A strain of Bacillus spizenzae and its application

Abstract

The present invention provides a strain of Bacillus spizenzae ( Bacillus spizizenii )HMQ20YJ19, whose deposit number is CCTCC M 20231085. The present invention also provides its use in preparing a drug for preventing and treating pathogenic fungi. The Bacillus spizenzae of the present invention is suitable for the soil ecological environment and climatic conditions of Gansu, and can be used for the prevention and control of plateau summer vegetable diseases in Gansu.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a strain of Bacillus sp. and an application thereof. Background Art

[0002] Crop diseases caused by pathogenic bacteria affect agricultural production and cause huge yield losses. About 20%-30% of crop yield losses are caused by diseases. In the past few decades, synthetic pesticides have been widely used to prevent and control crop diseases. However, the excessive use of synthetic pesticides to protect crops has led to serious environmental problems and reduced the sustainability of agriculture. Today, there is an urgent need to explore other management methods that are not only effective but also less harmful to the environment. The use of beneficial microorganisms for biological control is an important alternative to reduce the damage caused by crop diseases to sustainable agriculture. After years of development, microbial live bacterial preparations that can produce active substances or biopesticides containing active ingredients have become a hot topic and focus of research in recent years. Biopesticides have the characteristics of wide sources, safety to non-target organisms, and good environmental compatibility, and have become a new trend in the development of the world's pesticide industry. In particular, with the rapid development of high-tech technologies such as molecular biology technology, genetic engineering, protein engineering, fermentation engineering, and enzyme engineering, biopesticides have shown good application prospects and huge social and economic benefits. Biocontrol microorganisms can not only effectively control plant diseases and promote plant growth, but are also safe for humans and animals, have good environmental compatibility, and are not likely to cause plant pathogens to develop resistance. They can meet consumers' multiple demands for agricultural product yield, quality, and safety. Using biocontrol microorganisms to control plant diseases has become an inevitable trend in the sustainable development of agriculture. Bacillus bacteria are considered important biological control agents and are the first choice in sustainable agricultural systems.

[0003] To date, Bacillus subtilis and Bacillus amyloliquefaciens can control a variety of bacterial and fungal diseases of vegetables, grapes, cucurbits, etc. Bacillus subtilis is mixed with antibiotics and polysaccharides to make biofungicides, which can effectively control downy mildew and powdery mildew of vegetables and grapes. However, Bacillus that promote the growth of one crop may not have the same effect on other crops. Some Bacillus have a general growth-promoting effect on several crops, while other Bacillus show strong host crop selectivity and colonize a single crop or a limited number of crops. In addition, biocontrol microorganisms often interact with microbial communities in the soil ecological environment. Exogenous biocontrol microorganisms may not be able to effectively establish themselves in the new soil environment due to competition with the resident bacterial community. Therefore, the successful use of biocontrol agents may depend on regional adaptability. At present, some commercial biocontrol agents at home and abroad are not very effective in preventing and controlling some soil-borne diseases of plateau summer vegetables in Gansu Province due to the above reasons. This urgently requires us to base ourselves on the unique microbial resources of Gansu Province and screen out some biocontrol agents suitable for the soil ecological environment and climatic conditions of Gansu Province for the prevention and control of plateau summer vegetable diseases. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a strain of Bacillus spizenzae and its application. The Bacillus spizenzae is suitable for the soil ecological environment and climatic conditions of Gansu Province and can be used for the prevention and control of plateau summer vegetable diseases in Gansu Province.

[0005] The present invention provides a strain of Bacillus spizizenii HMQ20YJ19, which was deposited in the China Center for Type Culture Collection (CCTCC) on June 25, 2023, and the deposit address is: China Center for Type Culture Collection, Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and its deposit number is CCTCC M 20231085.

[0006] The present invention also provides a microbial agent containing the above-mentioned Bacillus spizizenii HMQ20YJ19.

[0007] The present invention also provides a method for preparing the above-mentioned Bacillus spizizenii HMQ20YJ19 microbial agent, wherein Bacillus spizizenii HMQ20YJ19 is added to a culture medium for fermentation; the formula of the culture medium is: 7.5 g / L soluble starch, 10 g / L yeast extract, 5 g / L MgSO4·7H2O, and 7.5 g / L NaCl.

