A tetrahedral framework nucleic acid targeting rage and uses thereof

Abstract

The application discloses a tetrahedral framework nucleic acid targeting RAGE, which is a tetrahedral framework nucleic acid carrying siRNA; and the sequence of the siRNA is shown as SEQ ID NO. 5-6. By carrying specific siRNA on specific TDNs, the application effectively and continuously down-regulates the expression of RAGE, blocks the NF-kappa B channel, inhibits the expression of macrophage inflammatory factors, and plays a whole-body anti-inflammatory and anti-oxidation function. In addition, the application can also regulate the pyroptosis state of macrophages through the NLRP3 / Caspase-1 axis, maintain the microenvironment homeostasis and inhibit the spread of cell death signals, so as to realize the prevention and treatment of diabetic complications and diseases related to advanced glycation end products. In-vivo experiments also prove that the application has a therapeutic effect on the whole-body pathological tissue damage of diabetic mice. The nucleic acid nanomedicine has practical popularization and application value.

Description

Technical Field

[0001] This invention specifically relates to a tetrahedral framework nucleic acid that targets RAGE and its applications. Background Technology

[0002] Diabetic complications are damage to other systems of the body secondary to diabetes, such as diabetic nephropathy, diabetic foot, and diabetic retinopathy. It is now believed that diabetic complications are due to pathological changes in the body's cells under a systemic hyperglycemic environment. Advanced glycation end products (AGEs) are irreversible byproducts of the hyperglycemic microenvironment, and AGEs have been identified as a key risk factor for diabetic complications, while also exacerbating systemic complications of diabetes.

[0003] With economic and social development, people are consuming more modern high-calorie and highly processed foods rich in AGEs, which increases the burden on the body and accelerates the production and accumulation of AGEs in the body. The more advanced glycation end products in the body, the more oxidation and chronic inflammatory reactions occur, making it easier to trigger many chronic diseases, namely advanced glycation end product-related diseases, causing pathological damage to multiple tissues.

[0004] For patients with diabetic complications and advanced glycation end products (AGEs), the accumulated AGEs in the body are difficult to remove and continue to cause local inflammatory damage, exacerbating the condition. Therefore, developing drugs that specifically inhibit AGE production and prevent diabetic complications and AGE-related diseases is of significant clinical importance.

[0005] RAGE (receptor for advanced glycation end products) can bind to a variety of harmful ligands (not limited to inflammatory factors) accumulated in tissues of the body, including those of diabetic patients, obese individuals, and aging individuals. Therefore, developing drugs that specifically block the effects of RAGE and prevent various risk factors, including AGEs, from transmitting signals such as inflammation and cell death into cells through RAGE, thereby treating AGEs-induced diseases and diabetic complications, is an effective treatment strategy.

[0006] DNA tetrahedrons (TDNs) are nucleic acid molecules synthesized from several single strands of DNA (usually four) through complementary base pairing. They have good stability in vivo and can be used as carriers for some drugs or as the backbone structure for some detection probes. At the same time, TDNs have good biological effects.

[0007] There are currently no reports of successfully using DNA tetrahedral nucleic acid structures to bind siRNA in order to target RAGE, prevent tissue inflammation and death, and thus treat or prevent diabetic complications and AGE-related diseases. Summary of the Invention

[0008] To address the above problems, this invention provides a tetrahedral framework nucleic acid targeting RAGE, which is a tetrahedral framework nucleic acid carrying siRNA;

[0009] The sequence of the siRNA is shown in SEQ ID NO.5-6.

[0010] Furthermore, the four single-stranded DNA sequences of the tetrahedral framework nucleic acid are shown in SEQ ID NO. 1 to 4.

[0011] Furthermore, the molar ratio of the tetrahedral framework nucleic acid to siRNA is 1:1.

[0012] The present invention also provides a method for preparing the aforementioned tetrahedral framework nucleic acid, which includes the following steps:

[0013] Take four DNA single strands, add them to TM buffer, maintain at 95℃ for 10 min, rapidly cool to 4℃ and maintain for more than 20 min, then add siRNA and incubate at 37℃ to obtain the product.

[0014] Furthermore, the final concentration of the four DNA single strands is the same as that of the siRNA.

[0015] Furthermore, the final concentration of the four DNA single strands and siRNA is 1000 nM.

[0016] Furthermore, the pH of the TM buffer is 8.0, and the incubation time is 60 min.

