A RUNX2 gene non-expressing xenotransplant donor pig and a preparation method thereof

Abstract

The application provides a xenotransplant donor pig without expression of a RUNX2 gene and a preparation method thereof, the RUNX2 gene can cause a risk of xenogeneic immune rejection, and the RUNX2 gene is knocked out by using a CRISPR / Cas9 system, it is verified that the non-expression of the RUNX2 gene can effectively reduce the binding ability of organs, tissues and / or cells of the donor pig to IgG and IgM of a recipient, improve the ability of the organs, tissues and / or cells of the donor pig to resist complement-mediated cytotoxicity of the recipient, and can prolong the survival time of the organs, tissues and / or cells of the donor pig in the recipient.

Description

Technical Field

[0001] The present application belongs to the field of animal genetic engineering, and specifically relates to a xenotransplantation donor pig that does not express the RUNX2 gene and a preparation method thereof. Background Art

[0002] Xenotransplantation of organs, tissues and cells from donors of different species can effectively solve the shortage of human donors. The advantages of xenotransplantation over autologous transplantation and allogeneic transplantation include that it can be supplied on a predictable non-emergency basis, produced in a controlled environment and can be used for characterization and research before transplantation. It has been confirmed in many literatures that among the xenotransplantation donor animal models, pigs have become the focus of most research in the field of xenotransplantation because pigs share many anatomical and physiological characteristics with humans. Pigs also have a relatively short gestation period, can be bred in a pathogen-free environment, and may not present the same ethical issues associated with animals that are not usually used as a food source.

[0003] However, current research results show that when pig organs are transplanted into humans, immune rejection reactions that are much more severe than autologous transplantation and allogeneic transplantation will occur, because there are many unknown risk factors that cause immune rejection, affecting the long-term survival of pig tissues or organs after implantation, including heterologous genes that cause rejection reactions.

[0004] Current research on the RUNX2 gene as follows: RUNX2 (full name RUNX family transcription factor 2) transcription factor, is a highly conserved member of the RUNX transcription factor family. RUNX2 is mainly expressed in the differentiation process of human NK cells. RUNX2 gene knockout inhibits the development of NK cells, and overexpression accelerates the production of mature NK cells. RUNX2 may regulate human NK cell differentiation by regulating IL-2Rβ expression. RUNX2 inhibits the expression of cytotoxic effector molecules and cytokines, and directly regulates tumor necrosis factor-α and its effector molecules. RUNX2 knockout leads to a significant decrease in the number of mouse NK cells. RUNX2 is also essential for the development of human NK cells in vivo. RUNX2 cooperates with ETS1 and T-box factors to control the development or function of NK cells. RUNX2 plays a key role in regulating normal development and tumorigenesis. RUNX2 plays a dependent factor role in a high-risk subtype of human T-ALL (T-cell acute lymphoblastic leukemia) by regulating tumor metabolism and leukemia cell migration, is essential for T-ALL survival, and its abnormal expression can enhance the dissemination of the disease. In function, RUNX2 induces CXCR4-mediated T-ALL cell migration. In more invasive cancer cells, RUNX2 can promote the transcription of genes that secrete proteins that help remodel the environment around the tumor, making it easier for cancer cells to escape. RUNX2-mediated changes occur in the late stages of cancer progression and metastasis, and the main oncogenic role has been described as the role of RUNX2 in tumor development. SUMMARY

[0005] The present application studies found that the RUNX2 gene can cause xenogeneic immune rejection risk, the RUNX2 gene does not express can effectively reduce the donor tissue and / or organ cells and the binding ability of the recipient IgG and IgM, improve the ability of donor tissue and / or organ cells to resist the recipient complement-mediated cytotoxicity, can prolong the survival time of donor tissue and / or organ after xenotransplantation. According to the above, the present application provides a xenotransplantation donor pig, the organ, tissue or cell of the donor pig does not express the RUNX2 gene, and the recipient is a human.

[0006] The RUNX2 gene not expressed in the present application can be realized by gene knockout, gene knock-in, point mutation, deletion mutation and their combinations.

[0007] The RUNX2 gene not expressed in the present application can be realized by gene silencing.

[0008] The gene knockout described in the present invention is achieved by the CRISPR-Cas9 gene knockout system. The system includes a RUNX2 gene knockout vector, including vector one and vector two. The vector one is connected to sgRNA A1, and the specific targeting sequence of the sgRNA1 is AGCACTCCATACCTCTACTA; the vector two is connected to sgRNA2, and the specific targeting sequence of the sgRNA2 is CAGCGTCAAC GCCATCATTC.

