Use of a hedgehog pathway inhibitor for the manufacture of a medicament for preventing or treating complications after arterial bypass surgery

By using the Hedgehog pathway inhibitor GDC-0449, the problems of vascular remodeling and restenosis after arterial bypass surgery were solved, significantly alleviating neointimal hyperplasia and stenosis, and improving the survival rate of patients with coronary heart disease.

CN117045795BActive Publication Date: 2026-01-09THE THIRD XIANGYA HOSPITAL OF CENT SOUTH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311014643.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-11
Publication Date
2026-01-09
Estimated Expiration
2043-08-11

AI Technical Summary

Technical Problem

In current technologies, the problems of vascular remodeling and restenosis after arterial bypass surgery have not been effectively solved. Traditional drug interventions such as antiplatelet therapy have side effects, while endothelial progenitor cell therapy is not effective, and the Hedgehog signaling pathway has not been used for molecular targeted therapy.

Method used

The Hedgehog pathway inhibitor GDC-0449 was used to inhibit the abnormal proliferation of smooth muscle cells and inflammatory response in endothelial cells through local administration. This included the use of compounds such as vemodilution in combination with antiplatelet drugs for treatment.

Benefits of technology

It significantly alleviated neointimal hyperplasia and stenosis after coronary artery bypass grafting, reduced abnormal proliferation of smooth muscle cells, improved the inflammatory state of blood vessels, and improved the survival rate of patients with coronary heart disease after coronary artery bypass grafting.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117045795B_ABST
    Figure CN117045795B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a pharmaceutical use of a Hedgehog pathway inhibitor in preventing and treating vascular remodeling and restenosis after an arterial bypass operation and improving the survival rate of a coronary heart disease patient after the arterial bypass operation. The abnormal proliferation of smooth muscle cells driven by endothelial cell activation can be obviously inhibited by the Hedgehog pathway inhibitor GDC-0449 intervention, and the inflammatory reaction can be effectively reduced. In the in-vivo experiment, the local application of GDC-0449 to the bypass artery can significantly relieve the remodeling and stenosis of the bypass artery, and provide a theoretical basis and strong support for the molecular targeted treatment strategy of the vascular remodeling and failure after the arterial bypass operation.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a pharmaceutical use of a Hedgehog pathway inhibitor in preventing and treating post-artery bypass surgery complications. BACKGROUND

[0002] Coronary artery bypass grafting (CABG) is an effective method for treating coronary heart disease, which can improve myocardial blood supply by repairing or replacing the blocked coronary artery. According to the source of the blood vessels used for transplantation, coronary revascularization is generally divided into vein transplantation, allogeneic artery transplantation and autologous artery bypass. Vein transplantation is widely used and was the first to be applied to coronary artery bypass grafting to treat severe coronary heart disease. Compared with artery transplantation, vein transplantation is easier to obtain and causes less damage to patients in clinical practice, but postoperative vein grafts can cause postoperative acute stenosis due to thrombosis. In addition, intimal hyperplasia and atherosclerosis can cause vein grafts to thicken, which can also cause vascular stenosis and occlusion in the late stage of transplantation. Therefore, the long-term patency rate of vein grafts is only 50-60%, which is significantly lower than that of artery transplantation. However, the long-term patency rate of allogeneic artery transplantation is higher than that of vein transplantation, but the severe graft atherosclerosis caused by immune activation also restricts its clinical application. Autologous artery bypass has gradually become the most common choice for bypass surgery due to its higher long-term patency rate and lower immune activation response. However, autologous artery bypass can still cause slow progression of delayed vascular remodeling and restenosis due to endothelial activation and dysfunction. How to effectively prevent or intervene in vascular remodeling and restenosis after artery bypass is always a key problem to improve the long-term survival rate of patients with coronary heart disease.

[0003] Drug intervention plays a key role in the secondary prevention after artery bypass, and anti-platelet therapy is still the cornerstone for improving the prognosis of artery bypass and reducing the failure rate of bypass arteries. However, anti-platelet drugs have strong side effects such as causing bleeding, nausea and vomiting, and liver function damage. In addition to traditional drug intervention strategies, endothelial progenitor cell / colony-forming cell (EPCs / ECFCs) therapy is also a potential means to promote endothelial repair in bypass arteries. However, the effect of EPC treatment in clinical trials is not ideal. EPC treatment promotes re-endothelialization of the stent surrounding blood vessels after PCI, but it aggravates inflammatory activation and endothelial hyperplasia [1] ; in addition, some subgroups of circulating endothelial EPCs are actually immune phenotypes of mononuclear cells and do not play a role in repairing damaged endothelium, which explains why EPC treatment aggravates inflammatory response [2] . In view of the current bottleneck in cardiovascular drug secondary prevention and stem / progenitor cell targeted therapy after artery bypass surgery, it is urgent to further find a more optimized means to prevent or alleviate vascular remodeling and restenosis in bypass arteries.

[0004] Hedgehog (Hh) signaling molecules are secreted, locally acting protein ligands with a range of action of typically no more than 20 cells. In mammals, there are three Hedgehog homologous genes: Sonic Hedgehog (Shh), Indian Hedgehog (Ihh) and Desert Hedgehog (Dhh), which encode Shh, Ihh and Dhh proteins, respectively. The full-length Shh protein is synthesized in the source cell as a precursor protein and is autocatalytically cleaved into N-terminal and C-terminal products. N-Shh is soluble and has signal activity, and C-Shh binds the hydrophobic cholesterol residue to N-Shh after cleavage, which limits it in the source cell to prevent free diffusion. In many developmental processes of vertebrates and invertebrates, the Hedgehog signaling pathway controls cell fate, proliferation and differentiation, and abnormal activation of the Hh signaling pathway is related to the development of basal cell carcinoma, medulloblastoma and rhabdomyosarcoma, pancreatic cancer, lung cancer, prostate cancer, ovarian cancer and breast cancer. However, the prior art has not reported that the Hedgehog signaling pathway is a target for molecular targeted therapy of blood vessel remodeling and failure after arterial bypass surgery.

