A kit for detecting feline herpesvirus type I antibodies

By expressing an optimized gB-gD fusion protein in Escherichia coli and combining it with colloidal gold-labeled immunoassay, the sensitivity and specificity issues of feline herpesvirus type I detection have been resolved, enabling rapid and convenient primary care testing suitable for the diagnosis of feline herpesvirus type I antibodies.

CN117054650BActive Publication Date: 2026-04-03杭州爱谨生物科技有限公司
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-12-11
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing methods for detecting feline herpesvirus type I are time-consuming and require specialized equipment, making them difficult to promote at the grassroots level. Furthermore, traditional methods lack sufficient sensitivity and specificity, making it difficult to effectively distinguish cross-reactions with other pathogens.

Method used

Recombinant proteins expressed by the fusion of gB and gD proteins were used, and colloidal gold-labeled immunoassay was combined with a double-antigen sandwich method to detect feline herpesvirus type I antibodies. Codons were optimized using an E. coli expression system and a His tag was added for protein purification and detection.

Benefits of technology

It improves the sensitivity and specificity of detection, simplifies operation, reduces costs, and is suitable for on-site testing at the grassroots level. It has the advantages of rapid color development and no need for expensive instruments, and is suitable for rapid diagnosis of feline herpesvirus type I antibodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117054650B_ABST
    Figure CN117054650B_ABST
Patent Text Reader

Abstract

This invention discloses a kit for detecting feline herpesvirus type I antibodies, belonging to the field of animal virus antibody detection. It includes feline herpesvirus type I gB-gD recombinant protein, mouse IgG, and goat anti-mouse IgG, wherein the feline herpesvirus type I gB-gD recombinant protein is composed of the amino acid sequence shown in SEQ ID NO.1. Using this kit for detecting feline herpesvirus type I antibodies is convenient, rapid, highly sensitive, shows no cross-reactivity with other pathogens, and has strong specificity, possessing significant clinical value and broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Related patents

[0002] This application is a divisional application of Chinese Patent Application No. 2020114597564, filed on December 11, 2020, entitled "A recombinant feline herpesvirus type I gB-gD protein and its preparation method and application". Technical Field

[0003] This invention belongs to the field of animal virus antibody detection, specifically, it relates to a kit for detecting feline herpesvirus type I antibodies. Background Technology

[0004] Feline herpesvirus 1 (FHV-1), also known as feline rhinotracheitis virus, belongs to the Alphaherpesviridae family. It is an enveloped, double-stranded DNA virus that causes acute, highly contagious upper respiratory tract disease in felines. This virus primarily affects kittens, is transmitted through direct contact, and has a morbidity rate as high as 100% and a mortality rate of up to 50%. The disease was first discovered in the United States, and subsequently found and spread in Canada, the United Kingdom, and other regions. Currently, cases of this disease have been reported multiple times in my country, and the virus has been isolated.

[0005] Cats with latent FHV-1 infection or those that have recovered from infection can carry and shed the virus for extended periods, becoming a source of infection. Like other herpesviruses, FHV-1 can lie dormant in the trigeminal ganglion of cats and reactivate when the cat's immunity is weakened, leading to disease development and making prevention and control difficult. Therefore, strengthening the identification and diagnostic methods for FHV-1 is of great significance for the prevention and control of this disease.

[0006] Virus isolation is the most reliable diagnostic method for identifying FHV-1. Although it is not as sensitive as PCR, it can detect live viral particles, not just their DNA. While virus isolation is the most reliable detection method, it is time-consuming and therefore not commonly used for routine diagnosis of FHV-1 infection. Methods such as immunofluorescence assays, enzyme-linked immunosorbent assays (ELISA), and polymerase chain reaction (PCR) require specific instruments, equipment, and specialized skills, making them difficult to implement at the grassroots level. Summary of the Invention

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0008] The first aspect of the present invention provides a recombinant feline herpesvirus type I gB-gD protein, comprising the amino acid sequence shown in SEQ ID NO.1.

[0009] In this invention, recombinant protein, also called fusion protein or recombinant fusion protein, is the expression product of two genes recombined by DNA recombination technology.

