A general portable aptamer-quantum dot photocatalytic colorimetric detection platform

Abstract

The universal portable aptamer-quantum dot photocatalytic colorimetric detection platform comprises a power supply (1) and a light-proof cover (2) arranged thereon, the light-proof cover (2) comprises a side wall (201) and a top plate (202), the bottom is open, a round hole (203) is arranged on the top plate (202), a light source plate (3) is movably connected to one side of the upper end of the side wall (201), a light source (301) is arranged in the middle of the light source plate (3), and a light uniformizing sheet (302) is arranged below the light source (301); and a heating platform (101) is arranged on the upper portion of the power supply (1). The universal portable aptamer-quantum dot photocatalytic colorimetric detection platform adopts the aptamer single-chain competition strategy to develop a universal aptamer-quantum dot photocatalytic colorimetric detection platform, and the online detection of various target objects can be realized by adjusting the type of the aptamer and the paper-based configuration.

Description

Technical Field

[0001] This invention relates to the application of quantum dots and aptamers in the field of optical sensors, and in particular to a universal portable aptamer-quantum dot photocatalytic colorimetric detection platform. Background Technology

[0002] Quantum dots are a novel class of nanomaterials with sizes ranging from 1 to 10 nm. They possess strong enzyme-like activity, capable of catalyzing the oxidation of substrates to generate colorimetric signals. However, the potential for non-specific interactions between quantum dots and other molecules, leading to false positives, limits their application in optical sensors. Aptamers, single-stranded DNA or RNA molecules, have attracted significant attention in the field of biosensing due to their high selectivity and affinity for target molecules. Summary of the Invention

[0003] The technical problem to be solved by this invention is to provide a universal portable aptamer-quantum dot photocatalytic colorimetric detection platform that is simple in structure and easy to operate. By adjusting the type of aptamer and the paper-based configuration, multiple target substances can be detected simultaneously online. This technology is expected to achieve important applications and progress in the field of optical sensing.

[0004] The present invention relates to a universal portable aptamer-quantum dot photocatalytic colorimetric detection platform, comprising a power supply and a light shield disposed thereon. The light shield includes a side wall and a top plate, with an opening at the bottom. A circular hole is provided on the top plate. A light source plate is movably connected to the upper end of one side of the side wall. A light source is disposed in the middle of the light source plate, and a light-diffusing plate is disposed below the light source. A heating platform is disposed above the power supply.

[0005] The universal portable aptor-quantum dot photocatalytic colorimetric detection platform described in this invention also includes a smartphone.

[0006] The universal portable aptor-quantum dot photocatalytic colorimetric detection platform of the present invention has a mobile phone holder movably connected to the upper end of the other side of the sidewall, and a shooting hole is provided in the middle of the mobile phone holder.

[0007] The universal portable aptor-quantum dot photocatalytic colorimetric detection platform of the present invention includes a light strip arranged around the periphery of the light-diffusing plate.

[0008] The universal portable aptor-quantum dot photocatalytic colorimetric detection platform of the present invention has one side of the light shield hinged to the upper part of the power supply, which covers the heating platform during the reaction, and a paper base is provided on the heating platform.

[0009] The universal portable aptor-quantum dot photocatalytic colorimetric detection platform of the present invention, wherein the light-diffusing plate is circular, and when the light source plate is flipped above the top plate, the light source, the light-diffusing plate and the lamp strip are all inside the circular hole;

[0010] The phone holder can be used parallel to the top plate or folded over the top of the top plate for use. When folded, the camera hole is above the circular hole.

[0011] The universal portable aptor-quantum dot photocatalytic colorimetric detection platform of the present invention includes a hinged active connection, a power supply including a mobile power supply and an AC power supply, and an LED light source.

[0012] The method for online detection using the universal portable aptamer-quantum dot photocatalytic colorimetric detection platform described in this invention includes the following steps:

[0013] (A) Prepare a paper base, the paper base comprising one sample area and three reaction areas;

[0014] (B) Fabricate the aforementioned universal portable aptamer-quantum dot photocatalytic colorimetric detection platform;

[0015] (C) Sample pretreatment to obtain sample solution;

[0016] (D) Reaction and detection: CdSe / ZnS core-shell quantum dots are modified into the reaction region, dried at 37°C, and then an aptamer is added. The sample solution is added to the sample region and reacted for a period of time. OPD is added to the reaction region and reacted for a period of time under the excitation of LED beads, thus achieving colorimetric detection of the target analyte.