[0005] [1]Tongers J,Losordo D,Landmesser U.Stem and progenitor cell-based therapy in ischaemic heart disease:promise,uncertainties,and challenges[J].European heart journal,2011,32(10):1197-206.

[0006] [2]Rehman J,Li J,Orschell C,et al.Peripheral blood"endothelial progenitor cells"are derived from monocyte / macrophages and secrete angiogenic growth factors[J].Circulation,2003,107(8):1164-9. SUMMARY

[0007] In order to solve the above problems, the application provides a pharmaceutical use of a Hedgehog pathway inhibitor in preventing and treating vascular remodeling and restenosis after an arterial bypass operation, and improving the survival rate of a coronary heart disease patient after an arterial bypass operation. The abnormal proliferation of smooth muscle cells driven by the activation of endothelial cells can be obviously inhibited by the Hedgehog pathway inhibitor GDC-0449 intervention, and the inflammatory response can be effectively reduced; the local application of GDC-0449 to the bypass artery in the in-vivo experiment can significantly relieve the remodeling of the bypass artery of the mouse.

[0008] The application provides an application of a Hedgehog pathway inhibitor in preparing a drug for preventing and treating complications after an arterial bypass operation.

[0009] Specifically, the Hedgehog pathway inhibitor includes but is not limited to one or more of vismodegib, cyclopamine or glargine.

[0010] Preferably, the Hedgehog pathway inhibitor can be vismodegib.

[0011] Specifically, the complications after the arterial bypass operation include but are not limited to vascular remodeling and / or failure.

[0012] Further specifically, the vascular remodeling refers to a active process of the change of the structure of the blood vessel, including cell proliferation, cell apoptosis, cell migration and the production and degradation process of the extracellular matrix, and is related to the interaction between local growth factors, vasoactive substances and hemodynamics.

[0013] The vascular failure is not a structural lesion, but a vascular dysfunction syndrome developed from the high-risk factors leading to atherosclerosis, and further development can lead to a series of vascular events accompanied by arterial stenosis and vascular wall calcified plaques or due to the rupture of the arterial plaque or thromboembolism.

[0014] Specifically, the Hedgehog pathway can be a Sonic hedgehog pathway.

[0015] Further specifically, the Sonic hedgehog pathway is N-Shh which is active after the maturation of Sonic hedgehog.

[0016] More specifically, the Sonic hedgehog (Shh) full-length protein is synthesized in a source cell and is autocatalytically cleaved into N-terminal and C-terminal products after the synthesis as a precursor protein, and the N-Shh is the N-terminal product and has signal activity.

[0017] Specifically, the RIPK1 regulates the secretion of N-Shh through phosphorylation of EEF1AKMT3.

[0018] Further specifically, the phosphorylation site of EEFlAKMT3 is S26.

[0019] Specifically, the drug further comprises a pharmaceutically acceptable excipient.

[0020] Further specifically, the pharmaceutically acceptable excipient is selected from one or more than two combinations of wetting agents, emulsifiers, preservatives, antioxidants, buffers, excipients, diluents, lubricants, bacteriostatic agents, solutes that make the preparation isotonic with the blood of the recipient, suspending agents, suspending agents, solubilizers, thickening agents, stabilizers, sweeteners, and spices.

[0021] Preferably, the pharmaceutically acceptable excipient is at least one selected from lactose, mannose, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, fine crystalline cellulose, polyvinylpyrrolidone, cellulose, water, sugar syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0022] Specifically, the drug dosage form includes but is not limited to: solution, tincture, spirit, powder, lotion, oil, emulsion, ointment, paste, plaster, film coating agent, gel or aerosol.

[0023] Preferably, the drug dosage form is a gel.

[0024] Specifically, the drug administration method can be local administration.

[0025] Further specifically, the local administration is applied to the adventitia of the blood vessels.

[0026] Specifically, the drug can be administered simultaneously with an anti-platelet drug.

[0027] Further specifically, the anti-platelet drug can be selected from thromboxane A2 inhibitors, thienopyridines, non-thienopyridines, thrombin receptor antagonists, and / or 5-hydroxytryptamine receptor antagonists.

[0028] Preferably, the thromboxane A2 inhibitor has the function of platelet activation and vasoconstriction, has strong mobility, and activates platelets through intracellular calcium ion increase.

[0029] Further preferably, the thromboxane A2 inhibitor is aspirin.

[0030] Preferably, the thienopyridine includes but is not limited to: clopidogrel or prasugrel.

[0031] Preferably, the non-thienopyridine includes but is not limited to: ticagrelor or cangrelor.

[0032] Preferably, the thrombin receptor antagonists include but are not limited to: Atopaxar.

[0033] Preferably, the 5-hydroxytryptamine receptor antagonists include but are not limited to: Sarpogrelate or Citalopram.

[0034] The technical effects achieved by the present application are:

[0035] (1) HE staining showed that the neointimal hyperplasia and stenosis of the bypass artery were significantly relieved after local administration of GDC-0449, and the abnormal proliferation of smooth muscle cells was reduced; and the inflammatory activation state of the blood vessels was also significantly improved.