[0008] Preferably, the specific conditions of the fermentation are: fermentation at a rotation speed of 160-220 r / min, an inoculum amount of 3-7%, a fermentation temperature of 30-34° C., a fermentation time of 48-72 h and an initial pH of 6.5-7.5.

[0009] Preferably, Bacillus spizizenii HMQ20YJ19 is added to the culture medium, and fermentation is carried out under the conditions of a rotation speed of 200 r / min, an inoculum amount of 5%, a fermentation temperature of 31° C., a fermentation time of 56 h and an initial pH of 7.0.

[0010] The present invention also provides use of the above-mentioned Bacillus spizizenii HMQ20YJ19 strain or microbial agent in preparing a medicine for preventing and treating pathogenic fungi; the pathogenic fungi include Alternaria azukiae, Botrytis aclada, B. cinerea, B. elliptica, Colletorichum fioriniae, Fusarium graminearum, F. oxysporum, F. solani, F. verticillioides, Phytophthora capsici, Pyricularia oryzae, Rhizoctonia solani and Sclerotiniasclerotiorum.

[0011] The present invention also provides the use of the above-mentioned Bacillus spizizenii HMQ20YJ19 strain or microbial agent in the preparation of medicines for preventing and treating diseases of summer vegetables in the Gansu plateau.

[0012] Preferably, the application is application in the preparation of medicines for treating pepper blight and tomato gray mold in Gansu Province.

[0013] The present invention also provides a medicine, wherein the effective component comprises the above-mentioned Bacillus spizizenii HMQ20YJ19 strain or microbial agent.

[0014] Preferably, the drug further comprises a pharmaceutically acceptable excipient.

[0015] The Bacillus spizizenii HMQ20YJ19 screened by the present invention has a deposit number of CCTCC M 20231085, and has good antagonistic effects on a variety of summer vegetable diseases, such as Alternaria azukiae, Botrytis aclada, B. cinerea, B. elliptica, Colletorichum fioriniae, Fusarium graminearum, F. oxysporum, F. solani, F. verticillioides, Phytophthora capsici, Pyricularia oryzae, Rhizoctonia solani, and Phytophthora capsici. solani) and Sclerotinia sclerotiorum, etc., and have been tested in laboratory and field tests, and have good control effects. Therefore, the Bacillus spizizenii HMQ20YJ19 of the present invention can be well used for preventing and controlling summer vegetable diseases in the Gansu plateau. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0017] Figure 1 The strain HMQ20YJ19 is effective in preventing and controlling pepper blight in greenhouse seedling trays and potted plants.

[0018] Figure 2 The strain HMQ20YJ19 produces disease prevention and growth-promoting related characteristic substances.

[0019] Figure 3 To prevent and control pepper diseases in the field.

[0020] Figure 4 This is a single factor screening experiment for the fermentation medium components of strain HMQ20YJ19.

[0021] Figure 5 This is a single factor screening test for fermentation conditions of strain HMQ20YJ19.

[0022] Figure 6 The effect of the fermentation liquid of strain HMQ20YJ19 on preventing and controlling tomato gray mold in potted plants. DETAILED DESCRIPTION

[0023] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0024] Example 1

[0025] 1 Materials and methods

[0026] 1.1 Isolation and preservation of bacteria

[0027] Soil samples were collected from salinized plots in Minqin County, Wuwei City, Gansu Province. Five points were randomly selected from the sampling plots, and 0-5 cm salinized soil was taken. After mixing, it was brought back in a sealed bag. The soil and plant residues were removed with a 0.2 cm mesh sieve and air-dried at room temperature. 10 g of soil sample was weighed and placed in a conical flask containing 90 mL of sterile water. It was shaken for 10 min to make 10 -1 The soil suspension of 1000 μg / ml was allowed to stand for the soil particles to settle, and then 1 mL of the supernatant was transferred into a test tube containing 9 mL of sterile water to make 10 -2 The soil suspension of concentration was diluted in sequence to make the final concentration of 10 -5 Soil suspension. Select 10 -3 , 10 -4 and 10 -5 200 µL of each suspension of the three concentrations was taken and added to a plate of halophilic microorganism isolation medium (tryptone 2.5 g, yeast extract 10 g, magnesium sulfate heptahydrate 10 g, potassium chloride 5 g, sodium chloride 80 g, 2% calcium chloride dihydrate 10 mL, agar powder 18 g, water 1000 mL), and evenly spread with a spreader rod, and repeated three times. The culture dish was cultured at 28°C for 5 days, and colonies of different morphologies were selected and transferred to a new halophilic microorganism isolation medium plate for purification and culture, and stored at 4°C for testing. The strain was frozen in a -80°C ultra-low temperature refrigerator in a cryopreservation tube (glycerol content 20%) for long-term storage.