[0017] The present invention also provides the use of the aforementioned tetrahedral framework nucleic acid in the preparation of medicaments for the prevention and / or treatment of diabetic complications.

[0018] Finally, this invention provides the use of the aforementioned tetrahedral framework nucleic acid in the preparation of medicaments for the prevention and / or treatment of diseases related to advanced glycation end products.

[0019] Furthermore, the drug targets RAGE, inhibits the production of advanced glycation end products, and reduces the inflammatory response's effect on tissue damage; the tissues include: lung, liver, kidney, spleen, and pancreas.

[0020] This invention targets the tetrahedral framework nucleic acids of RAGE (Recurrent Glycation End Products). By attaching specific siRNAs to specific TDNs, it effectively and continuously downregulates RAGE expression, blocks the NF-κB pathway to inhibit the expression of macrophage inflammatory factors, and exerts systemic anti-inflammatory and antioxidant functions. Furthermore, this invention can regulate the pyroptosis state of macrophages through the NLRP3 / Caspase-1 axis, maintaining microenvironmental homeostasis and inhibiting the spread of cell death signals. This enables the prevention and treatment of diabetic complications and diseases related to advanced glycation end products (AGEs). It has practical application value.

[0021] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0022] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0023] Figure 1 A. Schematic diagram of Tsi synthesis and identification; B. Schematic diagram of Tsi synthesis; C. PAGE gel detection results; D. Atomic force microscopy detection results; E. Transmission electron microscopy detection results; F, J. Particle size and potential detection results; G. Serum stability detection results of Tsi drug; H. Effect of different concentrations of Tsi drug on macrophage activity; I. Effect of different concentrations of AGEs on macrophage activity; K, L. Flow cytometry detection results of Tsi drug; M. Confocal fluorescence detection results of Tsi drug entering the cell.

[0024] Figure 2 : Results of Tsi drug inhibiting macrophage inflammatory factor expression; AC, ROS detection results; D, Schematic diagram of Tsi inhibiting inflammation; E, PCR detection results of inflammatory factor mRNA gene expression; FG, WB detection results of inflammatory factor protein expression; HK, Immunofluorescence detection results of inflammatory factor expression.

[0025] Figure 3 Tsi drug inhibits macrophage RAGE / NF-κB pathway activation; A, Tsi inhibits RAGE expression - immunofluorescence detection; B, Tsi inhibits RAGE expression - WB protein detection; C, Tsi inhibits RAGE expression - PCR detection; D, Tsi inhibits RAGE expression on day 7 - protein detection; EF, WB detection results of NF-κB pathway-related protein expression; G, Schematic diagram of Tsi drug inhibiting macrophage RAGE / NF-κB pathway; HL, Immunofluorescence detection results of NF-κB pathway-related protein expression.

[0026] Figure 4: Tsi drug inhibits the activation of the NLRP3 / Caspase-1 / GSDMD pyroptosis pathway in macrophages; AF, Immunofluorescence detection of NLRP3 / Caspase-1 / GSDMD pathway-related protein expression results; GH, Western blotting detection of pyroptosis-related IL-1β and IL-18 protein expression results; IJ, Western blotting detection of NLRP3 / Caspase-1 / GSDMD pathway-related protein expression results; K, Schematic diagram of Tsi drug inhibiting the NLRP3 / Caspase-1 / GSDMD pyroptosis pathway in macrophages.

[0027] Figure 5 : Tsi drug treatment for systemic complications in diabetic mice; A, Diagnostic mouse modeling and nucleic acid drug treatment schematic diagram; B, C, Recording of blood glucose changes in mice; D, E, Recording of body weight changes in mice; F, G, Blood glucose changes in IPGTT experiment; H, I, Blood glucose changes in IPTTT experiment; J, Detection of serum AGEs concentration; K, Distribution and metabolism of siRNA and Tsi drugs in vivo; L, Changes in pancreatic islet tissue in mice; M, Inflammatory infiltration and damage in liver tissue in mice; N, Inflammatory infiltration and damage in kidney tissue in mice; O, Changes in red and white pulp in spleen tissue in mice; P, Immunofluorescence staining of IL-1β in pancreatic tissue; Q, Immunofluorescence staining of IL-1β in liver tissue; R, Immunofluorescence staining of IL-1β in kidney tissue; S, Immunofluorescence staining of IL-1β in spleen tissue.