[0017] An optical photograph of the paper substrate after the reaction is taken using a smartphone, and the RGB values ​​of the reaction area are obtained using color analysis software for subsequent data analysis, thereby achieving quantitative detection of the target analyte.

[0018] The method described in this invention is used for the simultaneous detection of Pb(II), As(III), and Cd(II), wherein:

[0019] 20 μL of 1 μM CdSe / ZnS core-shell quantum dots were modified into the reaction region. After drying at 37 °C, 20 μL of 25 μM amino-modified Pb(II), As(III), and Cd(II) aptamers were added to the three reaction regions respectively. After adding 20 μL of the sample solution to the sample region and reacting for a period of time, 20 μL of 2 g / L OPD was added to the reaction region. The reaction was carried out for 10 min under the excitation of a 420 nm LED bead, thus achieving colorimetric detection of the target analyte.

[0020] The nucleotide sequences of the amino-modified Pb(II), As(III) and Cd(II) aptamers are shown in SEQ ID NO:1~3 in the sequence listing.

[0021] The method of the present invention, wherein:

[0022] The paper base manufacturing process includes the following steps: using AutoCAD software to print the designed configuration onto filter paper, drying it in a 150℃ oven for 30 minutes, and then placing it in a sealed bag for later use; the paper base is composed of three parts: a color developing layer, an adhesive layer, and a hydrophilic layer. The color developing layer includes a sample area with a diameter of 1cm, three reaction areas with a diameter of 0.6cm, and three hydrophilic channels of 0.8*0.3cm. There is a 0.2cm hydrophobic gap between the reaction areas and the hydrophilic channels. The hydrophilic layer has three 0.75*0.3cm hydrophilic channels for connecting the reaction areas and the hydrophilic channels. The adhesive layer fixes the color developing layer and the hydrophilic layer into the paper base.

[0023] The sample pretreatment includes the following steps: Weigh 1g of sample, place it in a 200mL sealed container, and add 0.07mol L⁻¹ of 50mL solution at a temperature of 22±3℃. -1 The simulated gastric fluid was prepared, and the pH of the solution was adjusted between 1.10 and 1.30. The sample was then placed in a shaking environment with a shaking frequency of approximately 150 min. -1 The solution was shaken in a constant temperature water bath shaker at 37°C for 1 hour in the dark, and then allowed to stand at 37°C for 1 hour in the dark. The pH value of the solution after migration was tested to see if it was between 1.10 and 1.30. If it was within this range, the supernatant was filtered through a 0.45μm filter membrane to obtain the sample solution.

[0024] The universal portable aptamer-quantum dot photocatalytic colorimetric detection platform of this invention differs from existing technologies in that:

[0025] This invention presents a universal portable aptamer-quantum dot photocatalytic colorimetric detection platform. Developing this platform utilizes an aptamer single-chain competitive strategy, it enables simultaneous online detection of multiple target analytes by adjusting the aptamer type and paper substrate configuration. The platform consists of a colorimetric unit and a recognition unit. The core of the colorimetric unit is a ternary colorimetric system composed of aptamer, quantum dot, and colorimetric substrate. The aptamer acts as the recognition component, and the quantum dot as the signal transduction component. When a target analyte is present, the aptamer folds to wrap around it, altering the photocatalytic activity of the quantum dot, thereby achieving colorimetric detection. Simultaneously, a smartphone plays a crucial role in the recognition unit. It can capture optical images in real time and convert them into RGB and grayscale values ​​for subsequent data analysis, thus enabling quantitative detection of the target analyte.

