcing agent, a plasticizer, and a photoinitiator; wherein the hydrogel framework material accounts for 10%-35% of the total mass of the components.

[0006] Furthermore, the hydrogel framework material is activated and coupled with the initiation chain.

[0007] Furthermore, the hydrogel framework material includes at least one of methyl acrylate, ethyl acrylate, n-propyl acrylate, n-butyl acrylate, hydroxyethyl methacrylate, polyethylene glycol diacrylate, hydroxypropyl methacrylate, and hydroxybutyl methacrylate.

[0008] Furthermore, the functional material includes compounds containing at least one of epoxy, vinyl, primary amine, mercapto, carbonyl, hydroxyl, and carboxyl groups.

[0009] Furthermore, the functional material includes glycidyl methacrylate.

[0010] Furthermore, the crosslinking agent includes ethylene glycol diacrylate.

[0011] Furthermore, the reinforcing agent includes N-vinylpyrrolidone.

[0012] Furthermore, the plasticizer includes ethylene glycol.

[0013] Furthermore, the photoinitiator includes at least one of 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylphenylacetone and 2-hydroxy-2-methylphenylacetone.

[0014] Furthermore, the hydrogel framework material is activated after surface modification, and the surface modification includes introducing at least one of amino, carboxyl, epoxy, thiol and vinyl groups into the hydrogel framework material.

[0015] Furthermore, the solid support further includes a solvent.

[0016] Furthermore, the solvent includes water.

[0017] Furthermore, in the raw materials forming the solid support, the volume ratio of the hydrogel skeleton material, the functional material, the crosslinking agent, the additive, and the solvent is (3-10):(2-5):(0.1-1):(5-10):(4-8).

[0018] Furthermore, in the raw materials forming the solid support, the volume ratio of the reinforcing agent, the plasticizer and the photoinitiator in the additives is (1-5):(3-6):(0.1-1).

[0019] In another aspect of the present invention, the present invention provides a method for preparing the solid support, the method comprising the following steps: mixing the hydrogel framework material, the functional material, the crosslinking agent, the additive and the solvent and pouring the mixture into a mold, and irradiating it under light conditions to obtain a hydrogel framework; initiating chain coupling of the hydrogel framework to obtain the solid support; wherein the light conditions include UV irradiation; and the light irradiation time includes 8-12 minutes.

[0020] Furthermore, prior to initiating the chain coupling, the surface of the hydrogel framework is modified to obtain a modified hydrogel. The modification process includes treating the surface of the hydrogel framework once or multiple times with a hydrophilic modifying compound.

[0021] Furthermore, the hydrophilic modified compound includes at least one of branched polyethyleneimine, polyglutamic acid, and polyethylene glycol derivatives.

[0022] Furthermore, this method further includes activating the modified hydrogel before performing the initiation chain coupling, wherein the activation treatment includes treating the modified hydrogel with an activating compound. The activating compound includes a carbodiimide carboxyl activator and an NHS-activated lipid intermediate; wherein the carbodiimide carboxyl activator includes at least one of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and dicyclohexylcarbodiimide; and the NHS-activated lipid intermediate includes at least one of N-hydroxythiosuccinimide sodium salt and N-hydroxysuccinimide.

[0023] Further, the initiation chain coupling includes: immersing the activated modified hydrogel in a streptavidin coupling solution overnight, and then immersing it in an initiation chain coupling solution. The solid support is obtained.

[0024] Furthermore, the streptavidin coupling solution includes Streptavidin.

[0025] Further, the initiating chain coupling solution includes Triggering chain.

[0026] Furthermore, the initiating chain includes a 5' biotin-tagged DNA sequence.

[0027] In another aspect, the present invention provides a method for synthesizing DNA using the solid-phase carrier, the method comprising the following steps: cutting the solid-phase carrier and using it for DNA synthesis and deprotection reactions, repeatedly cycling the synthesis and deprotection reactions to synthesize a target sequence; dissociating the solid-phase carrier after the synthesis and deprotection reactions; using the dissociation product obtained from the dissociation reaction as a template for PCR amplification; performing agarose gel electrophoresis on the PCR amplification product, recovering the target electrophoretic band, and sequencing it.

[0028] Further, the synthesis reaction includes: immersing the cut solid support in a DNA enzymatic synthesis reaction solution and reacting at a temperature of 30℃-45℃. The DNA enzymatic synthesis reaction solution includes terminal deoxynucleotidyl transferase, terminal protective base monomer, cobalt chloride, PBS, and water.

[0029] Further, the deprotection reaction includes: removing the solid support that has undergone the synthesis reaction, rinsing it, and then immersing it in the deprotection reaction solution. The solid support is then removed and rinsed; the synthesis reaction and the deprotection reaction are then repeated; wherein the deprotection reaction solution includes sodium nitrite and glacial acetic acid.