[0036] (2) The endothelial cell activation-driven smooth muscle cell proliferation was significantly inhibited after GDC-0449 intervention; GDC-0449 can also inhibit the proliferation of smooth muscle cells under N-Shh intervention. BRIEF DESCRIPTION OF DRAWINGS

[0037] Figure 1 It is a comparison chart of the stenosis of the bypass artery of the wild-type mouse model at different times, wherein A is a general schematic diagram of the bypass artery, and the red arrow mark indicates the main part of the pathological stenosis; B is an HE pathological section diagram of the bypass artery at different times; C is a statistic of B; D is an immunofluorescence staining diagram of the RIPK1 protein expression of the bypass artery; and E is an immunofluorescence staining diagram of the RIPK1 phosphorylation of the bypass artery.

[0038] Figure 2 It is a potential target point screened by using a cytokine chip after the endothelial cells are knocked out of RIPK1, wherein A is the expression level of the cytokines secreted by the endothelial cells after the RIPK1 is knocked out; B is a fluorescence dot array diagram of the cytokine chip, and the enlarged area is the antibody dot array of N-Shh.

[0039] Figure 3 It is a comparison chart of the stenosis of the bypass artery of the RIPK1 endothelial-specific knockout mouse model before and after administration, wherein A is an HE pathological section diagram of the RIPK1 endothelial-specific knockout mouse model before and after administration; B is a statistic of A; and C is an immunofluorescence staining diagram of the smooth muscle cells of the RIPK1 endothelial-specific knockout mouse model before and after administration.

[0040] Figure 4Figure 1A is a graph showing the transcription factor Gli1 mRNA level in smooth muscle cells after treatment with Shh signaling pathway activator SAG and Shh inhibitor GDC-0449. Figure 1B is a graph showing the proliferation marker Ki67 immunofluorescence staining and statistics of smooth muscle cells after treatment with GDC-0449 under co-culture condition with endothelial cells. Figure 1C is a graph showing the proliferation marker Ki67 immunofluorescence staining and statistics of smooth muscle cells after treatment with active protein N-Shh and inhibitor GDC-0449.

[0041] Figure 5 Figure 2A is a graph showing the immunofluorescence staining and statistics of Gli1 protein expression, which is a downstream signal of Shh signaling pathway activation, in wild-type mice and RIPK1 endothelial-specific knockout mice under arterial bypass model. Figure 2B is a graph showing the immunofluorescence staining of Shh protein expression in wild-type mice and RIPK1 endothelial-specific knockout mice under arterial bypass model.

[0042] Figure 6 Figure 3A is a graph showing the exogenous Flag-EEF1AKMT3 protein pulled down by HA antibody. Figure 3B is a graph showing the exogenous HA-RIPK1 protein pulled down by Flag antibody. Figure 3C is a graph showing the endogenous RIPK1 protein pulled down by EEF1AKMT3 antibody.

[0043] Figure 7 Figure 4A is a graph showing the chemical modification of phosphate group provided by ATPγS and specifically recognized by Thiophosphate-ester antibody. Figure 4B is a graph showing the phosphate group provided by ordinary ATP and specifically recognized by EEF1AKMT3 S26 phosphorylation antibody.

[0044] Figure 8 Figure 5 is a graph showing the immunofluorescence staining and statistics of EEF1AKMT3 S26 phosphorylation antibody in wild-type mice and RIPK1 endothelial-specific knockout mice under arterial bypass model.

[0045] Figure 9To verify the effect of RIPK1 and EEF1AKMT3 on protein synthesis in endothelial cells, A is to detect the synthesis of nascent peptide chains of endothelial cells using anti-puromycin antibody after siRNA knockdown of RIPK1, EEF1AKMT3 or EEF1A under puromycin-stimulated conditions; B is to detect the synthesis of nascent peptide chains of endothelial cells using anti-puromycin antibody after siRNA knockdown of EEF1AKMT3 and back-supplementation of wild-type EEF1AKMT3 protein or EEF1AKMT3-S26A phospho-inactivation mutant.

[0046] Figure 10 To verify the effect of EEF1AKMT3 S26 phosphorylation on the ability to methylate its downstream substrate EEF1A in vitro methylation experiments.

[0047] Figure 11 To detect the regulation of RIPK1 and EEF1AKMT3 on N-Shh protein secretion in endothelial cells by ELISA, A is the secretion of N-Shh in endothelial cells after siRNA knockdown of RIPK1, EEF1AKMT3 or EEF1A; B is the secretion of N-Shh in endothelial cells after knockdown of EEF1AKMT3 and back-supplementation of wild-type EEF1AKMT3 protein or EEF1AKMT3-S26A phospho-inactivation mutant.

[0048] For all statistical values in the above figures, *P<0.05, **P<0.01, ***P<0.001; "+" in the figure represents that each group in the figure is given the corresponding treatment in the figure, and "-" represents that each group in the figure is not given the corresponding treatment in the figure. DETAILED DESCRIPTION

[0049] The application will be further described in conjunction with specific examples, and the following examples are not used to limit the application, but only to illustrate the application. Unless otherwise specified, the experimental methods used in the following examples are generally carried out under conventional conditions, and the materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0050] Nouns and terms:

[0051] Receptor-interacting protein kinase 1 (RIPK1): is an important mediator of various signaling pathways activated by the death receptor family and pattern recognition receptors. RIPK1 contains an N-terminal kinase domain, a C-terminal death domain (DD) and an intermediate domain containing a RIP homotypic interaction motif (RHIM).