[0026] The universal portable aptamer-quantum dot photocatalytic colorimetric detection platform of the present invention will be further described below with reference to the accompanying drawings. Attached Figure Description

[0027] Figure 1 This is a schematic diagram of the structure of the universal portable aptamer-quantum dot photocatalytic colorimetric detection platform of the present invention;

[0028] Figure 2 This is a diagram illustrating the detection mechanism of the platform of this invention;

[0029] Figure 3 This is a linear graph obtained by the method of simultaneously detecting Pb(II), As(III) and Cd(II) in toy samples in this invention;

[0030] Figure 4 This is a diagram showing the test results of mutual interference among three heavy metals in this invention;

[0031] Figure 5 This is a selective evaluation chart of eight heavy metal ions from the platform of this invention. Detailed Implementation

[0032] I. Detection Methods

[0033] 1. Instruments and reagents

[0034] ICP-OES measurements were performed using an Optima 8300 inductively coupled plasma spectrometer (PerkinElmer, USA), with photocatalysis experiments conducted using 420nm LED beads (Chundaxin Optoelectronics, Shenzhen).

[0035] CdSe / ZnS core-shell quantum dots were purchased from Beijing Beida Jubang Technology Co., Ltd. The amino-modified Pb(II), As(III), and Cd(II) aptamers were all from Sangon Biotech (Shanghai) Co., Ltd., and their specific sequences are as follows:

[0036] Pb(II):GGGTGGGTGGGTGGGT;

[0037] As(III):ATGCAAACCCTTAAGAAAGTGGTCGTCCAAAAAACCATTG;

[0038] Cd(II):GGGAGGGAACTGTTGTGGTATTATTTTTGGTTGTGCAGTAGGGCGGG.

[0039] All aptamers were dissolved in a phosphate buffer solution at pH 7.4, prepared from disodium hydrogen phosphate and sodium dihydrogen phosphate (Sinopharm Chemical Reagent Co., Ltd., Shanghai). Trisodium citrate dihydrate and trisodium citrate monohydrate, used to prepare citrate buffer (pH 4), were sourced from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). o-Phenylenediamine (OPD) and various metal ions (including Zn(II), Ca(II), Co(II), Ni(II), Hg(II), Cd(II), Pb(II), As(III)) were purchased from Aladdin Reagent Co., Ltd., Shanghai, China. Filter paper was purchased from Whatman (UK). Ultrapure water (R ≥ 18.2 MΩ) was prepared using a Milli-Q ultrapure water purifier (Bedford, MA, USA) and used in all experiments. All other reagents were of analytical grade and required no further purification before use.

[0040] 2. Development of the ACP platform

[0041] The aptamer-based colorimetric platform (ACP) consists of two parts: a reaction module and an optical module. The specific structure is as follows: Figure 1 As shown:

[0042] A universal portable aptor-quantum dot photocatalytic colorimetric detection platform includes a power supply 1 and a light shield 2 mounted thereon. The light shield 2 includes a side wall 201 and a top plate 202 with an opening at the bottom. A circular hole 203 is provided on the top plate 202. A light source plate 3 is movably connected to the upper end of one side of the side wall 201. A light source 301 is provided in the middle of the light source plate 3, and a light homogenizer 302 is provided below the light source 301. A heating platform 101 is provided above the power supply 1. The platform also includes a smartphone 4.

[0043] In the preferred embodiment, a mobile phone holder 5 is movably connected to the upper end of the other side of the side wall 201, a shooting hole is provided in the middle of the mobile phone holder 5, and a light strip 303 is provided around the light diffuser 302.

[0044] One side of the light shield 2 is hinged to the upper part of the power supply 1, and during the reaction, it covers the heating platform 101. A paper base 6 is provided on the heating platform 101.

[0045] The light-diffusing plate 302 is circular. When the light source plate 3 is flipped above the top plate 202, the light source 301, the light-diffusing plate 302, and the light strip 303 are all inside the circular hole 203.

[0046] The phone holder 5 can be used parallel to the top plate 202 or folded over the top of the top plate 202. When folded, the camera hole is above the round hole 203 (the camera hole is set in the middle of the phone holder 5, not shown in the figure, in order to adapt to various different mobile phones. The position of the mobile phone camera is different, and the usage is different. It can be used in parallel or folded).

[0047] The active connection is a hinge, the power supply 1 includes a mobile power supply and an AC power supply, and the light source 301 is an LED lamp bead.