[0028] Figure 6 Tsi drug inhibits tissue inflammation and pyroptosis in diabetic mice; A, Inflammatory infiltration and damage in mouse lung tissue; B, Serum IL-1β and TNF-α concentrations; C, Statistical analysis of lung tissue inflammatory infiltration; D, Statistical analysis of RAGE immunohistochemical staining in lung tissue; E, Immunohistochemical staining of RAGE in lung tissue; F, Immunofluorescence staining of RAGE expression in mouse lung tissue; G, Immunofluorescence staining of IL-1β expression in mouse lung tissue; H, Immunofluorescence staining of NLRP3 expression in mouse lung tissue; I, Immunofluorescence staining of GSDMD expression in mouse lung tissue; J, Statistical analysis of immunofluorescence staining; K, Immunofluorescence staining of RAGE, NLRP3, and IL-β in kidney tissue; L, Immunofluorescence staining of RAGE, NLRP3, and IL-β in liver tissue. Detailed Implementation

[0029] Example 1: Preparation and characterization of the tetrahedral framework nucleic acid (Tsi) for RAGE targeting according to the present invention.

[0030] 1. Synthesis method

[0031] Four single-stranded DNA molecules (S1, S2, S3, S4) were dissolved in TM Buffer (10 mM Tris-HCl, 50 mM MgCl2, pH 8.0) to a final concentration of 1000 nM. After thorough mixing, the solution was rapidly heated to 95°C and held for 10 minutes, then rapidly cooled to 4°C and held for at least 20 minutes to obtain sTDN. An equal concentration of siRNA was then incubated with the aforementioned DNA tetrahedra at 37°C for 60 minutes to complete the synthesis of Tsi. A schematic diagram of the synthesis is shown below. Figure 1 As shown in Figure A.

[0032] The sequence of the four single strands (5′→3′) is as follows:

[0033] S1:

[0034] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGA ACATTCCTAAGTCTGAA(SEQID NO.1)

[0035] S2:

[0036] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTC AGACTTAGGAATGTTCG(SEQID NO.2)

[0037] sS3:

[0038] GGTTGTTGGGTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC(SEQ ID NO.3)

[0039] S4:

[0040] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGA TGGGCATGCTCTTCCCG(SEQID NO.4)

[0041] SiRNA-RAGE(sense):aaucugguagacucggacucg(SEQ ID NO.5)

[0042] SiRNA-RAGE (antisense): cccaacaacccgaguccgagucuaccagaua (SEQ ID NO.6)

[0043] 2. Identification

[0044] The results of PAGE gel and capillary electrophoresis show that the Tsi size is approximately 280 bp. Figure 1 B, C); Scattered circular triangular objects can be seen under transmission electron microscopy and atomic force microscopy. Figure 1 (D, E) Particle size potentials show that Tsi is approximately 14 nm in size. Based on the aforementioned identification results, it can be concluded that Tsi was successfully synthesized.

[0045] The beneficial effects of the present invention will be further illustrated below with experimental examples.

[0046] Experimental Example 1: In vitro experiment on the prevention and treatment of diabetic complications and advanced glycation end products using Tsi.

[0047] 1. Method

[0048] AGEs-induced in vitro inflammation model: AGEs at a concentration of 200 μg / ml were used to simulate an inflammation model in the diabetic microenvironment. Macrophages in the AGEs group were treated with AGEs for 24 h. In the treatment group, macrophages were pretreated with siRNA, sTDN, and Tsi for 24 h, respectively, followed by AGEs treatment for 24 h. The control group (Control) was cultured in standard culture medium without AGEs or any nucleic acid drugs.

[0049] After establishing the in vitro model, the supernatant of the samples was collected, and the expression of corresponding indicators, including mRNA gene and protein levels, was detected. All data are expressed as mean ± standard deviation (n=3), and multiple comparisons were performed using one-way ANOVA and Tukey correction.

[0050] 2. Results

[0051] For details, please see [link / details]. Figures 2-4 In the figure, @ indicates comparison with the Ctrl group, # indicates comparison with the AGEs group, & indicates comparison with the siR group, * indicates comparison with the sTDN group, and ns: no significant difference; @, #, &, * indicate p < 0.05, @@, ##, &&, ** indicate p < 0.01, @@@, ###, &&&, *** indicate p < 0.001. Figure 2 The results showed that the siRNA-only group had weak or even no therapeutic effect. The TDN group had a certain anti-inflammatory effect. Furthermore, Tsi significantly inhibited the expression of pro-inflammatory factors IL-1β, TNF-α, and IL-6. Figure 3 The results showed that siRNA and TDN drugs had some effect on inhibiting the NF-κB pathway, but Tsi could significantly inhibit the activation of the NF-κB pathway. Figure 4The results showed that siRNA had almost no therapeutic effect on pyroptosis, while TDN had some therapeutic effect on pyroptosis. However, Tsi significantly inhibited the occurrence of macrophage pyroptosis, showing a better effect than TDN alone. The results also indicate that Tsi can inhibit the expression of AGEs-induced inflammatory factors in vitro.