[0052] Hedgehog: Hedgehog (Hh) signaling molecule is a local protein ligand secreted by signal cells, with a small range of action, generally not more than 20 cells. In many development processes of vertebrates and invertebrates, the Hedgehog signaling pathway controls cell fate, proliferation and differentiation, and when the signaling pathway is abnormally activated, it will cause the occurrence and development of tumors.

[0053] Sonic Hedgehog (SHH): one of the three Hedgehog homologous genes, is an important shape of embryonic morphogenesis and adult homeostasis.

[0054] N-Shh: Sonic hedgehog (Shh) full-length protein is synthesized in source cells as a precursor protein and is autocatalytically cleaved into N-terminal and C-terminal products, and N-Shh is the N-terminal product and has signal activity.

[0055] Vismodegib in the application is also known as GDC-0449.

[0056] The main instruments and reagents in the application are as follows:

[0057] Main instruments: qPCR instrument (Bio-Rad); enzyme marker (Perkin); fluorescence inverted microscope (Olympus); frozen section machine (Leica); electrophoresis instrument (Bio-Rad).

[0058] HE staining kit: manufacturer: Biyun Tian, article number: C0105M.

[0059] Cytokine chip: manufacturer: Raybiotech, article number: AAH-BLG-L-507.

[0060] Raybiotech cytokine kit: manufacturer: Raybiotech, article number: R96334.

[0061] Reverse transcription kit: manufacturer: Thermo Fisher Scientific, article number: K1691.

[0062] ELISA kit: manufacturer: Sino Biological, article number: 10372-MM05.

[0063] RNA extraction kit: manufacturer: Biyun Tian, article number: R0077S.

[0064] Real-time fluorescent quantitative PCR kit: manufacturer: Bio-Rad, article number: 1725125.

[0065] Example 1 Sonic Hedgehog inhibitor GDC-0449 targets inhibition of smooth muscle cell proliferation and arterial bypass remodeling

[0066] Experimental animals:

[0067] The C57BL / 6J mice used in this experiment were purchased and raised in the Department of Experimental Animal Science of Central South University, with the experimental unit license number: SYXK(Xiang)2015-0017, and the experimental animal purchase unit license number: SCXK(Xiang 2016-0002). The vascular endothelial cell-specific RIPK1 knockout transgenic mice were constructed by Jiangsu Jicui Yekang Biotechnology Co., Ltd. The RIPK1f / f mice were constructed using the CRISPR / Cas9 method (strain background: C57BL / 6J, Strain NO. T005427), and were mated with Cdh5-cre mice (strain background: C57BL / 6J, Strain NO. T004712) to finally obtain RIPK1 flox positive and Cre positive mice (RIPK1 f / f; Cdh5-Cre; RIPK1-Cdh5cKO mice).

[0068] 1.1 Construction of mouse autologous arterial bypass model

[0069] The mouse autologous arterial bypass model was constructed (the construction method was a mature experimental method already owned by the team, and the relevant content was published in Xu Q et al. Impact of Local Alloimmunity and Recipient Cells in Transplant Arteriosclerosis. Circ Res. 2020 Sep 25; 127(8): 974-993. doi: 10.1161 / CIRCRESAHA.119.316470. Epub 2020 Jul 21. PMID: 32689904.). The pathological characteristics of the bypass artery were observed by bypass artery frozen section and HE pathological staining, immunofluorescence staining, etc.

[0070] The specific steps of HE staining are performed according to the kit instructions. For immunofluorescence staining, the following operations are performed: (1) rewarming the slide: take the frozen section box out of the -20°C refrigerator, select the appropriate section, and insert it into the staining rack at room temperature for 10 minutes for rewarming; wash with PBS solution on the shaker for 3 times, 5 minutes each time, and then wash with flowing tap water for 5 minutes to completely wash away the attached OCT glue; (2) tissue penetration: soak the washed OCT section in 0.2% Triton X-100 for 10 minutes to penetrate the membrane, and then wash with PBS on the shaker for 3 times, 5 minutes each time; (3) blocking: carefully shake off the water droplets on the slide and dry the residual liquid with a dust-free paper, draw a circle around the tissue piece with an immunohistochemical pen, and drop 5% BSA, and block at room temperature for 30 minutes in a wet box; (4) primary antibody incubation: prepare the primary antibody in advance with 1% BSA, and 20-40 μL of antibody solution is required for each tissue area (the volume ratio of the antibody is selected according to the recommended concentration or the pre-experiment of different concentration gradients); after the blocking is completed, wash once with PBST, shake dry, and wash away the residual liquid on the slide, drop the diluted antibody working solution, and incubate overnight in a wet box at 4°C in the dark; (5) secondary antibody incubation: take the wet box back to room temperature for rewarming for one hour in the dark, wash with PBST on the shaker for 3 times, 5 minutes each time. Prepare the corresponding fluorescent secondary antibody in advance with 1% BSA in the dark, and incubate at 37°C for one hour in the dark; (6) nucleus staining: after washing with PBST, drop DAPI, and incubate for 10-15 minutes in the dark; (7) mounting: after washing and shaking dry, drop 2 drops of anti-fluorescence quenching mounting medium in the tissue area, carefully chase out the bubbles with a cover glass, and brush a little nail polish on the edges of the cover glass for mounting; (8) photographing and analysis: take pictures under the fluorescence microscope in the darkroom, select the appropriate magnification, focusing conditions, and field of view, and take pictures.