[0030] Furthermore, prior to the dissociation reaction, the process further includes: immersing the solid support, after cycling through the synthesis and deprotection reactions, into the PolyA synthesis reaction solution and reacting at a temperature of 30°C-45°C. Initiate the synthesis of a PolyA fragment from the 3' end of the initiation chain; wherein the PolyA synthesis reaction solution comprises terminal deoxynucleotidyl transferase, unprotected dATP monomer, buffer, and water.

[0031] Furthermore, the dissociation reaction comprises: immersing the solid support after the synthesis reaction and the deprotection reaction cycles in pure water, and reacting at a temperature of 80℃-100℃. Dissociation products were obtained.

[0032] The present invention has at least one of the following beneficial effects:

[0033] 1. The solid carrier of the present invention uses hydrogel as the skeleton material, which swells but does not dissolve, and has stronger stretching ability;

[0034] 2. The solid-phase support of the present invention uses hydrogel as the backbone material and grafts functional groups on its surface, which can be used for enzymatic DNA synthesis, effectively reducing the steric hindrance in the enzymatic reaction process and achieving high synthesis efficiency.

[0035] 3. The method for preparing solid-phase support of the present invention is simple to operate, energy-saving and environmentally friendly, and the resulting solid-phase support has strong spreading ability and low steric hindrance.

[0036] 4. The solid-phase support of the present invention can reduce the steric hindrance of the enzymatic reaction process and greatly improve the synthesis efficiency when used for enzymatic DNA synthesis.

[0037] The above overview is for illustrative purposes only and is not intended to be limiting in any way. In addition to the illustrative aspects, embodiments, and features described above, further aspects, embodiments, and features of this application will become readily apparent from the accompanying drawings and the following detailed description. Attached Figure Description

[0038] In the accompanying drawings, unless otherwise specified, the same reference numerals throughout the various drawings denote the same or similar parts or elements. These drawings are not necessarily drawn to scale. It should be understood that these drawings depict only some embodiments disclosed in this application and should not be construed as limiting the scope of this application.

[0039] Figure 1 This is a flowchart of a method for preparing a solid support according to an embodiment of the present invention;

[0040] Figure 2 This is a flowchart of a method for synthesizing DNA using a solid-phase support according to an embodiment of the present invention;

[0041] Figure 3 This refers to the sequencing results of the final target sequence obtained in Example 1 of the present invention;

[0042] Figure 4 This is the sequencing result of the final target sequence obtained in Example 2 of the present invention. Detailed Implementation

[0043] To more clearly understand the technical features, objectives, and beneficial effects of the present invention, the technical solution of the present invention will now be described in further detail. In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of this application. Therefore, the drawings and description are considered exemplary in nature and not restrictive.

[0044] In one aspect of the present invention, a solid support is provided. The solid support comprises a hydrogel framework material, a functional material, a crosslinking agent, and additives; wherein the hydrogel framework material comprises an acrylate polymer; and the additives comprise reinforcing agents, plasticizers, and photoinitiators; wherein the hydrogel framework material accounts for 10%-35% of the total mass of the components in the solid support. The solid support has at least one of the following beneficial effects: strong stretchability, low steric hindrance, and high synthesis efficiency.

[0045] To facilitate understanding, the principle by which this solid support achieves the aforementioned beneficial effects will be briefly explained below:

[0046] Hydrogels are polymer materials with special physicochemical properties. The solid-phase support of this invention uses hydrogel as a framework material, possessing the excellent physicochemical properties of hydrogels. Compared with traditional solid-phase supports, it has the characteristic of swelling without dissolving. This invention obtains functionalized hydrogels by grafting functional groups onto the surface of hydrogels and modifying them, resulting in a solid-phase support with low steric hindrance, strong spreadability, and wide applicability.

[0047] According to embodiments of the present invention, the solid support comprises a hydrogel framework material, a functional material, a crosslinking agent, and an additive, and further comprises a solvent. The type of solvent is not particularly limited and can be water or an inorganic salt solution; in specific embodiments, water is preferred. Furthermore, the proportions of the hydrogel framework material, functional material, crosslinking agent, additive, and solvent in the solid support are not particularly limited, as long as the hydrogel framework material accounts for 10%-35% of the total volume of each component. For example, in specific embodiments, the volume ratio of the hydrogel framework material, functional material, crosslinking agent, additive, and solvent can be (3-10):(2-5):(0.1-1):(5-10):(4-8), preferably (4-8):(1-4):(0.1-1):(7-10):(4-7).