[0010] gB (envelope glycoprotein B) and gD (envelope glycoprotein D) proteins are the main immunogenic antigens of feline herpesvirus and are highly conserved. They can induce and activate the body's immune system to produce an immune response and induce host cells to produce neutralizing antibodies. Therefore, fusing the main antigenic epitopes of gB and gD proteins together for expression can not only improve the sensitivity of diagnosis, but also reduce cross-reactivity with other pathogens.

[0011] In some embodiments of the present invention, preferably, the recombinant protein consists of the amino acid sequence shown in SEQ ID NO.1.

[0012] A second aspect of the present invention provides a gene encoding the recombinant protein described in the first aspect of the present invention, comprising the nucleotide sequence shown in SEQ ID NO.2.

[0013] This gene sequence was designed for expression of the recombinant protein in *E. coli*, and the codons were optimized based on *E. coli*'s codon preferences. Different species use synonymous codons at different frequencies, and this codon preference affects the translation process. If an mRNA contains many clusters of rare codons, it can negatively impact ribosome motility, significantly reducing protein expression levels. Therefore, the gene sequence was codon-optimized for *E. coli* expression, improving protein expression efficiency.

[0014] A third aspect of the present invention provides an expression vector comprising the gene described in the second aspect of the present invention.

[0015] In some embodiments of the present invention, the expression vector is pET30a, which is kanamycin resistant, and the expressed fusion protein has a histidine (His) tag.

[0016] A fourth aspect of the present invention provides a host cell containing the expression vector described in the third aspect of the present invention.

[0017] Furthermore, the host cell is a eukaryotic host cell or a prokaryotic host cell.

[0018] In some embodiments of the present invention, the host cell is a prokaryotic host cell. Preferably, the host cell is *Escherichia coli*, and more preferably, *Escherichia coli* BL21. Expression using *E. coli* has advantages such as short cycle time, low cost, and high expression level.

[0019] A fifth aspect of the present invention provides a method for preparing the recombinant protein described in the first aspect of the present invention, comprising the step of inducing the host cells described in the fourth aspect of the present invention to express the protein.

[0020] Furthermore, the host cell is a eukaryotic host cell or a prokaryotic host cell.

[0021] In some embodiments of the present invention, the host cell is a prokaryotic host cell. Preferably, the host cell is *Escherichia coli*, and more preferably, *Escherichia coli* BL21. Expression using *E. coli* has advantages such as short cycle time, low cost, and high expression level.

[0022] In some specific embodiments of the present invention, the step of inducing Escherichia coli to express proteins is as follows:

[0023] S1, the *E. coli* was cultured in LB medium containing 50 μg / mL kanamycin at 37°C.

[0024] S2. When the OD600 of the E. coli culture medium reaches 0.5-0.7, expression is induced by IPTG at a final concentration of 1 mM. The induction conditions are: 25℃, 200 rpm, 4 h. Using these induction conditions, the recombinant protein can be expressed more slowly, allowing sufficient time for spatial conformation formation, which is very important for the recombinant protein to function.

[0025] S3, centrifuge the culture medium at 7000 rpm for 10 min at 4℃ and collect the bacterial cells;

[0026] S4, use Binding Buffer to lyse the bacterial cells;

[0027] S5, ultrasonic disruption of bacterial cells, conditions: 600w, 2s of sonication, 5s interval, 80-120 times in total;

[0028] S6, centrifuge at 4℃, 12000rpm for 30min and collect the supernatant. The recombinant protein is in the supernatant.

[0029] Preferably, in step S2, induction is performed when the OD of the Escherichia coli culture medium is between 600 and 0.6.

[0030] Preferably, in step S5, the ultrasonic disruption is performed 100 times. Using the disruption method of this invention avoids excessively vigorous disruption that could lead to loss of recombinant proteins.

[0031] In some embodiments of the present invention, a further step of purifying the recombinant protein is included. Various methods can be used to purify the recombinant protein, such as ion exchange chromatography, gel filtration chromatography, and affinity chromatography. In some embodiments of the present invention, affinity chromatography is chosen because the recombinant protein contains a His tag, and one-step purification can achieve high purity.

[0032] In some specific embodiments of the present invention, the supernatant containing the recombinant protein is passed through a Ni column and then eluted with elution buffer to obtain the target protein.

[0033] Preferably, the elution buffer is formulated as follows: 50 mM Tris, 0.2 M NaCl, 0.5 M Midazole, pH 8.0.