[0028] 1.2 Determination of the ability of biocontrol bacteria to antagonize multiple pathogenic fungi

[0029] The plate confrontation culture method was used to screen and determine the antagonistic ability of biocontrol bacteria against various pathogenic fungi. Use a borer (6.5 mm) to cut out the edge cakes of colonies of Alternaria azukiae, Botrytis aclada, B. cinerea, B. elliptica, Colletorichum fioriniae, Fusarium graminearum, F. oxysporum, F. solani, F. verticillioides, Phytophthora capsici, Pyricularia oryzae, Rhizoctonia solani and Sclerotinia sclerotiorum cultured at 25°C for 7 days, and inoculate them on the culture medium at a point 2 cm away from the edge of the culture dish and at the same time at a point 2 cm away from the edge of the culture dish on the other side parallel to the culture medium. The soil isolate was inoculated at a point 1 cm from the ground, and the size of the inhibition zone was measured after culturing at 25°C for 10 days. Each treatment was repeated 3 times.

[0030] 1.3 Preparation of culture medium of strain HMQ20YJ19

[0031] After the strain HMQ20YJ19 was inoculated on LB solid medium for activation, it was transferred to a 100 mL Erlenmeyer flask containing 50 mL LB liquid medium and cultured at 28°C and 150 rpm for 24 h to obtain seed solution. The seed solution was inoculated into the medium ( PDB+ LB) and cultured at 28°C with shaking at 150 rpm for 24 h.

[0032] 1.4 Determination of the efficacy of strain HMQ20YJ19 against pepper blight in seedling trays

[0033] The greenhouse seedling tray was used to test the effectiveness of preventing and controlling pepper blight in a greenhouse at the Institute of Plant Protection, Gansu Academy of Agricultural Sciences. Pepper variety "Changfeng" seeds were surface-sterilized in 0.1% sodium hypochlorite for 20 min and then washed four times with sterile water. The seeds were sown in a 50-hole seedling tray filled with horticultural soil, with one seed per hole. The seedlings were grown in a greenhouse free of pests and diseases and kept at a temperature of 20-30°C. After 8 weeks, 20 mL of the culture solution of strain HMQ20YJ19 (viable bacteria concentration 10 8CFU / mL) were poured into the horticultural soil at the root of the plant to prevent excess liquid from flowing out from the bottom of the seedling tray. 11 Spores / g, WP, Deqiang Biotechnology Co., Ltd., Harbin, China) and fluazinam (ai 50%, SC, Jiangyin Suli Chemical Co., Ltd., Jiangyin, China) were used as blank control and positive control, respectively, and the plants were treated with the same treatment method as above. Each treatment was repeated 3 times, with a total of 150 plants. 10 mL of Phytophthora capsici inoculum (1×10 5 Sporangium / mL) was poured into the horticultural soil at the root of each plant. The inoculated plants were placed in a growth chamber to maintain humidity above 90% and temperature at 20-30°C. The disease level was investigated on the 7th day after inoculation of the pathogen and the control effect was calculated.

[0034] Disease grading standards: Level 0: healthy and symptom-free; Level 1: The rhizomes of seedlings turn slightly black, and the leaves do not wilt or wilt recoverably; Level 2: The rhizomes of seedlings turn black by 1-2 cm, the leaves wilt irreversibly, and the lower leaves occasionally fall off; Level 3: The rhizomes of seedlings turn black by more than 2 cm, and the leaves wilt obviously or fall off; Level 4: The rhizomes of seedlings turn black and constrict, and all leaves except the growing point fall off or the plant wilts; Level 5: The whole plant dies.