[0071] In this example Figure 1 To observe the stenosis of the wild-type mouse artery bypass model at different times. It was found that the wild-type mouse bypass artery had obvious stenosis in the area mainly gathered in the first third of the anastomosis end Figure 1 A) of the specification; the bypass artery began to gradually develop neointimal hyperplasia and lumen stenosis at 4 weeks, and was more obvious at 8 weeks Figure 1 B-C) of the specification. The co-staining of endothelial cell markers CD31 (77699, CST) and RIPK1 (3493, CST) proteins suggested that the expression of RIPK1 was up-regulated in the stenosis of the bypass artery Figure 1 D) of the specification, and the expression of its kinase-activated form pRIPK1 (44590, CST) was also up-regulated Figure 1 E) of the specification.

[0072] 1.2 Cytokine chip screening of endothelial cell knockout RIPK1 related secreted proteins

[0073] After the aforementioned changes were observed, the next step was to screen for cytokines regulated by endothelial cell RIPK1. siRNA (purchased from Genomed, sequence: 5'-3': UGCUCUUCAUUAUUCAGUUUGCUCCAC (SEQ ID NO. 1)) was transfected into endothelial cells to knock out RIPK1, and the conditioned medium was collected for cytokine chip screening. The experimental steps are as follows:

[0074] (1) HUVEC (purchased from the National Biomedical Experimental Cell Resource Bank) was seeded in a 10 cm culture dish, and when the confluence reached 60%-70%, siCtrl / siRIPK1 was transfected (transfection method see Leung SW et al. siRNA Versus miRNA as Therapeutics for Gene Silencing. Mol Ther Nucleic Acids. 2015 Sep 15; 4(9): e252. doi: 10.1038 / mtna.2015.23. PMID: 26372022; PMCID: PMC4877448.);

[0075] (2) After 6-8 hours of transfection, the medium was changed to complete medium, and the culture was continued for 24 hours; the old medium was discarded, and the cells were washed with PBS 3 times, 5 mL of serum-free medium was added to each 10 cm culture dish, and the culture was continued for 24 hours;

[0076] (3) All the culture media were collected, centrifuged at 14000 rpm at 4°C for 10 minutes, 4 mL of supernatant was collected from each culture dish, and the grouping was labeled;

[0077] (4) The cell cryotubes were divided, quickly frozen in liquid nitrogen, and stored at -80°C;

[0078] (5) The HUVEC in the original culture dish was lysed with RIPA prepared in advance, and the protein was extracted for knockdown verification. After the knockdown effect was verified, the conditioned medium was sent to Huaying Bio for cytokine chip (L-507) analysis.

[0079] The experimental results are shown in Figure 2 , after specific knockdown of endothelial cells, the secretion of Shh signaling pathway signal protein N-Shh was significantly increased Figure 2 A and B).

[0080] 1.3 In situ targeting of Sonic Hedgehog pathway in bridging artery

[0081] 20% Pluronic F-127 gel:

[0082] Prepare 1x PBS in advance and pre-cool in 4°C cold room. Weigh 2 g Pluronic F-127 (P2443, Sigma) powder into 10 mL pre-cooled PBS, rotate overnight at 4°C, sterilize after completely dissolved the next day, and store at 4°C. When using, add GDC-0449 (S1082, Selleck) to prepare a drug sol of appropriate concentration on ice in a clean bench, rotate overnight at 4°C to fully dissolve GDC-0449.

[0083] To determine whether RIPK1-regulated N-Shh has an impact on graft arteriopathy remodeling, we next locally applied the Shh signaling pathway inhibitor GDC-0449 in the grafting operation. The RIPK1-Cdh5 cKO→WT (with RIPK1-Cdh5 cKO mouse aorta as donor transplantation, to wild-type mice) grafting model (see Xu Q et al. Impact of Local Alloimmunity and Recipient Cells in Transplant Arteriosclerosis. Circ Res. 2020 Sep 25; 127(8): 974-993. doi: 10.1161 / CIRCRESAHA.119.316470. Epub 2020 Jul 21. PMID: 32689904. for the construction method of the model) was randomly divided into experimental and control groups. The experimental group was coated with 20% Pluronic F-127 + GDC-0449 on the adventitia of the grafting blood vessels after the grafting operation was sutured firmly; the control group was coated with 20% Pluronic F-127 + DMSO on the adventitia of the grafting blood vessels. After 8 weeks, the mice were euthanized, the grafting arteries were taken to prepare frozen sections and HE staining was performed. The HE staining steps were performed according to the kit instructions.

[0084] The experimental results are shown in Figure 3 HE staining showed that after local administration of GDC-0449, neointimal hyperplasia and graft arteriopathy stenosis were significantly alleviated Figure 3 A, B), and abnormal smooth muscle cell proliferation was reduced Figure 3 C).

[0085] 1.4 Sonic Hedgehog inhibitor GDC-0449 targets and inhibits smooth muscle cell proliferation and graft arteriopathy remodeling

[0086] We also demonstrated the inhibitory effect of GDC-0449 on endothelial RIPK1-regulated smooth muscle cell proliferation. We first verified the effectiveness of GDC-0449 in inhibiting Shh signaling pathway activation at the cellular level. RNA was extracted to detect the transcription of Gli1, a downstream signaling protein of the Shh pathway, after GDC-0449 intervention in smooth muscle cells. Experimental methods followed the instructions of the RNA extraction kit and real-time quantitative PCR kit. Primers were: F: CAGCACCACCTCGACTTCT (SEQ ID NO. 2); R: CCTAGCCTGCCCACCTC (SEQ ID NO. 3).