[0048] According to embodiments of the present invention, the type of hydrogel framework material in the raw materials forming the solid support is not particularly limited. For example, it may include methyl acrylate, ethyl acrylate, n-propyl acrylate, n-butyl acrylate, hydroxyethyl methacrylate, polyethylene glycol diacrylate, hydroxypropyl methacrylate, hydroxybutyl methacrylate, or combinations thereof, preferably including hydroxyethyl methacrylate, polyethylene glycol diacrylate, hydroxypropyl methacrylate, or combinations thereof. The type of functional material is also not particularly limited; for example, it may be a carbohydrate, as long as it contains functional groups, such as compounds containing epoxy, primary amine, mercapto, carbonyl, hydroxyl, carboxyl, or combinations thereof. Specifically, the functional material includes glycidyl methacrylate. The crosslinking agent includes ethylene glycol diacrylate. Furthermore, the additive is composed of a reinforcing agent, a plasticizer, and a photoinitiator. In a specific embodiment, the volume ratio of the reinforcing agent, plasticizer, and photoinitiator in the additive is (1-5):(3-6):(0.1-1), preferably (2-4):(4-6):(0.2-0.7). The reinforcing agent includes, but is not limited to, N-vinylpyrrolidone, the plasticizer includes, but is not limited to, ethylene glycol, and the photoinitiator includes, but is not limited to, 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylphenylacetone, 2-hydroxy-2-methylphenylacetone, or a combination thereof.

[0049] According to embodiments of the present invention, the solid-phase support of the present invention has an initiation chain coupled to its surface. Specifically, the hydrogel framework material of the present invention is activated and has an initiation chain coupled to its surface. The hydrogel framework material is activated after surface modification, which includes introducing at least one of amino, carboxyl, epoxy, thiol, and vinyl groups into the hydrogel framework material. The surface-modified and activated hydrogel framework material can better couple the initiation chain to achieve the function of enzymatic DNA synthesis.

[0050] In another aspect, the present invention provides a method for preparing a solid-phase support. (See reference...) Figure 1 The method includes: mixing a hydrogel framework material, a functional material, a crosslinking agent, an additive, and a solvent, pouring the mixture into a mold, and irradiating it under light conditions to obtain a hydrogel framework; modifying the surface of the hydrogel framework to obtain a modified hydrogel; and activating the modified hydrogel and then initiating chain coupling to obtain a solid-phase support. The light conditions include UV irradiation for 8-12 minutes. This method has at least one of the following beneficial effects: simple operation, energy saving and environmental protection, and the resulting solid-phase support has strong spreadability and low steric hindrance.

[0051] The types of hydrogel framework materials, functional materials, crosslinking agents, additives and solvents have been described in detail above, and will not be repeated here.

[0052] According to embodiments of the present invention, the order in which the hydrogel framework material, functional material, crosslinking agent, additive, and solvent are added during the mixing process is not particularly limited, as long as a homogeneous prepolymer is ultimately formed. For example, in a specific embodiment, the above-mentioned raw materials in a predetermined proportion can be placed in a mixing container and mixed to obtain a homopolymer solution; wherein, the size and material of the mixing container are not particularly limited, but preferably are... The mixing method is not particularly limited, including but not limited to shaking, vortexing, tumbling, and other methods. Then, the obtained prepolymer solution is injected into a mold. Because the solution contains a photoinitiator, under light irradiation, it can initiate the polymerization of free radicals between the reactants, resulting in a shaped hydrogel skeleton. The material, shape, and size of the mold are not particularly limited, as long as the mold surface is smooth and flat. For example, in specific embodiments, the mold material includes, but is not limited to, plastic, glass, rubber, and metal, and is preferably plastic, such as thermoplastic plastics (including PET materials, etc.). The shape of the mold only needs to facilitate the removal of the hydrogel skeleton and have a certain height; for example, it can be a circular hole or a cuboid shape, and is preferably a circular hole. The size of the mold can be specifically determined according to the volume of the obtained prepolymer solution, but to save raw materials, in specific embodiments, the volume of the mold is usually less than 1 cm³. 3 Furthermore, to avoid the prepared hydrogel carrier being too thick, requiring subsequent cutting, the height of the mold in this specific embodiment can be [missing information]. Preferably In summary, in specific embodiments, the mold used in this invention is preferably made of PET material and has a height of [missing information]. A round-hole mold.

[0053] According to an embodiment of the present invention, after the above-mentioned prepolymer solution is injected into a mold, it can be further pressed with a glass sheet to remove air bubbles, and then irradiated with UV light to initiate free radical polymerization and form a stable hydrogel framework. Specifically, it can be used... Irradiation with UV lamps, the irradiation time can be Preferably The direction of UV irradiation is not particularly restricted, but to avoid excessive local light intensity, the angle between the UV light and the prepolymer surface can be 60-90°, and preferably 90° perpendicular irradiation. Then, the glass slide is removed, the hydrogel skeleton is taken out of the mold and washed with pure water, and stored in pure water to keep its surface moist. The glass slide includes, but is not limited to, a coverslip.