[0052] Experimental Example 2: In vivo experiment on the prevention and treatment of diabetic complications and advanced glycation end products using Tsi.

[0053] High-fat, high-sugar diet combined with streptozotocin (STZ) injection is a typical animal model of diabetes. After establishing the diabetes model, a model of diabetic complications caused by AGEs is built by feeding the animal a high-fat, high-sugar diet for a long period of time.

[0054] This experiment used Tsi to treat diabetic mice to evaluate the role of Tsi in preventing and inhibiting diabetic complications and AGEs-related diseases.

[0055] 1. Method

[0056] (1) Purchase 6-week-old male C57BL / 6J mice and acclimatize them for one week.

[0057] (2) Seven-week-old male C57BL / 6J mice were fed a high-fat, high-sugar diet for one month. Then, STZ injection was used to establish a hyperglycemia / diabetes model.

[0058] (3) Experimental groups (including siRNA group, TDN group, and Tsi group) were injected with 100 μL of 1000M siRNA, TDN, and Tsi, respectively, into hyperglycemic / diabetic model mice. Control group (control group, healthy C57BL / 6J mice) and diabetic group (TD-AGEs group, hyperglycemic / diabetic model mice) were injected with the same volume of physiological saline. Injections were given twice every 7 days for 8 weeks. Except for the control group, both the diabetic group and the experimental group were fed a high-fat, high-sugar diet. After treatment, blood, liver, lung, kidney, spleen, and pancreas were collected for testing. Throughout the experimental drug administration and observation process, the mice's blood glucose level, weight change, water intake, and urine output were monitored. Note: The number of mice in each group was n=6.

[0059] (4) Collected blood was subjected to ELISA to detect the concentrations of AGEs, IL-1β, and TNF-α in the blood.

[0060] (5) Immunofluorescence assays were performed to detect the expression levels of the target gene RAGE protein and the inflammatory marker IL-1β, the pyroptosis marker NLRP3, and the GSDMD protein.

[0061] All data are expressed as mean ± standard deviation (n=6), and multiple comparisons were performed using one-way ANOVA and Tukey correction.

[0062] 2. Results

[0063] 1. The regulatory effects of Tsi on blood glucose, inflammatory factors, and tissue inflammatory damage.

[0064] For details, please see [link / details]. Figure 5 In the figure, @ indicates comparison with the Ctrl group, # indicates comparison with the TD-AGEs group, & indicates comparison with the siR group, * indicates comparison with the sTDN group, and ns: no significant difference; @, #, &, * indicate p < 0.05, @@, ##, &&, ** indicate p < 0.01, @@@, ###, &&&, *** indicate p < 0.001. Figure 5 A is a flowchart of the mouse modeling and drug treatment time. Figure 5 The BI values ​​represent the results of blood glucose, weight, IPGTT, and IPITT tests, indicating the successful establishment of the diabetes model. Figure 5 J represents the serum concentration of AGEs. As can be seen from the figure, even though Tsi has little effect on lowering blood sugar, Tsi can significantly inhibit the production of AGEs in diabetic mice under hyperglycemic conditions.

[0065] Figure 5 K represents the systemic distribution of Tsi, showing that Tsi can rapidly reach all tissues and organs throughout the body via blood circulation, and exhibits excellent serum stability and significantly enhanced resistance to enzymatic degradation compared to siRNA alone. Figure LO shows H&E staining of tissue sections from the pancreas, kidney, liver, and spleen of mice, indicating that siRNA has a weak therapeutic effect on diabetic mice, while TDN has a certain therapeutic effect. Tsi can significantly inhibit the level of inflammatory infiltration in tissues within the diabetic microenvironment and alleviate the concurrent damage to the pancreas, kidney, liver, and spleen in diabetic patients. Figure 5 PS represents the immunofluorescence results of IL-1β inflammatory markers in the pancreas, kidney, liver, and spleen of mice. It shows that the expression of IL-1β in the pancreas, kidney, liver, and spleen tissues of diabetic mice is increased compared with the control group. The therapeutic effect of siRNA on diabetic mice is weak. TDN can downregulate the expression of IL-1β inflammatory markers. Tsi can significantly downregulate the expression of IL-1β inflammatory markers in the pancreas, kidney, liver, and spleen, and the effect is better than that of TDN alone.