[0009] The method for constructing the RUNX2 gene knockout vector of the present invention is as follows:

[0010] The nucleotide sequence of the gene encoding the synthesized sgRNA1 is shown in SEQ ID NO. 1, and its complementary strand is shown in SEQ ID NO. 2. The single-stranded sgRNA DNA sequences are then annealed to form sgRNA1 oligonucleotide chains; the oligonucleotides are then ligated into the PX330 plasmid vector;

[0011] The nucleotide sequence of the gene encoding the synthesized sgRNA2 is shown in SEQ ID NO.3, and its complementary chain is shown in SEQ ID NO.4. The single-stranded sgRNA DNA sequence is then annealed to form an sgRNA2 oligonucleotide chain; the oligonucleotide is then ligated into the PX330 plasmid vector.

[0012] The RUNX2 gene knockout vector of the present invention is introduced into transformed cells, and the transformed cells are used to prepare donor pigs for xenotransplantation. The RUNX2 gene is not expressed in the organs, tissues or cells of the donor pigs.

[0013] The present invention also provides a method for preparing a xenotransplantation donor, comprising transplanting the transformed cells into a denuclearized egg cell to form a nuclear transplanted egg, and then transplanting the nuclear transplanted egg into the fallopian tube of a surrogate mother.

[0014] The present invention also provides a method for delaying, reducing or preventing rejection, separation or adverse reactions to xenotransplanted organs or tissues in human recipients, wherein the method comprises genetically modifying the RUNX2 gene of the donor pig's tissue or organ so that the RUNX2 gene of the donor pig or the donor pig's tissue or organ is not expressed.

[0015] The xenotransplantation donor organ of the present invention includes liver, lung, kidney or skin.

[0016] The xenotransplant donor tissue of the present invention includes nerves.

[0017] The beneficial effects are as follows:

[0018] The present invention discovers for the first time that the RUNX2 gene can cause the risk of xenotransplant rejection. Based on this, a xenotransplant donor is provided, in which the RUNX2 gene of the xenotransplant donor is not expressed through gene knockout or gene silencing. The non-expression of the RUNX2 gene can effectively reduce the binding ability of donor tissue and / or organ cells to human recipient IgG and IgM, improve the ability of donor tissue and / or organ cells to resist complement-mediated cytotoxicity of human recipients, and prolong the survival time of donor tissue and / or organ after xenotransplantation.

[0019] The present invention utilizes the CRISPR / Cas9 system to design dual sgRNA to knock out the RUNX2 gene. The obtained gene knockout cell line can be used as a donor for somatic cell nuclear transplantation. After RUNX2 knockout, the binding ability of pig kidney cells to human IgG and IgM can be effectively reduced, and the ability of pig kidney cells to resist human complement-mediated cytotoxicity can be improved, providing a favorable research tool for in-depth exploration of the biological function of the RUNX2 gene.

[0020] Knockout of the RUNX2 gene, a risk factor identified in the present invention, increases the probability of xenogeneic cell survival and further improves the feasibility of xenotransplantation. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the identification diagram of positive clone cells with RUNX2 gene knockout;

[0022] Figure 2 This is a graph showing the cell survival of wild pig kidney cells and RUNX2 knockout pig kidney cells after incubation with human serum;

[0023] Figure 3 This is a graph showing the binding ability of wild pig kidney cells and RUNX2-knockout pig kidney cells to human IgG and IgM. DETAILED DESCRIPTION

[0024] The present invention is further described by way of examples below, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or alteration of the present invention that can be easily implemented by a person skilled in the art will fall within the scope of the claims of the present invention.

[0025] Example 1: Construction of RUNX2 gene knockout vector.

[0026] RUNX2 gene knockout in porcine kidney cells was achieved using the CRISPR / Cas9 system, using sgRNAs including sgRNA1 and sgRNA2. The DNA sequence of sgRNA1 is shown in SEQ ID NO: 1, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 2; the DNA sequence of sgRNA2 is shown in SEQ ID NO: 3, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 4.