[0054] According to embodiments of the present invention, the present invention further includes modifying the surface of the obtained hydrogel framework. Specifically, this includes removing the hydrogel framework from pure water and then treating its surface with a hydrophilic modifying compound to obtain a modified hydrogel. The type of hydrophilic modifying compound is not particularly limited; specifically, it can be determined based on the type of functional material selected. For example, in specific embodiments, the hydrophilic modifying compound may include at least one of amino-rich surface modifying materials, carboxyl-rich functional materials, and epoxy-rich functional materials. The types of amino-rich surface modifying materials, carboxyl-rich functional materials, and epoxy-rich functional materials are not particularly limited, as long as they have a modifying effect. For example, in specific embodiments, amino-rich surface modifying materials include, but are not limited to, branched polyethyleneimine. Furthermore, since polyglutamic acid has a large number of free carboxyl groups on its molecular chain, it can provide a large number of carboxyl groups to the hydrogel surface as a carboxyl-rich functional material, enabling efficient coupling of biomolecules. Additionally, polyethylene glycol (PEG) is a linear molecule with excellent water solubility; using PEG derivatives as carboxyl-rich functional materials can effectively reduce the surface coupling density and steric hindrance. Therefore, carboxyl-rich functional materials preferably include polyglutamic acid, PEG derivatives, or combinations thereof, wherein the PEG derivatives preferably include amino-PEG carboxyl groups. Furthermore, epoxy-rich functional materials include, but are not limited to, polyethylene glycol diglycidyl ether.

[0055] According to embodiments of the present invention, the number of treatments during the modification process is not particularly limited; specifically, one or more treatments can be performed, and the types of hydrophilic modifying compounds used in each treatment can be the same or different. The treatment time is also not particularly limited, but preferably the treatment time is greater than [a certain duration]. Furthermore, the concentration of the hydrophilic modifying compound used is not particularly limited. However, to avoid waste due to excessively high concentration or slow reaction due to excessively low concentration, the concentration of the hydrophilic modifying compound is preferably [value missing] in the specific embodiment. Furthermore, the present invention may further include removing and washing the hydrogel or storing it in PBS buffer after each modification treatment before the next treatment, and storing the resulting modified hydrogel in pure water to keep its surface moist.

[0056] According to embodiments of the present invention, the present invention further includes activating the surface of the modified hydrogel, specifically, removing the modified hydrogel from pure water and treating it with an activating compound. The type of activating compound used is not particularly limited, and may include, for example, carbodiimide carboxyl activators, NHS activated lipid intermediates, or combinations thereof, preferably including carbodiimide carboxyl activators and NHS activated lipid intermediates. The carbodiimide carboxyl activators include, but are not limited to, at least one of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and dicyclohexylcarbodiimide; the NHS activated lipid intermediates may include sodium N-hydroxythiosuccinimide, N-hydroxysuccinimide, or combinations thereof. The treatment time is also not particularly limited, but is preferably [time missing]. More preferably Furthermore, the concentration of the activating compound used is not particularly limited, but to avoid waste due to excessively high concentration or slow reaction due to excessively low concentration, the concentration of the activating compound is preferably [value missing] in the specific embodiment. Furthermore, the present invention may further include storing the resulting activated modified hydrogel in MES buffer after the activation treatment is completed, and then performing subsequent processing.

[0057] According to embodiments of the present invention, the present invention further includes coupling an initiating chain to the surface of the obtained activated modified hydrogel. Specifically, this includes immersing the activated modified hydrogel in a streptavidin coupling solution, shaking and reacting overnight at room temperature to couple streptavidin to the surface of the modified hydrogel via an amidation reaction, storing it in PBS buffer, and then immersing it again in the initiating chain coupling solution. A solid-phase support was obtained. The streptavidin-coupled solution contained... Streptavidin. The initiating chain coupling solution includes... Initiating chain. Furthermore, in a specific embodiment, the initiating chain includes a 5' biotin-labeled DNA sequence, which is coupled using a streptavidin-biotin affinity reaction to obtain a solid-phase carrier coupled with the initiating chain, and stored in Tris-HCl buffer for subsequent use.

[0058] In another aspect, the present invention provides a method for synthesizing DNA using the above-described solid-phase support, with reference to... Figure 2 The method includes the following steps: cutting a solid-phase carrier and using it for DNA synthesis and deprotection reactions, repeatedly cycling the synthesis and deprotection reactions to synthesize the target sequence; dissociating the solid-phase carrier after the synthesis and deprotection reaction cycles; using the dissociation product as a template for PCR amplification; performing agarose gel electrophoresis on the PCR amplification product, recovering the target electrophoretic band, and sequencing it. This method has at least one of the following beneficial effects: reducing steric hindrance in the enzymatic reaction process and greatly improving synthesis efficiency.