[0048] The LED beads are replaceable, allowing the use of different wavelengths to suit various experimental needs. The light-diffusing sheet 302 is 0.5mm thick and approximately 10cm from the heating platform 101, ensuring consistent luminous flux from the LED beads within the sealed space. The LED strip 303 serves as the light source within the sealed device, guaranteeing uniform light intensity for each subsequent photograph. The paper base 6 is placed above the heating platform 101, whose temperature can be controlled within the range of 30-150℃ (±0.1℃) to meet different experimental temperature requirements. The light shield 2 is constructed of aluminum alloy, ensuring structural stability and preventing deformation at 150℃. The lower left edge of the light shield 2 is hinged, allowing it to be flipped open along this axis for replacement of the paper base 6. The power supply 1 consists of both AC power and a portable power source, ensuring stable power supply in both fixed and mobile states. The core of the optical module is a smartphone 4 equipped with color recognition software. After the reaction is completed, the smartphone 4 is placed on the phone holder 5 and the optical photograph of the paper base 6 is taken at a fixed height. The RGB value and grayscale value of the reaction area of ​​the paper base 6 are identified, thereby realizing the quantitative detection of the target object.

[0049] 3. Making Paper Base 6

[0050] The designed configuration was printed onto filter paper using AutoCAD software, dried in a 150℃ oven for 30 minutes, and then placed in a sealed bag for later use. Specifically, paper base 6 consists of three parts: a chromogenic layer, an adhesive layer, and a hydrophilic layer. The chromogenic layer has a sample area with a diameter of 1 cm, three reaction areas with a diameter of 0.6 cm, and three 0.8*0.3 cm hydrophilic channels. There is a 0.2 cm hydrophobic gap between the reaction areas and the hydrophilic channels. The hydrophilic layer has three 0.75*0.3 cm hydrophilic channels for connecting the reaction areas and the hydrophilic channels. The adhesive layer fixes the chromogenic layer and the hydrophilic layer into the detection paper base 6. The configuration of paper base 6 can be modified according to the number of target substances. An optimized ternary chromogenic system (quantum dot-aptamer-chromogenic substrate) can be applied to the surface of paper base 6 to create a paper-based chip capable of simultaneously detecting multiple heavy metals.

[0051] 4. Pretreatment of actual samples

[0052] Taking toys as an example, this sensor was applied to the detection of actual samples. The samples were pretreated according to the pretreatment method for toy articles in the EU standard EN71-3 2019. 1g of sample was weighed and placed in a 200mL sealed container. 0.07mol / L of precipitate was added at a temperature of (22±3)℃ and a volume of 50ml. -1 The simulated gastric fluid was used, and the pH of the solution was adjusted to between 1.10 and 1.30. The sample was then placed in a shaking environment for approximately 150 minutes. -1 The solution was shaken in a constant temperature water bath at 37°C in the dark for 1 hour, and then allowed to stand at 37°C in the dark for 1 hour. The pH of the solution after migration was tested to see if it was between 1.10 and 1.30. If it was within this range, the supernatant was filtered through a 0.45 μm filter membrane to obtain the sample solution.

[0053] 5. Reaction and Detection

[0054] 20 μL of 1-3 μM CdSe / ZnS core-shell quantum dots were added to the reaction zone, dried at 37 °C, and then 20 μL of 10-25 μM aptamer was added. After adding 20 μL of sample solution to the sample zone and reacting for a period of time, 20 μL of 2 g / L OPD was added to the reaction zone. The reaction was carried out for 10 min under the excitation of 420 nm LED beads, thus achieving colorimetric detection of the target analyte.

[0055] Depending on the analyte, different aptamers are added. In this invention, 20 μL of 10-25 μM amino-modified Pb(II), As(III), and Cd(II) aptamers are added to the three reaction zones respectively. The nucleotide sequences of the amino-modified Pb(II), As(III), and Cd(II) aptamers are shown in SEQ ID NO:1~3 in the sequence listing. Different wavelengths of LED beads are selected according to different target substances. In this invention, 420 nm is used.

[0056] The paper substrate 6 is photographed after the reaction using a smartphone 4, and the RGB values ​​of the reaction area are obtained using a color recognizer (APP software) for subsequent data analysis, thereby achieving quantitative detection of the target analyte.