[0027] Two sgRNA sequences targeting the porcine RUNX2 gene (NCBI accession number: 100737965). sgRNA-F1 sequence: 5-CACCAGCACTCCATACCTCTACTA-3; SEQ ID NO: 1 sgRNA-R1 sequence: 5-AAACTAGTAGAGGTATGGAGTGCT-3; SEQ ID NO: 2 sgRNA-F2 sequence: 5-CACCCAGCGTCAACGCCATCATTC-3; SEQ ID NO: 3 sgRNA-R2 sequence: 5-AAACGAATGATGGCGTTGACGCTG-3. SEQ ID NO: 4

[0028] The designed sgRNA sequence was synthesized as follows: the DNA sequences of the four single-stranded sgRNAs were annealed to form two oligonucleotide chains of sgRNAs targeting different sites of the porcine RUNX2 gene; the oligonucleotides were then ligated into the PX330 plasmid vector to obtain the RUNX2 gene knockout vector.

[0029] Example 2: Preparation of RUNX2 gene knockout pig kidney cells.

[0030] After sequencing and verifying the constructed sgRNA expression vector, the target plasmid was extracted and ethanol precipitated. The purified sgRNA expression vector at a certain concentration was introduced into pig kidney cells via electroporation. After 12 hours of culture, the medium was changed. After 72 hours, the genome of each group of cells was extracted. Cell clones were obtained by limiting dilution. PCR reactions were then performed using specific primers. The PCR products were sequenced using agarose gel electrophoresis or sequencing. The sgRNA cleavage status of the cells was evaluated by sequencing peak analysis. The positive pure and knockout clones obtained were shown in Figure 2. Figure 1 .

[0031] Example 3: Detecting the resistance of RUNX2-knockout pig kidney cells to human complement-mediated cytotoxicity.

[0032] When the confluence of wild-type and RUNX2 knockout pig kidney cells reached approximately 70%, human serum was diluted in DMEM at a ratio of 1:3 and incubated with the cells. After 45 minutes, the supernatant was discarded, the cells were washed twice with PBS, and then stained with PI propidium iodide for 10 minutes. Subsequently, cell death was detected by flow cytometry. Figure 2 It can be seen that compared with PK cells, after incubation with 75% serum, RUNX2 gene knockout cells can significantly reduce the toxicity of human serum to pig cells.

[0033] Example 4: Detecting the binding ability of RUNX2-knockout pig kidney cells to human IgG and IgM.

[0034] Trypsinize wild-type and RUNX2 knockout pig kidney cells into 1.5 mL centrifuge tubes and wash twice with PBS. Dilute human serum inactivated at 56°C for 1 hour with PBS at a ratio of 1:4 and incubate the cells at room temperature. After 30 minutes, wash twice with PBS and add 1:200 diluted human IgG or IgM fluorescently labeled antibodies to the cells and incubate at room temperature for 30 minutes. After washing with PBS, flow cytometry was used to detect the binding capacity of RUNX2 knockout pig kidney cells to human IgG and IgM. Figure 3 It can be seen that compared with PK cells, the binding of RUNX2 gene knockout cells to human IgG or IgM is significantly reduced

[0035] The above examples show that knocking out the RUNX2 gene can effectively reduce the binding ability of pig kidney cells to human IgG and IgM, and improve the ability of pig kidney cells to resist human complement-mediated cytotoxicity.

[0036] The present invention also verifies the resistance of RUNX2 gene knockout pig lung cells and pig liver cells to human complement-mediated cytotoxicity and the ability to bind to human IgG and IgM through examples, and obtains the same conclusion as the pig kidney cell experiment.

[0037] The present invention also verifies through examples the resistance of RUNX2 gene-silenced pig kidney cells to human complement-mediated cytotoxicity and their ability to bind to human IgG and IgM, and obtains the same experimental conclusions as the gene knockout method.

[0038] The present invention also obtains transgenic pigs through the preparation method of transgenic pigs for xenotransplantation, transplants RUNX2 gene knockout pig kidney, lung or liver cells into denuclearized oocytes to form cell nucleus transplanted eggs, and transplants the obtained cell nucleus transplanted eggs into the oviduct of a surrogate pig, and the pregnant sows give birth to transgenic piglets for xenotransplantation. The piglets are used as donor animals for xenotransplantation of organs and cells between different species.

[0039] Therefore, the transgenic cloned pigs of the present invention can be used as donor animals for organ and cell transplantation between different species.