[0059] According to embodiments of the present invention, the invention further includes cutting the solid-phase carrier. The shape and size of the cut solid-phase carrier are not particularly limited, as long as it can be placed in a PCR tube for the synthesis reaction. Specifically, the solid-phase carrier can be cut into a rectangle with a width of (1.2-2.5) mm and a length of (2.5-3.5) mm, and the solid-phase carrier is immersed in a DNA enzymatic synthesis reaction solution to carry out the DNA synthesis reaction. The DNA synthesis reaction is carried out at a temperature of 30℃-45℃, and the reaction time can be... Preferably After the reaction, the mixture was stored at 4°C. The DNA enzymatic synthesis reaction solution included terminal deoxynucleotidyl transferase, terminal protective monomers, cobalt chloride, PBS, and water. The specific contents of each component are shown in Table 1. The terminal protective monomers included aminooxy-protected deoxyguanosine triphosphate, aminooxy-protected deoxyadenosine triphosphate, aminooxy-protected deoxycytidine triphosphate, and aminooxy-protected deoxycytidine triphosphate. Each synthesis reaction system contained only one type of terminal protective monomer. Furthermore, the DNA synthesis reaction could be carried out in a metal bath, water bath, or PCR instrument, preferably in a PCR instrument.

[0060]

[0061] According to an embodiment of the present invention, the present invention further includes a deprotection reaction of the solid-phase carrier after the above-mentioned DNA synthesis reaction. Specifically, this includes removing the solid-phase carrier after the completion of the above-mentioned DNA synthesis reaction with tweezers, rinsing it with pure water, and then immersing it in a deprotection reaction solution until submerged. The solid-phase carrier is then removed and rinsed with pure water. The order in which the solid-phase carrier and deprotection reaction solution are added to the PCR tube is not particularly restricted; either the solid-phase carrier or the deprotection reaction solution can be added first. In this specific embodiment, it is preferable to add the solid-phase carrier first, followed by the deprotection reaction solution. Furthermore, the deprotection reaction solution includes sodium nitrite and glacial acetic acid. Specifically, the deprotection reaction solution is prepared by dissolving 45-50 mg of sodium nitrite in… In pure water, then add It was prepared from a 1% glacial acetic acid solution.

[0062] According to embodiments of the present invention, the present invention further includes continuously repeating the above-described synthesis reaction and deprotection reaction. Specifically, terminal protective base monomers can be added in the order of the base sequence of the target sequence to carry out an enzymatic DNA synthesis reaction, and the DNA synthesis reaction-deprotection reaction cycle can be repeated until the target sequence is synthesized.

[0063] According to embodiments of the present invention, the invention further includes a dissociation reaction of the solid-phase support after the DNA synthesis-deprotection cycle to dissociate the synthesized target sequence. Specifically, the solid-phase support after the synthesis and deprotection cycles can be immersed in pure water and reacted at a temperature of 80°C-100°C. The dissociated product was obtained and stored at 4°C after the reaction was completed.

[0064] According to embodiments of the present invention, prior to the dissociation reaction, the invention may further include synthesizing an unprotected terminal monomer at the 3' end of the synthesized target sequence to facilitate subsequent sequencing reactions of the synthesized primer sequence. The unprotected terminal monomer includes, but is not limited to, dATP monomers. For example, in a specific embodiment, a PolyA synthesis reaction can be performed on a solid-phase support after cycles of synthesis and deprotection reactions. The solid-phase support is immersed in a PolyA synthesis reaction solution, and the reaction is carried out at a temperature of 30°C-45°C. PolyA fragments were synthesized from the 3' end of the target sequence. After the reaction, the mixture was stored at 4°C. The hydrogel containing the synthesized PolyA was then removed with tweezers, rinsed with pure water, and placed into a new PCR tube for subsequent dissociation reactions. The PolyA synthesis reaction solution included terminal deoxynucleotidyl transferase, unprotected dATP monomer, buffer, and water. The specific synthesis system is shown in Table 2 below. Furthermore, the PolyA synthesis reaction can be performed in a metal bath, water bath, or PCR instrument, preferably in a PCR instrument.

[0065]

[0066] According to embodiments of the present invention, the present invention may further include detecting the dissociation products generated by the dissociation reaction, including PCR amplification of the dissociation products, detection of the amplified PCR products by agarose gel electrophoresis, recovery of the gel bands using a kit, and sequencing analysis of the recovered products. The PCR amplification reaction system and reaction conditions are not particularly limited. Specifically, the reaction system can be determined according to the type of DNA polymerase used, and the reaction conditions can be adjusted according to the length of the target sequence, the melting temperature of the primer sequence, and the extension rate of the DNA polymerase. In specific embodiments, the selected PCR amplification reaction systems are shown in Table 3 below.