[0034] A sixth aspect of the present invention provides the use of the recombinant protein described in the first aspect of the present invention in the preparation of a kit for detecting feline herpesvirus type I antibodies.

[0035] A seventh aspect of the present invention provides a kit for detecting feline herpesvirus type I antibodies, comprising the recombinant protein described in the first aspect of the present invention.

[0036] Furthermore, the kit also includes mouse IgG and goat anti-mouse IgG.

[0037] In some embodiments of the present invention, a double-antigen sandwich gold labeling method is used to detect feline herpesvirus type I antibodies.

[0038] In some specific embodiments of the present invention, the kit includes a double-antigen sandwich gold labeling test strip, and the reagent method for the test strip is as follows:

[0039] S1, prepare recombinant protein colloidal gold complex and mouse IgG colloidal gold complex respectively;

[0040] S2, the recombinant protein colloidal gold complex and mouse IgG colloidal gold complex are mixed to prepare a gold-labeled pad;

[0041] S3, using recombinant protein as the detection line and goat anti-mouse IgG as the quality control line, is drawn on a nitrocellulose membrane;

[0042] S4. Filter paper, a polyester plate containing a nitrocellulose membrane, a gold label pad, and a sample pad are mounted on a base plate. A portion of the filter paper is stacked on the polyester plate, a portion of the polyester plate is stacked on the gold label pad, and a portion of the gold label pad is stacked on the sample pad. The polyester plate has a test area and a quality control area. The test area has a detection line (T line), and the quality control area has a quality control line (C line). The detection line is close to the gold label pad, and the quality control line is close to the filter paper, thus preparing the test strip.

[0043] When using this product, add the biological sample to the sample pad, let it stand at room temperature for 10 minutes, and then determine the test results. The determination criteria are as follows:

[0044] ① The presence of two bands, one in the control area and the other in the test area, indicates a positive result;

[0045] ② If only one band appears on the control line and no band appears in the test area, the result is negative;

[0046] ③ If no band appears on the control line, it indicates that the test strip is damaged. Regardless of whether a band appears on the test line, a new test strip should be used and the test repeated.

[0047] In some embodiments of the present invention, a positive result for feline herpesvirus type I antibody detection indicates that the cat biological sample contains feline herpesvirus type I antibody, meaning that the cat has been infected with feline herpesvirus type I or has been infected with feline herpesvirus type I.

[0048] In some embodiments of the invention, the biological sample is serum or plasma, or any other bodily fluid that may contain antibodies.

[0049] Beneficial effects of the present invention

[0050] Compared with the prior art, the present invention has the following beneficial effects:

[0051] gB and gD proteins are the main immunogenic antigens of feline herpesvirus and are highly conserved. They can induce and activate the body's immune system to produce an immune response and induce host cells to produce neutralizing antibodies. Therefore, fusing the main antigenic epitopes of gB and gD proteins together for expression can not only improve the sensitivity of diagnosis, but also reduce cross-reactions with other pathogens. It has high specificity and has great clinical significance and broad application prospects.

[0052] Typically, most cats have the highest antibody levels three weeks after infection with feline herpesvirus (FHV-1), followed by a rapid decline in antibody levels. Therefore, retrospective diagnostic significance is gained by detecting the neutralizing antibody titers in paired sera from the acute phase of FHV-1 infection and after recovery.

[0053] The colloidal gold-labeled immunoassay method used in this invention is a novel analytical technique that is fast, simple, low-cost, pollution-free, and requires no training. Compared with traditional methods, it is more suitable for on-site testing, with advantages such as short color development time and no need for expensive instruments, and has broad market prospects and application value. Attached Figure Description

[0054] Figure 1 The gel electrophoresis results of the purified feline herpesvirus type I gB-gD fusion protein are shown. 1: Loading after cell lysis; 2: Flow bleed; 3: Elution with 50 mM Imidazole; 4: Elution with 0.5 M Imidazole.

[0055] Figure 2 The diagram shows a reagent image of a test strip according to an embodiment of the present invention. 1: Sample pad; 2: Gold label pad; 3: NC membrane; 31: Detection line (T line); 32: Control line (C line); 4: Filter paper; 5: Backing plate.

[0056] Figure 3 This diagram illustrates the results of a test using a test strip according to an embodiment of the present invention. T: test line, C: control line.