[0066] 2. The regulatory effect of Tsi on tissue protein expression in diabetic mice

[0067] For details, please see [link / details]. Figure 6In the figure, @ indicates comparison with the Ctrl group, # indicates comparison with the TD-AGEs group, & indicates comparison with the siR group, * indicates comparison with the sTDN group, and ns: no significant difference; @, #, &, * indicate p < 0.05, @@, ##, &&, ** indicate p < 0.01, @@@, ###, &&&, *** indicate p < 0.001. Figure 6 A shows H&E staining of lung tissue sections from Tsi mice, indicating that Tsi has a protective function against diabetic pulmonary complications. Figure 6 B shows the results of detecting IL-1β and TNF-α in mouse serum, indicating that Tsi can significantly inhibit the expression levels of inflammatory factors throughout the body. Figure 6 C is a statistical graph showing the inflammatory infiltration in mouse lung tissue; Figure 6 DE represents the immunohistochemical results and statistical graphs of lung tissue. Figure 6 FJ shows immunofluorescence images and statistical comparison charts of RAGE, IL-1β, NLRP3, and GSDMD proteins in lung tissue: Figure 6 The results showed the expression of RAGE protein in lung tissue after Tsi treatment, demonstrating the effective targeted inhibition of Tsi. Figure 6 G represents the expression of IL-1β protein in lung tissue after Tsi treatment, and the results show that Tsi effectively inhibits tissue inflammation. Figure 6 HI represents the expression of NLRP3 and GSDMD proteins in lung tissue after Tsi treatment, and the results show that Tsi effectively inhibits tissue pyroptosis. Figure 6 Immunohistochemical results from KL showed that Tsi could downregulate the expression of RAGE / NLRP3 / IL-1β proteins in the kidney and liver.

[0068] In summary, these results indicate that Tsi significantly inhibits AGEs-induced macrophage inflammation by blocking the NF-κB pathway. Furthermore, Tsi suppresses pyroptosis by inhibiting the NLRP3 / Caspase-1 axis, demonstrating a significant therapeutic effect on systemic inflammation. Tsi is a promising nucleic acid-targeting drug that effectively delivers siRNA and achieves a durable silencing effect to modulate the AGEs-induced inflammatory microenvironment, thereby preventing diabetic complications. It has important clinical value in treating diabetic complications and AGEs-induced diseases.

Claims

1. A tetrahedral framework nucleic acid targeting RAGE, characterized in that: It is a tetrahedral framework nucleic acid carrying siRNA; The sequence of the siRNA is shown in SEQ ID NO.5 and SEQ ID NO.6; The four single-stranded DNA sequences of the tetrahedral framework nucleic acid are shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO.

4.

2. The tetrahedral framework nucleic acid according to claim 1, characterized in that: The molar ratio of the tetrahedral framework nucleic acid to siRNA is 1:

1.

3. A method for preparing the tetrahedral framework nucleic acid according to claim 1 or 2, characterized in that: It includes the following steps: Take four DNA single strands, add them to TM buffer, maintain at 95℃ for 10 min, rapidly cool to 4℃ and maintain for more than 20 min, then add siRNA and incubate at 37℃ to obtain the product.

4. The preparation method according to claim 3, characterized in that: The final concentrations of the four DNA single strands and siRNA are the same.

5. The preparation method according to claim 4, characterized in that: The final concentration of the four DNA single strands and siRNA is 1000 nM.

6. The preparation method according to claim 3, characterized in that: The pH of the TM buffer is 8.0; the incubation time is 60 min.

7. Use of the tetrahedral framework nucleic acid of claim 1 or 2 in the preparation of a medicament for the prevention and / or treatment of diabetic complications.

8. The use of the tetrahedral framework nucleic acid of claim 1 or 2 in the preparation of a medicament for the prevention and / or treatment of diabetic complications arising from the accumulation of advanced glycation end products, characterized in that: The drug targets RAGE, inhibits the production of advanced glycation end products, and reduces the inflammatory response's effect on tissue damage; the tissues include: lung, liver, kidney, spleen, and pancreas.

Images