[0067]

[0068] This solid-phase carrier can be used for, but is not limited to, DNA enzymatic synthesis. Different functional groups can be grafted onto the surface of the solid-phase carrier to prepare functionalized solid-phase carriers suitable for various tasks. Example

[0069] The method proposed in this invention will be described in detail below through specific embodiments. Unless otherwise specified, the methods used in the following embodiments are conventional methods, and the reagents used are commercially available unless otherwise specified.

[0070] Example 1

[0071] 1. Preparation of hydrogel framework

[0072] Take the following raw materials to form a solid support in The prepolymer solution was prepared by vortexing in a tube.

[0073] Hydrogel framework material: hydroxyethyl methacrylate, ;

[0074] Functional material: glycidyl methacrylate, ;

[0075] Crosslinking agent: ethylene glycol diacrylate; ;

[0076] Additive: Reinforcing agent – ​​N-vinylpyrrolidone ;

[0077] Plasticizer – Ethylene glycol ;

[0078] Photoinitiator – 2-hydroxy-2-methylphenylacetone .

[0079] Pour the resulting homogeneous prepolymer solution into a PET round-hole mold, press it with a coverslip to remove air bubbles, and then... Irradiate the sample at a 90° angle for 10 minutes. Then, remove the coverslip, take out the hydrogel framework, rinse it with pure water, and store it in pure water for later use. The diameter of the mold used in this embodiment is [diameter missing]. Thickness is .

[0080] 2. Preparation of modified hydrogels

[0081] Amin functionalization: Weigh out molecular weight branched polyethyleneimine dissolves in The hydrogel skeleton was immersed in the solution and reacted with shaking at room temperature for 2 hours. Afterwards, it was removed, rinsed with water, and then placed in a container. Temporarily store in buffer solution.

[0082] Carboxyl functionalization: Weigh Polyglutamic acid with a molecular weight of soluble in Dissolve the solution in buffer solution by shaking at room temperature. After the solution becomes clear, add [the following ingredient] to the solution. Carbodiimide hydrochloride, After further dissolution, a reaction solution is obtained, and the hydrogel framework is then removed from... Remove from the buffer solution, place in the above reaction solution and react for 3 hours to obtain a modified hydrogel, which is then placed in pure water for later use.

[0083] 3. Preparation of solid-phase support

[0084] Activation treatment: Weigh out Carbodiimide hydrochloride, Dissolved in The modified hydrogel was immersed in the buffer solution for reaction. After removal, the surface activation of the modified hydrogel is complete. Temporarily store in buffer solution.

[0085] Coupling trigger chain: weighing Streptavidin dissolves in Immediately immerse the surface-activated modified hydrogel in the buffer solution, allow it to react overnight at room temperature with shaking, then remove it. Complete streptavidin coupling on the hydrogel surface via amidation. Place the resulting solid support in... Temporarily store in buffer solution. Then... CTTCAATCAGTCTAGCTCAATAT) dissolves in The hydrogel containing streptavidin was immersed in the buffer solution and reacted at room temperature with shaking. Afterwards, the strands were removed and coupled on the hydrogel surface using the streptavidin-biotin affinity reaction principle to prepare a solid support. The obtained solid support was then placed... Prepare in buffer solution.

[0086] 4. DNA synthesis reaction

[0087] The resulting solid support was removed from the Tris-HCl buffer and cut into wide strips. ,long The square-shaped reagents were immersed in PCR tubes containing the following reagents, and enzymatic DNA synthesis was performed in a PCR instrument. The enzymatic DNA synthesis reaction system and PCR instrument operating conditions are shown in Tables 4 and 5 below:

[0088]

[0089]

[0090] After the enzymatic DNA synthesis is complete, use tweezers to remove the hydrogel, rinse it with pure water, and then place it into a new PCR tube for subsequent deprotection reactions.

[0091] 5. Deprotection reaction

[0092] Weigh out 47.2 mg of sodium nitrite and dissolve it in... Add pure water The glacial acetic acid solution was used to obtain the deprotection reaction solution. This deprotection reaction solution was added to the PCR tube containing the hydrogel synthesized with terminal protected bases, and the tube was immersed in the reaction solution. Afterwards, remove the sample, rinse with pure water, and repeat the DNA synthesis-deprotection reaction cycle in steps 4 and 5, synthesizing multiple bases in the order CGTCGTCGTC.