[0057] Figure 4 The illustration shows a clinical sample test result using a reagent strip, according to an embodiment of the present invention. S: Sample pad, T: Test line, C: Control line, FHV: Feline herpesvirus type I.

[0058] Figure 5 The overall results of testing clinical cat serum samples using the test strips of the present invention are shown. Detailed Implementation

[0059] To make the technical problems solved by the present invention, the technical solutions and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments.

[0060] Example

[0061] The following examples are used to illustrate preferred embodiments of the invention. Those skilled in the art will understand that the techniques disclosed in the examples represent techniques discovered by the inventors that can be used to implement the invention, and therefore can be considered preferred embodiments for implementing the invention. However, those skilled in the art should understand from this specification that many modifications can be made to the specific embodiments disclosed herein, still yielding the same or similar results, without departing from the spirit or scope of the invention.

[0062] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains, and all materials publicly cited herein and referenced by them are incorporated herein by reference.

[0063] Those skilled in the art will recognize, or can learn through routine experimentation, many equivalents of the specific embodiments of the invention described herein. These equivalents will be included in the claims.

[0064] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0065] Example 1: Construction of the feline herpesvirus type I gB-gD fusion protein gene expression vector

[0066] The feline herpesvirus type I gB gene was designed based on the protein sequence of NCBI Gene Bank: YP_003331552.2. It was based on the protein's hydrophilicity / hydrophobicity... https: / / web.expasy.org / protscale / After analysis, the gB (1-100 aa) sequence was selected from the region with predicted high hydrophilicity for fusion. The gD gene was designed based on the protein sequence of NCBI Gene bank: YP_003331589.1. The fusion was based on the protein's hydrophilicity / hydrophobicity... https: / / web.expasy.org / protscale / After analysis, the gD(275-374aa) sequence was selected for fusion in the region with high predicted hydrophilic content.

[0067] The amino acid sequence of the gB-gD recombinant protein fusion is as follows (SEQ ID NO.1):

[0068] MSTRGDLGKRRRGSRWQGHSGYFRQRCFFPSLLGIAATGSRHGNGSSGLTRLARYVSFIWIVLFLVGPRPVEGQSGSTSEQPRRTVATPEVGGTPPKPTTSGSEDSKRSNDSRGESSGPNWIDIENYTPKNNVPIIISDDDVPTAPPKGMNNQSVVIPAIVLSCLIIALILGVIYYILRVKRSRSTAYQQLPIIHTTHHP

[0069] Different species use synonymous codons at different frequencies, and this codon preference affects the translation process. If an mRNA contains many clusters of rare codons, it can negatively impact the speed of ribosome movement, significantly reducing protein expression levels.

[0070] This invention utilizes *Escherichia coli* as an expression system. To obtain higher expression efficiency and higher expression levels, codon optimization was performed during the expression of exogenous proteins. The resulting nucleotide sequence is shown below (SEQ ID NO.2):

[0071] ATGTCCACCCGTGGCGATCTGGGCAAACGTCGTCGTGGCTCCCGTTGGCAGGGCCATTCCGGCTATTTTCGTCAGCGTTGCTTTTTTCCGTCCCTGCTGGGCATTGCGGCGACCGGCTCCCGTCATGGCAATGGCTCCTCCGGCCTGACC CGTCTGGCGCGTTATGTGTCCTTTATTTGGATTGTGCTGTTCTGGTGGGCCCGCGTCCGGTGGAAGGCCAGTCCGGCTCCACCTCCGAACAGCCGCGTCGTACCGTGGCGACCCCGGAAGTGGGCGGCACCCCGCCGAAACCGACCACC TCCGGCTCCGAAGATTCCAAACGTTCCAATGATTCCCGTGGCGAATCCTCCGGCCCGAATTGGATTGATATTGAAAATTATACCCCGAAAAATAATGTGCCGATTATTATTTCCGATGATGATGTGCCGACCGCGCCGCCGAAAGGCATG AATAATCAGTCCGTGGTGATTCCGGCGATTGTGCTGTCCTGCCTGATTATTGCGCTGATTCTGGGCGTGATTTATTATATTCTGCGTGTGAAACGTTCCCGTTCCACCGCGTATCAGCAGCTGCCGATTATTCATACCACCCATCATCCG

[0072] The recombinant gene sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd. and ligated with the pET30a plasmid to form a recombinant expression vector.