[0087] The experimental results are shown in Figure 4 After activating the Shh pathway with SAG (S6384, Selleck), the level of Gli1 mRNA in smooth muscle cells was significantly increased; however, after intervention with different concentrations of GDC-0449, the level of Gli1 mRNA was significantly decreased, suggesting that the Sonic Hedgehog pathway in smooth muscle cells can be significantly inhibited by GDC-0449. Figure 4 A in the middle.

[0088] 1.5 Endothelial cell-smooth muscle cell co-culture

[0089] Next, the regulatory effect of GDC-0449 on RIPK1-mediated smooth muscle cell proliferation was clarified through indirect co-culture of endothelial cells and smooth muscle cells (smooth muscle cells were purchased from Huatuo Biotechnology, catalog number HTX2073; endothelial cells were purchased from the Cell Resource Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, catalog number: 1101HUM-PUMC000437). Endothelial cell-smooth muscle cell co-culture was performed using a 24-well Transwell plate system with 0.4 μm cells. Smooth muscle cells were digested with trypsin, resuspended in complete culture medium, and cell counts were performed. The cell concentration was adjusted to 10⁻⁶ cells based on the cell count. 4 / 100μL; Fill a 24-well plate with the Transwell chamber and invert it, then aspirate 50μL of cell suspension (cell count 5×10⁻⁶). 3 Carefully drop the solution onto the convex membrane of the transwell chamber; cover the 24-well plate, carefully transfer it into the cell culture incubator, and keep the convex side of the transwell chamber facing upwards overnight until the smooth muscle cells adhere; after the smooth muscle cells have adhered, add 500 μL of complete culture medium to the 24-well plate; prepare the digested endothelial cells and count them, then add 10... 4Endothelial cells were seeded on the lower membrane of transwell chamber and cultured for 3 days before smooth muscle cells were stained for Ki67 (staining method see Lou Z et al. The AMPK-Parkin axis negatively regulates necroptosis and tumorigenesis by inhibiting the necrosome. Nat Cell Biol. 2019 Aug;21(8):940-951. doi: 10.1038 / s41556-019-0356-8. Epub 2019 Jul 29. PMID: 31358971; PMCID: PMC6679774.).

[0090] The experimental results are shown in Figure 4 , and it was found that the proliferation of smooth muscle cells induced by endothelial cell knockout of RIPK1 was significantly inhibited after intervention with GDC-0449 (B in Figure 4 ); in addition, GDC-0449 can also inhibit the proliferation of smooth muscle cells directly intervened by active N-Shh recombinant protein (10372-H08H1, Sino Biological) (C in Figure 4 ).

[0091] 1.6 Activation of N-Shh downstream pathway in bypass artery after endothelial cell-specific knockout of RIPK1

[0092] We also observed the activation of the Shh signaling pathway in the pathological changes of the bypass artery in the bypass artery model. The steps for immunofluorescence staining are the same as those in 1.1. Gli1 (2534, CST) immunofluorescence staining of the bypass artery showed that Gli1 was not expressed in the bypass artery of wild-type mice, but was significantly up-regulated in the bypass artery of endothelial cell-specific knockout of RIPK1 (A in Figure 5 ), and the total protein expression of Shh (ab135240, abcam) in the endothelium was up-regulated (B in Figure 5 ), indicating that the N-Shh downstream pathway in the bypass artery was activated after endothelial cell-specific knockout of RIPK1, and it was reasonable and feasible to use GDC-0449 to target and inhibit the Shh signaling pathway to improve the bypass artery remodeling.

[0093] From the above, we jointly proved in vivo and in vitro that endothelial cells regulate smooth muscle cell proliferation and bypass artery remodeling by secreting N-Shh, and that the application of DGC-0449 to target Shh signaling pathway activation can effectively improve neointimal hyperplasia and vascular remodeling.

[0094] Example 2 Co-immunoprecipitation (co-IP) and in vitro kinase assay to confirm that EEF1AKMT3 is phosphorylated by RIPK1 at S26 site

[0095] To further demonstrate the reason and mechanism of endothelial cell RIPK1 regulating N-Shh secretion, co-immunoprecipitation and in vitro kinase assay were performed in this embodiment to explore the potential mechanism of RIPK1 regulating N-Shh secretion.

[0096] 2.1 Co-immunoprecipitation experiment

[0097] First, the potential interacting proteins of RIPK1 were screened through the BIOPLEX database (https: / / bioplex.hms.harvard.edu / explorer / ), and EEF1AKMT3 was anchored because of its close relationship with protein synthesis translation. Exogenous Flag-EEF1AKMT3 and HA-RIPK1 were transfected in 293T tool cells, and the interacting proteins RIPK1 and EEF1AKMT3 were pulled down with Flag antibody (20543-1-AP, Proteintech) and HA antibody (AE008, Abclonal), respectively (Fig. 1A, B). Figure 6 At the same time, Abclonal Company was commissioned to construct EEF1AKMT3 antibody for IP experiment in this embodiment and subsequent verification.

[0098] The method for constructing EEF1AKMT3 antibody is as follows:

[0099] (1) PCR was performed with Flag-EEF1AKMT3 plasmid as template to amplify 1-226aa fragment; Gibson cloning was performed with pET-28a-SUMO expression vector, in which the exogenous Tag was about 18kda, including His-Tag (6aa), T7-Tag (11aa) and SUMO-Tag (101aa).

[0100] (2) E. coli Rosetta strain was used for prokaryotic system induced expression of protein.