[0093] 6. PolyA Synthesis

[0094] After the DNA synthesis-deprotection cycle was completed, PolyA synthesis was performed. A PolyA fragment was added to the 3' end of the target sequence for PCR amplification, and the synthesis results were characterized. The PolyA synthesis system is shown in Table 6 below. After immersing the hydrogel from the completed DNA synthesis-deprotection cycle into this synthesis system, PolyA synthesis was performed in a PCR instrument. The PCR instrument operating conditions are shown in Table 7 below.

[0095]

[0096]

[0097] After the PolyA synthesis is complete, the solid-phase carrier is removed with tweezers, rinsed with pure water, and placed into a new PCR tube for subsequent dissociation reactions.

[0098] 7. Dissociation reaction

[0099] Add to the PCR tube containing the solid-phase carrier after PolyA synthesis Pure water was used for the thermal dissociation reaction on a PCR instrument. The operating conditions of the PCR instrument are shown in Table 8 below:

[0100]

[0101] 8. Detection of dissociation products

[0102] PCR amplification: The dissociation products obtained from the dissociation reaction were subjected to PCR amplification. The PCR reaction system is shown in Table 9 below. The template used was the dissociation product, and the first primer sequence was... The tail primer sequence is The PCR reaction conditions are shown in Table 10 below.

[0103]

[0104]

[0105] The PCR amplification products were subjected to agarose gel electrophoresis. The target band obtained from the gel was cut and recovered using a gel extraction kit. The recovered DNA product was sequenced and analyzed. The number of bases before PolyA was compared with the initial initiating strand to observe the synthesis of the target sequence and calculate the final synthesis efficiency. The sequencing results are as follows: Figure 3 As shown, out of the 5 valid data, 3 sequences were capable of synthesis, with a synthesis efficiency of 100%, and all were successful.

[0106] Example 2

[0107] 1. Preparation of hydrogel framework

[0108] Same as Example 1.

[0109] 2. Preparation of modified hydrogels

[0110] Amin functionalization: Weigh out molecular weight branched polyethyleneimine dissolves in The hydrogel skeleton was immersed in the solution and reacted with shaking at room temperature for 2 hours. Afterwards, it was removed, rinsed with water, and then placed in a container. Temporarily store in buffer solution.

[0111] Epoxy group functionalization: Weigh out Molecular weight polyethylene glycol diglycidyl ether dissolves in Dissolve the hydrogel in buffer solution by shaking at room temperature. After the solution becomes clear, remove the hydrogel framework from... Remove from buffer solution, immerse in the solution and react overnight, then remove and place. Temporarily store in buffer solution.

[0112] Carboxyl functionalization: Weigh Molecular weight amino polyethylene glycol carboxyl group dissolves in In solution, the hydrogel framework is removed from Remove from the buffer solution, immerse in the solution, react overnight, then remove and place in pure water for later use.

[0113] 3. Preparation of solid-phase support

[0114] Same as Example 1.

[0115] 4. DNA synthesis reaction

[0116] Same as Example 1.

[0117] 5. Deprotection reaction

[0118] Same as Example 1.

[0119] 6. PolyA Synthesis

[0120] Same as Example 1.

[0121] 7. Dissociation reaction

[0122] Same as Example 1.

[0123] 8. Detection of dissociation products

[0124] The detection method is the same as in Example 1. The sequencing results are as follows: Figure 4 As shown, among the 6 valid data, 6 sequences are capable of synthesis, 4 have 1-2 base deletions, and 2 are completely correct.

[0125] In summary, the solid-phase support proposed in this invention uses hydrogel as the framework material, possessing the excellent physicochemical properties of hydrogel, including the characteristic of swelling without dissolving. This invention obtains functionalized hydrogels by grafting functional groups onto the surface of the hydrogel and modifying it, resulting in a solid-phase support with low steric hindrance, strong spreadability, and wide applicability. Furthermore, the solid-phase support of this invention can be used for enzymatic DNA synthesis reactions with high accuracy and efficiency.

[0126] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or basic characteristics. Therefore, the embodiments should be considered exemplary and non-limiting in all respects.

[0127] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A solid-phase support for enzymatic DNA synthesis, characterized in that, The raw materials include hydrogel framework materials, functional materials, crosslinking agents, additives, and initiation chains; The hydrogel framework material includes at least one of methyl acrylate, ethyl acrylate, n-propyl acrylate, n-butyl acrylate, hydroxyethyl methacrylate, polyethylene glycol diacrylate, hydroxypropyl methacrylate, and hydroxybutyl methacrylate. The additives include reinforcing agents, plasticizers, and photoinitiators; The functional material is glycidyl methacrylate; The raw materials of the solid support further include a solvent, and in the raw materials forming the solid support, the volume ratio of the hydrogel skeleton material, the functional material, the crosslinking agent, the additive and the solvent is (3-10):(2-5):(0.1-1):(5-10):(4-8). In the raw materials forming the solid support, the volume ratio of the reinforcing agent, the plasticizer, and the photoinitiator in the additives is (1-5):(3-6):(0.1-1). The hydrogel framework material, the functional material, the crosslinking agent, the additive, and the solvent are mixed and poured into a mold, and then irradiated under light conditions to obtain the hydrogel framework. The hydrogel framework is surface modified to obtain a modified hydrogel. The modification treatment includes treating the functional surface of the hydrogel with a hydrophilic modifying compound once or multiple times. The hydrophilic modifying compound includes branched polyethyleneimine and polyglutamic acid, or the hydrophilic modifying compound includes branched polyethyleneimine, polyethylene glycol diglycidyl ether and amino polyethylene glycol carboxyl group.