[0073] Example 2: Expression of feline herpesvirus type I gB-gD fusion protein

[0074] The feline herpesvirus type I gB-gD fusion gene plasmid was transformed into *E. coli* BL21 and plated on LB agar plates containing 50 μg / mL kanamycin (Shanghai Sangon Biotech, catalog number: K0408). The plates were incubated overnight at 37°C. Single colonies were picked and cultured in 300 mL LB medium containing the same concentration of kanamycin at 37°C until the OD600 reached approximately 0.6. Expression was induced with 1 mM IPTG (Shanghai Sangon Biotech, catalog number: IB0168) at 25°C for 4 h. After induction, the culture was centrifuged at 7000 rpm for 10 min at 4°C, and the bacterial cells were collected.

[0075] Example 3: Purification and refolding of feline herpesvirus type I gB-gD fusion protein

[0076] The bacterial cells were lysed using 50 mL of Binding Buffer (50 mM Tris, 0.2 M NaCl, pH 8.0); then sonicated at 600 W for 2 seconds, followed by 5-second intervals, for a total of 100 cycles; finally, the cells were centrifuged at 12000 rpm for 30 minutes at 4°C, and the supernatant was collected. The target protein was in the supernatant. The cells were then purified in one step using a Ni column, eluting the target protein with Elution Buffer (50 mM Tris, 0.2 M NaCl, 0.5 M Imidazole, pH 8.0). The target protein was detected by PAGE gel electrophoresis, and the results are shown below. Figure 1 As shown.

[0077] Depend on Figure 1 It was found that the purified fusion protein had high purity. The purified recombinant protein was dialyzed with dialysis buffer (50 mM Tris, 0.2 M NaCl, pH 8.0), with the dialysis buffer changed every 12 hours for a total of 3 times. The dialyzed protein solution was then filtered through a 0.22 μm filter, and the concentration was determined by the BCA method. It was then stored at -20℃ for later use.

[0078] Example 4: Detection of feline herpesvirus type I antibody using a double-antigen sandwich gold labeling method

[0079] 1. Preparation of double-antigen sandwich gold labeling test strip

[0080] 1.1 Firing of Colloidal Gold

[0081] Add 1000 mL of ultrapure water to an Erlenmeyer flask and heat to boiling on a magnetic stirrer. Then add 4 mL of 10% chloroauric acid (Sigma) and 6 mL of 10% trisodium citrate solution. Continue heating to boiling for 5 min. After cooling to room temperature, filter the colloidal gold through a 0.22 μm filter and store at 4 °C for later use.

[0082] 1.2 Labeling of recombinant feline herpesvirus type I gB-gD fusion protein

[0083] Take 100 mL of colloidal gold solution and put it into a beaker. Add 0.2 M K2CO3 to adjust the pH of the gold solution to 9.5. After stirring, add 2 mg of purified recombinant feline herpesvirus type I gB-gD fusion protein. Stir at room temperature for 15 min. Add 1 mL of 10% BSA solution. Stir at room temperature for 15 min. Centrifuge at 12000 rpm for 10 min. Carefully aspirate and discard the supernatant. Dilute the precipitate to 1 mL with gold labeling dilution buffer (20 mM Tris, 1% BSA, 0.03% Proclin 300, pH 8.0). This is the labeled recombinant feline herpesvirus type I gB-gD fusion protein colloidal gold complex.

[0084] 1.3 Mouse IgG Marker

[0085] Take 100 mL of colloidal gold solution and put it into a beaker. Add 0.2 M K2CO3 to adjust the pH of the gold solution to 7.0. After stirring, add 1 mg of mouse IgG (Hangzhou LONGi Biotechnology Co., Ltd., catalog number: AS00901). Stir at room temperature for 15 min. Add 1 mL of 10% BSA solution. Stir at room temperature for 15 min. Centrifuge at 12000 rpm for 10 min. Carefully aspirate and discard the supernatant. Dilute the precipitate to 1 mL with gold labeling dilution buffer (20 mM Tris, 1% BSA, 0.03% Proclin 300, pH 8.0). This is the labeled mouse IgG colloidal gold complex.

[0086] The gold-labeled complex was diluted 100 times with gold-labeling diluent and then mixed with the feline herpesvirus type I gB-gD fusion protein colloidal gold complex diluted in step 1.2. The mixture was then soaked in glass fiber and dried at 37°C for 4 hours to prepare the gold-labeled pad.