[0057] II. Results and Discussion

[0058] 1. Detection Mechanism

[0059] The ACP platform reaction module is based on a ternary colorimetric system of aptamer-quantum dot-chromogenic substrate. The aptamer acts as the recognition unit, specifically identifying target molecules, while the quantum dot acts as the signal transduction unit, converting target analyte detection into a colorimetric signal output. By adjusting the type of aptamer, colorimetric detection of different types of target analytes can be achieved. Specifically (e.g.) Figure 2As shown, the phosphate group in the aptamer structure gives the aptamer surface a negative charge. This allows it to combine with quantum dots carrying the opposite charge via electrostatic adsorption, forming an aptamer-quantum dot probe. The aptamers accumulate on the quantum dot surface, weakening the quantum dot's photocatalytic activity. Upon the addition of the target analyte, this specific recognition effect competes with the electrostatic adsorption between the probe and the aptamer. The aptamer folds to wrap around the target analyte, occupying most of the base sites on the aptamer. The former's force is much stronger than the latter, causing the aptamers that were previously electrostatically adsorbed on the quantum dot surface to detach, restoring the quantum dots to their free state and restoring photocatalytic activity. Furthermore, as a portable, real-time sensing platform suitable for on-site detection, integrating a smartphone into the optical module is crucial for its success. The smartphone can directly read the grayscale value of the reaction area through digital imaging, enabling real-time quantitative detection of the target analyte.

[0060] 2. Simultaneous detection of three heavy metals

[0061] This invention takes the simultaneous detection of Pb(II), As(III), and Cd(II) in a toy sample as an example, and uses a multi-channel paper substrate to evaluate the detection capability of the sensor. The results are as follows: Figure 3 As shown, the color of the reaction region gradually deepens with increasing target analyte concentration. The linear equations for Pb(II), As(III), and Cd(II) are y = 129.2x + 12.4 (R² + 12.4x ... 2 =0.998), y=127.9x+17.5 (R 2 =0.992), y=120.6x+13.1 (R 2 =0.993). The detection limits of this method were calculated using the 3σ / s formula, where σ is the standard deviation of the blank signal (n = 10) and s is the slope of the calibration curve. The detection limits for the three heavy metals were 7 nm, 5 nm, and 8 nm, respectively. Notably, the color of the reaction zone remained stable for 15 minutes. However, due to the limited stability of OPD oxidation, the reaction zone gradually faded with prolonged storage time.

[0062] 3. Selective evaluation

[0063] The selectivity of the sensor is evaluated using the simultaneous detection of Pb(II), As(III) and Cd(II) as an example, including mutual interference between target analytes and potential interference from other substances.

[0064] According to the method of the present invention, the mutual interference between three heavy metals is tested. Figure 4 This is a diagram showing the test results of mutual interference among three heavy metals in this invention;

[0065] in:

[0066] The left figure shows the test results of Pb(II) coexisting with 10 μM As(III) and Cd(II). When the concentration of Pb(II) varies in the range of 0 ~ 100 μM, the RSDs of As(III) and Cd(II) CI are 2.4% and 3.6%, respectively.

[0067] The intermediate graph shows that when the As(III) concentration is in the range of 0 ~ 100 μM, the RSDs of 10 μMPb(II) and Cd(II) CI are 2.1% and 3.4%, respectively.

[0068] The right figure shows the effect of Cd(II) on the results of 10 μM Pb(II) and As(III). The RSDs of Cd(II) CI were 2.5% and 3.6% for Pb(II) and As(III) respectively, when the Cd(II) concentration varied from 0 to 100 μM.

[0069] These results indicate that the potential matrix effect resulting from the interaction of the three metal ions is negligible.

[0070] 4. Selectivity of other substances

[0071] To evaluate its performance in practical applications, a mixed solution of eight common heavy metal ions—Zn(II), Ca(II), Co(II), Ni(II) (concentration 1000 μM) and Hg(II) (concentration 50 μM)—was prepared. The selectivity of the sensor was evaluated using the method of the present invention, and the results are as follows: Figure 5 As shown, the RSD value of the grayscale value in the reaction zone ranges from 6.2% to 6.5%. Therefore, the sensor exhibits a high level of selectivity. Notably, by modifying the aptamer type and paper-based configuration, this sensor can be applied to the detection of different types of targets.