2. The solid support according to claim 1, characterized in that, The modified hydrogel is activated and coupled with the initiation chain, and the solid support satisfies at least one of the following conditions: The crosslinking agent includes ethylene glycol diacrylate; The reinforcing agent includes N-vinylpyrrolidone; The plasticizer includes ethylene glycol; The photoinitiator includes at least one of 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylphenylacetone and 2-hydroxy-2-methylphenylacetone.

3. The solid support according to claim 1, characterized in that, The solvent includes water.

4. A method for preparing a solid support according to any one of claims 1-3, characterized in that, include: The hydrogel framework material, the functional material, the crosslinking agent, the additive and the solvent are mixed and poured into a mold, and then irradiated under light conditions to obtain the hydrogel framework. The surface of the hydrogel framework is modified to obtain a modified hydrogel. The modified hydrogel was subjected to initiation chain coupling to obtain the solid support; The lighting conditions include UV irradiation; The illumination time includes 8-12 minutes.

5. The method according to claim 4, characterized in that, The process further includes activating the modified hydrogel before initiating the chain coupling, wherein the activation treatment includes treating the modified hydrogel with an activating compound for 0.5-3 h; The activating compounds include carbodiimide carboxyl activators and NHS-activated lipid intermediates; The carbodiimide carboxyl activator includes at least one of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and dicyclohexylcarbodiimide; The NHS-activated lipid intermediate includes at least one of sodium N-hydroxythiosuccinimide and N-hydroxysuccinimide.

6. The method according to claim 5, characterized in that, The initiation chain coupling includes: immersing the modified hydrogel that has undergone the activation treatment in a streptavidin coupling solution overnight, and then immersing it in an initiation chain coupling solution for 0.5-3 h to obtain the solid support; The streptavidin-conjugated solution contains 0.5-1 mg / mL streptavidin; The initiator chain coupling solution comprises 2-6 nmol / mL initiator chain; The initiating chain includes a 5' biotin-tagged DNA sequence.

7. A method for synthesizing DNA using a solid-phase support according to any one of claims 1-3, characterized in that, include: The solid-phase carrier is cut and used for DNA synthesis and deprotection reactions. The synthesis and deprotection reactions are repeated continuously to synthesize the target sequence. The solid support after cycling through the synthesis reaction and the deprotection reaction is subjected to a dissociation reaction; PCR amplification was performed using the dissociation product obtained from the dissociation reaction as a template; The products obtained from the PCR amplification were subjected to agarose gel electrophoresis, and the target electrophoretic bands were recovered and sequenced for analysis.

8. The method according to claim 7, characterized in that, The synthetic reaction includes: The cut solid support was immersed in the DNA enzymatic synthesis reaction solution and reacted at a temperature of 30℃-45℃ for 15-40 min. The DNA enzymatic synthesis reaction solution includes terminal deoxynucleotidyl transferase, terminal protective base monomer, cobalt chloride, PBS, and water.

9. The method according to claim 7, characterized in that, The deprotection reaction includes: Remove the solid support after the synthesis reaction, rinse it, and immerse it in the deprotection reaction solution. After 10-20 minutes, remove the solid support and rinse it again. Then repeat the synthesis reaction and the deprotection reaction. The deprotection reaction solution includes sodium nitrite and glacial acetic acid.

10. The method according to claim 7, characterized in that, Before carrying out the dissociation reaction, the process further includes: immersing the solid support after the synthesis reaction and deprotection reaction cycle into the PolyA synthesis reaction solution, and reacting at a temperature of 30℃-45℃ for 30-50 min to initiate the synthesis of PolyA fragments at the 3' end of the chain. The PolyA synthesis reaction solution includes terminal deoxynucleotidyl transferase, unprotected dATP monomer, buffer, and water.

11. The method according to claim 7, characterized in that, The dissociation reaction includes: The solid support after the synthesis reaction and the deprotection reaction were immersed in pure water and reacted at a temperature of 80℃-100℃ for 20-40 min to obtain the dissociation product.

Images