[0087] 1.4 Dotted membrane of recombinant feline herpesvirus type I gB-gD fusion protein

[0088] The purified gB-gD fusion protein was diluted to 0.9 mg / mL with spot dilution buffer (50 mM Tris, 2% sucrose, pH 8.5) and used as the test line (T line) of the colloidal gold test strip. Goat anti-mouse IgG (Hangzhou LONGi Biotechnology Co., Ltd., catalog number: PS00901) was diluted to 0.3 mg / mL with the same dilution buffer and used as the control line (C line) of the colloidal gold test strip. The two diluted solutions were then streaked onto a nitrocellulose membrane and dried at 37°C overnight.

[0089] 1.5 Assembly of a test strip for detecting feline herpesvirus type I antibodies using a double-antigen sandwich gold labeling method

[0090] The gold-labeled pad, the polyester plate coated with the raw materials onto the nitrocellulose membrane (NC membrane), filter paper, sample pad, etc., are installed on the base plate to assemble the feline herpesvirus type I antibody double antigen sandwich test strip. Specific installation method is as follows: Figure 2 As shown: Sample pad 1, gold label pad 2, NC membrane 3, and filter paper 4 are respectively installed on base plate 5. A portion of sample pad 1 is stacked on top of gold label pad 2, a portion of gold label pad 2 is stacked on top of NC membrane 3, and a portion of filter paper 4 is stacked on top of NC membrane 3. NC membrane 3 is divided into a testing area and a quality control area. The testing area has a detection line 31 (T line), and the quality control area has a quality control line 32 (C line). Detection line 31 is close to gold label pad 2, and quality control line 32 is close to filter paper 4.

[0091] Furthermore, the assembled test strips are cut into 3mm strips using a strip cutter, and then inserted into specially designed plastic cards to become a complete test reagent card.

[0092] 2. Detection of feline herpesvirus type I antibody using a double-antigen sandwich gold labeling method on test strips / cards.

[0093] Add 90 μL of the sample to be tested (cat serum, plasma) to the sample loading port (S), incubate at room temperature for 10 minutes, and then determine the results. The result determination criteria are as follows (e.g., Figure 3 As shown):

[0094] ① The presence of two bands, one in the control area and the other in the test area, indicates a positive result;

[0095] ② If only one band appears on the control line and no band appears in the test area, the result is negative;

[0096] ③ If no band appears on the control line, it indicates that the test strip is damaged. Regardless of whether a band appears on the test line, a new test strip should be used and the test repeated.

[0097] Detection results of 3-antigen sandwich gold label method for feline herpesvirus type I antibody test strips / cards

[0098] A total of 20 feline herpesvirus type 1 positive cat serum samples (sample numbers 1-20) and 50 normal, disease-free, and unvaccinated cat serum samples (sample numbers 21-70) were tested. Some test results are as follows: Figure 4 As shown, two lines, T and C, indicate a positive test result, while only one line, C, indicates a negative test result.

[0099] The test results are shown in Table 1: 19 positive cases were detected in 20 positive serum samples, 1 case was missed (sample 7), and 1 false positive case (sample 37) was found in 50 negative serum samples.

[0100] Table 1 Results of feline herpesvirus type I antibody detection

[0101]

[0102]

[0103] Therefore, the sensitivity and specificity of the sample detection are 95% and 98%, respectively, with an overall concordance rate of 97.1%. Figure 5 As shown.

[0104] The above results demonstrate that the recombinant feline herpesvirus type I gB-gD fusion protein of this invention has very high sensitivity and specificity for detecting feline herpesvirus type I. It can be used as a raw material for making feline herpesvirus type I antibody test strips and can be widely used in clinical testing.

[0105] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A kit for detecting feline herpesvirus type I antibodies, characterized in that, It includes feline herpesvirus type I gB-gD recombinant protein, mouse IgG, and goat anti-mouse IgG, wherein the feline herpesvirus type I gB-gD recombinant protein consists of the amino acid sequence shown in SEQ ID NO.

1.

2. The reagent kit according to claim 1, characterized in that, Detection of feline herpesvirus type I antibodies using a double-antigen sandwich gold labeling method.