[0072] 5. Actual sample determination

[0073] The ACP platform was used to detect Pb(II), As(III), and Cd(II) in toys. The results are shown in Table 1. The detectable concentrations of migratable Pb(II) in the plastic coating were 1.0 ± 0.04 μM, As(III) were 1.31 ± 0.07 μM, and Cd(II) were 2.52 ± 0.05 μM, with spiked recoveries ranging from 89% to 110%. In the glue sticks, none of the three heavy metals (Pb(II), As(III), and Cd(II)) were detected, with spiked recoveries ranging from 103% to 106%. These results are consistent with the ICP-OES measurements, indicating that the method has good accuracy and can be used for the detection of actual samples.

[0074]

[0075] 6. Conclusion

[0076] In summary, we have successfully developed a cost-effective portable multi-channel detection platform based on paper chips. It utilizes aptamer-quantum dot probes to achieve simultaneous and rapid detection of multiple targets. This platform features low cost, high sensitivity, and portability.

[0077] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for online detection using a universal portable aptamer-quantum dot photocatalytic colorimetric detection platform, characterized in that: Includes the following steps: (A) Prepare a paper base (6), the paper base (6) comprising one sample area and three reaction areas; (B) Fabrication of the aforementioned universal portable aptamer-quantum dot photocatalytic colorimetric detection platform: The universal portable aptor-quantum dot photocatalytic colorimetric detection platform includes a power supply (1) and a light shield (2) mounted thereon. The light shield (2) includes a side wall (201) and a top plate (202) with an opening at the bottom. A circular hole (203) is provided on the top plate (202). A light source plate (3) is movably connected to the upper end of one side of the side wall (201). A light source (301) is provided in the middle of the light source plate (3), and a light homogenizer (302) is provided below the light source (301). A heating platform (101) is provided above the power supply (1). The universal portable aptor-quantum dot photocatalytic colorimetric detection platform also includes a smartphone (4). (C) Sample pretreatment to obtain sample solution; (D) Reaction and detection: CdSe / ZnS core-shell quantum dots are modified into the reaction region, dried at 37 degrees Celsius, and then an aptamer is added. The sample solution is added to the sample region and reacted for a period of time. OPD is added to the reaction region and reacted for a period of time under the excitation of LED beads, thus achieving colorimetric detection of the target analyte. Using a smartphone (4) to take an optical photograph of the paper base (6) after the reaction, the color recognition software obtains the grayscale value and RGB value of the reaction area for subsequent data analysis, thereby realizing the quantitative detection of the target analyte.

2. The method according to claim 1, characterized in that: The method is used to simultaneously detect Pb(II), As(III), and Cd(II), wherein: 20 μL of 1-3 μM CdSe / ZnS core-shell quantum dots were used to modify the reaction region. After drying at 37 degrees Celsius, 20 μL of 10-25 μM amino-modified Pb(II), As(III), and Cd(II) aptamers were added to the three reaction regions, respectively. After adding 20 μL of the sample solution to the sample region and reacting for a period of time, 20 μL of 2 g / L OPD was added to the reaction region. The reaction was carried out for 10 min under the excitation of a 420 nm LED bead, thus achieving colorimetric detection of the target analyte. The nucleotide sequences of the amino-modified Pb(II), As(III) and Cd(II) aptamers are shown in SEQ ID NO: 1-3 in the sequence listing.

3. The method according to claim 1, characterized in that: A mobile phone holder (5) is movably connected to the upper end of the other side of the side wall (201), and a shooting hole is provided in the middle of the mobile phone holder (5).

4. The method according to claim 3, characterized in that: A light strip (303) is provided around the light diffuser (302).

5. The method according to claim 4, characterized in that: One side of the light shield (2) is hinged to the upper part of the power supply (1), and during the reaction, it covers the heating platform (101). A paper base (6) is provided on the heating platform (101).

6. The method according to claim 5, characterized in that: The light-diffusing plate (302) is circular. When the light source plate (3) is flipped above the top plate (202), the light source (301), the light-diffusing plate (302) and the light strip (303) are all inside the circular hole (203). The mobile phone holder (5) is used parallel to the top plate (202) or folded over and used on the upper part of the top plate (202). When folded, the shooting hole is above the circular hole (203).

7. The method according to claim 6, characterized in that: The active connection is a hinge, the power supply (1) includes a mobile power supply and an AC power supply, and the light source (301) is an LED lamp bead.

Images