[0040] The vectors of the present invention may contain primer sequences, for example, a CAG promoter. Furthermore, any promoter capable of mammalian expression, such as the EF1α promoter, which is generally considered equivalent to the CAG promoter, may also be used. Furthermore, mammalian tissue-specific promoters, such as the ICAM2 promoter, may be used to express foreign genes using the CAG promoter as one type of gene expression promoter.

[0041] In the present invention, "transgenic" refers to the process of introducing DNA into a host and making it replicable as an extrachromosomal factor or through chromosomal integration. Transgenic includes any method for introducing nucleic acid molecules into an organism, cell, tissue or organ. It can be carried out by selecting appropriate standard techniques known in the relevant field according to the host cell, for example, including electroporation, calcium phosphate precipitation, calcium chloride precipitation, microinjection, polyethylene glycol method, DEAE-dextran method, cationic liposome method and lithium acetate-dimethyl sulfoxide method, but not limited to these. In order to distinguish the transformation of eukaryotic cells by plasmid or non-plasmid naked DNA from the transformation meaning of tumorization of cells, it is also called "transfection", which has the same meaning in the present invention.

[0042] The present invention provides a method for preparing a transgenic pig for xenotransplantation and a transgenic cloned pig for xenotransplantation produced by the method, comprising the steps of transplanting the transformed cell into a denuclearized oocyte to form a nucleus-transplanted egg; and transplanting the nucleus-transplanted egg into the oviduct of a surrogate mother.

[0043] In the present invention, "nuclear transplantation" refers to a gene manipulation technique that artificially combines the nuclear DNA of other cells with cells without nuclei to form the same traits, and methods known in the technical field to which the present invention belongs can be used.

[0044] In the present invention, "nuclear transplanted oocyte" refers to an oocyte into which a donor cell has been introduced or fused.

[0045] In the present invention, the "enucleated oocyte" refers to an oocyte from which the nucleus has been removed.

[0046] In the present invention, the term "organ" refers to a collection of tissues connected in a structural unit to perform a common function. An organ can be a solid organ. A solid organ is an internal organ with a fixed tissue consistency that is neither hollow (such as gastrointestinal organs) nor liquid (such as blood). Examples of solid organs include the heart, kidney, liver, lung, pancreas, spleen, and adrenal gland.

[0047] In the present invention, the term "tissue" refers to the cellular organization level intermediate between cells and organs. Tissue is a population of similar cells from the same origin that perform a specific function together. Organs are then formed by the functional aggregation of multiple tissues. Examples of tissues considered by the present invention include, but are not limited to, connective tissue, muscle tissue, neural tissue, epithelial tissue, and mineralized tissue. Blood, bones, tendons, ligaments, fat, and cellulite are examples of connective tissue, which can also be divided into fibrous connective tissue, skeletal connective tissue, and fluid connective tissue. Muscle tissue is divided into three different categories: visceral or smooth muscle, which is found in the inner walls of organs; skeletal muscle, which is usually attached to bones and produces large-scale movements; and cardiac muscle, which is found in the heart and contracts to pump blood through the organism. Cells containing central nervous system and peripheral nerve cells are classified as neural (or nerve) tissue. In the central nervous system, neural tissue forms the brain and spinal cord. In the peripheral nervous system, neural tissue forms cranial nerves and spinal nerves, including motor neurons.

[0048] As used herein, the terms "transformation" and "transfection" refer to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transformed" cell is one that has been transfected, transformed, or transduced with an exogenous nucleic acid. Such cells include the subject's primary cell and its progeny.

[0049] The present invention will be described in detail below by way of examples. The following examples are only provided to illustrate the present invention, and the present invention is not limited to the following examples.

Claims

1. A method for preparing a transgenic donor pig for xenotransplantation, comprising: transplanting the transformed cells into denuclearized oocytes to form nuclear transplanted eggs, and transplanting the nuclear transplanted eggs into the oviduct of a surrogate sow; The transformed cells are introduced with RUNX2 Gene knockout vector, the transformed cells are used to prepare donor pigs for xenotransplantation, the donor pigs RUNX2 Gene not expressed; The RUNX2 Gene non-expression is achieved through gene knockout; The RUNX2 The gene knockout vector includes vector 1 and vector 2: the vector 1 is connected to sgRNA1, whose specific targeting sequence is AGCACTCCATACCTCTACTA; the vector 2 is connected to sgRNA2, whose specific targeting sequence is CAGCGTCAACGCCATCATTC; The recipient of the organs, tissues or cells of the xenotransplantation donor pig is a human.

Images