3. The reagent kit according to claim 2, characterized in that, The kit includes a double-antigen sandwich gold labeling test strip, and the test strip is prepared as follows: S1, prepare feline herpesvirus type I gB-gD recombinant protein colloidal gold complex and mouse IgG colloidal gold complex respectively; S2, the feline herpesvirus type I gB-gD recombinant protein colloidal gold complex and mouse IgG colloidal gold complex are mixed to prepare a gold-labeled pad; S3, using feline herpesvirus type I gB-gD recombinant protein as the detection line and goat anti-mouse IgG as the quality control line, was drawn on a nitrocellulose membrane; S4. Filter paper, a polyester plate containing a nitrocellulose membrane, a gold label pad, and a sample pad are mounted on a base plate. A portion of the filter paper is stacked on the polyester plate, a portion of the polyester plate is stacked on the gold label pad, and a portion of the gold label pad is stacked on the sample pad. The polyester plate has a test area and a quality control area. The test area has a detection line, and the quality control area has a quality control line. The detection line is close to the gold label pad, and the quality control line is close to the filter paper, thus preparing the test strip.

4. The reagent kit according to claim 3, characterized in that, The preparation method of the feline herpesvirus type I gB-gD recombinant protein colloidal gold complex is as follows: Take 100 mL of colloidal gold solution and put it into a beaker. Add 0.2 M K2CO3 to adjust the pH of the gold solution to 6.

5. After stirring, add 2 mg of purified feline herpesvirus type I gB-gD recombinant protein. Stir at room temperature for 15 min. Add 1 mL of 10% BSA solution. Stir at room temperature for 15 min. Centrifuge at 12000 rpm for 10 min. Carefully aspirate and discard the supernatant. Dilute the precipitate to 1 mL with gold standard diluent, which includes 20 mM Tris, 1% BSA, 0.03% Proclin 300, and pH 8.

0.

5. The reagent kit according to claim 4, characterized in that, The colloidal gold solution is prepared as follows: Add 1000 mL of ultrapure water to an Erlenmeyer flask and heat to boiling on a magnetic stirrer. Then add 4 mL of 10% chloroauric acid and 6 mL of 10% trisodium citrate solution. Continue heating to boiling for 5 min. After cooling to room temperature, filter through a 0.22 μm filter and store at 4°C for later use.

6. The reagent kit according to claim 4, characterized in that, The purification process involves passing the feline herpesvirus type I gB-gD recombinant protein through a Ni column and eluting it with an elution buffer comprising 50 mM Tris, 0.2 M NaCl, 0.5 M Midazole, and pH 8.

0.

7. The reagent kit according to claim 4, characterized in that, The preparation method of the mouse IgG colloidal gold complex is as follows: Take 100 mL of colloidal gold solution and put it into a beaker. Add 0.2 M K2CO3 and adjust the pH of the gold solution to 6.

5. After stirring, add 1 mg of mouse IgG and stir at room temperature for 15 min. Add 1 mL of 10% BSA solution and stir at room temperature for 15 min. Centrifuge at 12000 rpm for 10 min. Carefully aspirate and discard the supernatant. Dilute the precipitate to 1 mL with gold standard diluent, which includes 20 mM Tris, 1% BSA, 0.03% Proclin 300, and pH 8.

0.

8. The reagent kit according to claim 7, characterized in that, The mouse IgG colloidal gold complex was diluted 100 times with gold label diluent and then mixed with the feline herpesvirus type I gB-gD recombinant protein colloidal gold complex. The mixture was then soaked in glass fiber and dried at 37°C for 4 hours to prepare the gold label pad.

9. The reagent kit according to claim 3, characterized in that, The purified feline herpesvirus type I gB-gD recombinant protein was diluted to 0.9 mg / mL with spot dilution buffer and used as the detection line for the colloidal gold test strip. Goat anti-mouse IgG was diluted to 0.3 mg / mL with the same dilution buffer and used as the control line for the colloidal gold test strip. The two diluted solutions were then streaked onto a nitrocellulose membrane and dried at 37°C overnight.

Citation Information

Patent Citations

  • Glazed tile (y36008fq)

    CN3340003D

  • Air conditioner outdoor unit

    CN3373885D

  • Preparation method for rapid detection of feline herpesvirus-1

    CN109679970A

  • Use of recombinant antigens to determine the immune status of an animal

    US20040058316A1