[0101] (3) The inclusion body expressing pET-28a-SUMO-EEF1AKMT3 (1-226aa) was immunized with experimental grade Japanese white rabbits. The first immunization was stimulated with 0.3 mg complete Freund's adjuvant, and the immunization cycle was 1 day; subsequently, 0.15 mg incomplete Freund's adjuvant was used for immunization stimulation at 12th day, 26th day and 40th day, and blood was collected at 52th day.

[0102] (4) pET-28a-SUMO-EEF1AKMT3 (1-226aa) was coated by ELISA at a concentration of 2ug / mL, 25uL / well, and diluted with 1×PBS. 100μL of immune serum samples from each group were added to the wells for antigen-antibody capture, and secondary antibody labeling was performed using Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) at a concentration of 1:5000. The serum titer was determined when the OD value was greater than 0.4.

[0103] (5) Antigen protein pET-28a-SUMO-EEF1AKMT3 (1-226aa) was used to perform antigen affinity purification with immune serum to obtain concentrated antibody. In HUVEC, endogenous IP was performed using EEF1AKMT3 antibody and RIPK1 antibody (610459, BD) (IP method see Yuan J et al. RIPK1 Promotes Energy Sensing by the mTORC1Pathway. Mol Cell. 2021 Jan 21;81(2):370-385.e7.doi:10.1016 / j.molcel.2020.11.008.Epub 2020 Dec 2.PMID:33271062.), and it was found that endogenous EEF1AKMT3 in endothelial cells can interact with RIPK1 ( Figure 6 (C in the middle).

[0104] 2.1 In vitro kinase assay

[0105] After confirming the interaction between RIPK1 and EEF1AKMT3, the mechanism of action of RIPK1 on EEF1AKMT3 was further verified through in vitro kinase assays. The specific steps are as follows:

[0106] (1) Add 250ng of activated kinase protein RIPK1 (R07-11G, SignalChem), 1μg of in vitro purified protein Flag-EEF1AKMT3, 3μL of PNBM (50mM) (ab138910, Abcam), and 6μL of ATPγS (10mM) (ab138911, Acam) to a 60μL reaction system, shake to mix, and quickly place in a shaking metal bath at 1500rpm and 30℃ for 30 minutes;

[0107] (2) After 30 minutes of shaking incubation, 0.6 μL of 1 M EDTA was added to quench the alkylation reaction; the sample was diluted to 100 μL with SDS-PAGE loading buffer, heated in a metal bath at 95 °C for 5 minutes, and subjected to subsequent Western blot analysis using Anti-Thiophosphate ester antibody (ab92570, Abeam) that specifically recognizes the alkylation phosphate group.

[0108] In vitro kinase experiments activated by ATPγS showed that EEFlAKMT3 could be directly phosphorylated by RIPK1, and this phosphorylation phenomenon could be greatly weakened by the kinase-inactive form of EEFlAKMT3 mutated at the S26 site (S26A) Figure 7

[0109] EEFlAKMT3 S26 phosphorylation antibody was constructed by immunizing a Japanese white rabbit (Abclonal) with the 21-30 aa synthetic modification polypeptide RLFTD(S-p)YSES-C coupled to KLH against the modification at the S26 site (specific method as in the in vitro kinase experiment (1)-(2) in 2.1 above) to recognize the phosphorylation of EEFlAKMT3 by RIPK1. In vitro kinase experiments activated by ATP also confirmed that EEFlAKMT3 was phosphorylated at the S26 site by RIPK1 Figure 7

[0110] In addition, EEFlAKMT3 S26 phosphorylation antibody was also used to detect EEFlAKMT3 phosphorylation in the bypass artery. The immunofluorescence staining procedure was the same as in 1.1, and immunofluorescence staining of the bypass artery showed that S26 phosphorylation of EEFlAKMT3 caused by RIPK1 activation occurred significantly in the bypass artery of wild-type mice; after endothelial cell-specific knockout of RIPK1, EEFlAKMT3 did not appear S26 phosphorylation due to the absence of RIPK1, and at this time, pathological remodeling of the bypass artery and abnormal proliferation of smooth muscle cells were significantly present Figure 8

[0111] The above experiments in Example 2 collectively confirmed that RIPK1 phosphorylates EEFlAKMT3-S26 and regulates bypass artery remodeling through this phosphorylation modification.

[0112] Example 3 Endothelial cell RIPK1 phosphorylation of EEFlAKMT3-S26 mediates EEFlA methylation changes to regulate N-Shh secretion

[0113] ​​​To further clarify how RIPK1 phosphorylation of EEF1AKMT3-S26 specifically regulates the bridging artery remodeling, the core molecular mechanism of endothelial cell RIPK1 regulating N-Shh secretion was jointly demonstrated by SUnSET (Surface sensing of translation) ribosome protein synthesis experiment, in vitro methylation experiment and ELISA in this embodiment.

[0114] 3.1 SUnSET (Surface sensing of translation) ribosome protein synthesis experiment

[0115] Transfect siRNA to knock out RIPK1, EEF1AKMT3 or its methylation substrate EEF1A (purchased from Genomed, EEF1A sequence: 5'-3': GCACCAUGAAGCUUUGAGUGAAGCT (SEQ ID NO. 4), EEF1AKMT3 sequence: 5'-3': CCAUCUAUCUGGCCUCCAATT (SEQ ID NO. 5)) in endothelial cells, the transfection and knockout steps refer to 1.2, and SUnSET ribosome protein synthesis experiment is carried out:

[0116] (1) Prepare the cells to be tested in advance and inoculate them in a 6-well plate; when the cell density reaches 70%, discard the old culture medium and wash with PBS once;

[0117] (2) Add serum-free basal medium to the 6-well plate and starve for 2 hours;

[0118] (3) After starvation, add high-concentration puromycin (A1113803, Thermo Fisher Scientific) to the cells (complete medium containing 10% serum is configured, the final concentration is 10 μg / mL, and 20 μg / mL is used for cell lines screened by puromycin) and incubate in a 37°C cell incubator for 15 minutes;

[0119] (4) Wash with PBS for 3 times and try to absorb the residual liquid; lyse the cells to prepare protein samples and use anti-puromycin antibody (EQ0001, Kerafast) for Western blot analysis.

[0120] The experimental results are shown in Figure 9 After knocking out RIPK1, the total protein synthesis in endothelial cells increased significantly, while after knocking out EEF1AKMT3 and its methylation substrate EEF1A, the protein synthesis decreased significantly Figure 9(A) ; Reversal experiments using wild-type EEF1AKMT3 or EEF1AKMT3-S26A mutants confirmed that endothelial cell protein synthesis was significantly upregulated after EEF1AKMT3 phosphorylation inactivation. Figure 9 (B in the middle).

[0121] 3.2 In vitro methylation experiment

[0122] Since EEF1A is a methylation substrate of EEF1AKMT3, its ability to regulate ribosomal protein synthesis is affected by methylation modification. Therefore, in vitro methylation experiments were conducted to verify that phosphorylation of EEF1AKMT3 regulates the methylation level of downstream EEF1A. The specific steps are as follows:

[0123] (1) Add 500ng of Flag-EEF1AKMT3 recombinant protein, 1μg of GST-EEF1A, 2μL of SAM (30mM) (B9003S, NEB), and 1μL of ATP (100mM) (R0441, Thermo Fisher Scientific) to a 60μL reaction system, shake to mix, and incubate at 37℃ for 1-2 hours at 1500rpm in a shaking metal bath.

[0124] (2) After the reaction, the SDS-PAGE loading buffer was adjusted to 150 μL, and SDS-PAGE electrophoresis was performed. The methylation level was detected by pan-methylation antibodies (A18293, A5870, A18292, Abclonal).

[0125] See results Figure 10 It was found that downstream EEF1A methylation modification was significantly activated after phosphorylation inactivation mutation of EEF1AKMT3 S26.

[0126] 3.3 ELISA Experiment

[0127] Finally, ELISA confirmed that phosphorylated EEF1AKMT3-S26 directly affects N-Shh secretion in endothelial cells. The experimental method was performed according to the ELISA kit instructions.

[0128] See results Figure 11 Knocking out RIPK1 in endothelial cells significantly upregulated the synthesis and secretion of N-Shh, while knocking out EEF1AKMT3 or EEF1A significantly reduced N-Shh secretion. Figure 11 (A in the text); Reversal experiments confirmed that the secretion of N-Shh in endothelial cells was significantly upregulated after the EEF1AKMT3-S26A mutant was reintroduced. Figure 11 (B in the middle).

[0129] According to embodiments 1-3, abnormal proliferation and pathological remodeling of smooth muscle cells in the bridging artery are caused by N-Shh participating in endothelial-smooth muscle cell communication; Shh inhibitor GDC-0449 can effectively target the Shh signaling pathway in smooth muscle cells to improve bridging artery remodeling; and the core mechanism is that phosphorylation of endothelial cell RIPK1 EEF1AKMT3-S26 affects its methylation transferase activity and ribosomal protein synthesis function.

Claims

1. Use of a Hedgehog inhibitor for the preparation of a medicament for the prevention and treatment of vascular remodeling after an autologous arterial bypass, characterized in that, The Hedgehog inhibitor is vismodegib; the administration mode of the vismodegib is local administration; the local administration is coating on the adventitia of blood vessels.

2. Use according to claim 1, characterized in that, The Hedgehog is Sonic hedgehog.

3. Use according to claim 2, characterized in that, The Sonic hedgehog is N-Shh, which is an N-terminal product of Sonic hedgehog after maturation and has signal activity.

4. Use according to claim 3, characterized in that, RIPK1 regulates the secretion of N-Shh by phosphorylating EEF1AKMT3.

5. Use according to claim 4, characterized in that, The phosphorylation site of EEF1AKMT3 is S26.

6. Use according to any one of claims 1 to 5, characterized in that, The medicine further comprises a pharmaceutically acceptable excipient.

7. Use according to claim 6, characterized in that, The pharmaceutically acceptable excipient is selected from one or more than two combinations of wetting agents, emulsifiers, preservatives, antioxidants, buffers, diluents, lubricants, bacteriostatic agents, solutes that make the preparation isotonic with the blood of the recipient, suspending agents, suspending agents, solubilizers, thickening agents, stabilizers, sweeteners, and spices. The Hedgehog inhibitor is vismodegib; the administration mode of the vismodegib is local administration; the local administration is coating on the adventitia of blood vessels. The Hedgehog is Sonic hedgehog. The Sonic hedgehog is N-Shh, which is an N-terminal product of Sonic hedgehog after maturation and has signal activity. RIPK1 regulates the secretion of N-Shh by phosphorylating EEF1AKMT3. The phosphorylation site of EEF1AKMT3 is S26. The medicine further comprises a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient is selected from one or more than two combinations of wetting agents, emulsifiers, preservatives, antioxidants, buffers, diluents, lubricants, bacteriostatic agents, solutes that make the preparation isotonic with the blood of the recipient, suspending agents, suspending agents, solubilizers, thickening agents, stabilizers, sweeteners, and spices.