[0035] 1.5 Determination of the potted control effect of strain HMQ20YJ19 on pepper blight

[0036] The greenhouse potted pepper blight control effect test was conducted in the greenhouse of the Institute of Plant Protection, Gansu Academy of Agricultural Sciences. Pepper seeds were treated as described in step 1.4. Seeds were sown in a 72-hole seedling tray filled with horticultural soil, with one seed per hole. The seedlings were grown in a greenhouse without pests and diseases and the temperature was controlled at 20-30°C. After 6 weeks, the seedlings were transplanted into plastic pots (10 cm in diameter) filled with horticultural soil and continued to grow in a greenhouse without pests and diseases and the temperature was controlled at 20-30°C for 4 weeks. 3 days and 4 hours before inoculation of pathogens, 50 mL of strain HMQ20YJ19 fermentation liquid (live bacteria concentration 10 8 CFU / mL) were poured into the horticultural soil at the root of the plant to prevent excess liquid from flowing out of the bottom of the plastic pot. Water, Bacillus subtilis and fluazinam were used as blank control and positive control respectively to treat the plants with the same treatment method as above. Each treatment was repeated 3 times, with a total of 90 plants. 10mL of Phytophthora capsici inoculum (1×10 5Sporangium / mL) was poured into the horticultural soil at the root of each plant. The inoculated plants were placed in a growth chamber to maintain humidity above 90% and temperature at 20-30°C. The disease level was investigated on the 14th day after inoculation of the pathogen and the control effect was calculated. The disease grading standard is the same as above.

[0037] 1.6 Identification of strain HMQ20YJ19 using gene sequence analysis

[0038] The whole genomic DNA of the biocontrol bacterium HMQ20YJ19 was extracted using the Fast TIANamp Bacteria DNA Kit (Tiangen, Beijing). The 16S rRNA gene of the strain was amplified by PCR using the universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') of the bacterial 16S rRNA gene. The gyrA gene of the strain was amplified by PCR using the primers GyrA-F (5'-CAGTCAGGAAATGCGTACGTCCTT-3') and GyrA-R (5'-CAAGGTAATGCTCCAGGCATTGCT-3'). The cheA gene of the strain was amplified by PCR using primers CheA-F (5'-AGGGCTGCCCATACATTAAAAGGAATGAGC-3') and CheA-R (5'-AGTTTCAACCGGGACCATTCTCATATTCAG-3'). 25 μL of the reaction mixture was amplified on a PCR thermal cycler. The PCR products were purified and sent to Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China) for sequencing. The sequencing results were compared in the NCBI database, and the 16S rRNA, gyrA, and cheA gene sequences of related species were downloaded from the NCBI gene bank database. Phylogenetic analysis was performed using MEGA 11.0. The 16S rRNA, gyrA, and cheA gene sequences of strain HMQ20YJ19 were submitted to the NCBI database.

[0039] 1.7 Detection of in vitro disease prevention and growth promotion related substances of strain HMQ20YJ19

[0040] 1.7.1 Siderophore production

[0041] The strain HMQ20YJ19 was selected and inoculated onto CAS medium, and cultured in a 30°C incubator for 14 days to observe whether a yellow-orange circle appeared. If so, it indicated that the strain had the ability to produce siderophore.

[0042] 1.7.2 Production of amylase

[0043] The strain HMQ20YJ19 was selected and inoculated onto NA medium containing 1% soluble starch, and cultured in a 30°C incubator for 5 days to observe whether a transparent circle appeared. If so, it means that the strain has the ability to produce amylase.

[0044] 1.7.3 Protease production

[0045] The strain HMQ20YJ19 was selected and inoculated onto a casein yeast medium containing 7% skim milk powder (5 g casein, 2.5 g yeast extract, 1 g glucose, 1000 mL water), and cultured in a 30°C incubator for 5 days. The appearance of a transparent circle was observed. If so, it indicated that the strain had the ability to produce protease.

[0046] 1.7.4 Production of pectinase

[0047] The strain HMQ20YJ19 was selected and inoculated onto a basal medium containing 1% pectin (1 g sodium nitrate, 1 g potassium hydrogen phosphate, 1 g potassium chloride, 0.5 g magnesium sulfate, 0.5 g yeast powder, 1 g glucose, 18 g agar, and 1000 mL water), and cultured in a 30°C incubator for 7 d. Gram's iodine solution (1.0 g iodine, 2.0 g potassium iodide, and 300 mL water) was poured into the pectin medium and the appearance of a transparent circle was observed against a dark blue background. If so, it indicated that the strain had the ability to produce pectinase.

[0048] 1.7.5 Production of cellulase

[0049] The strain HMQ20YJ19 was selected and inoculated onto a basal culture medium containing 1% cellulose, and cultured in a 30°C incubator for 5 days. The cellulose culture medium was submerged in 0.01% Congo red solution for 15 min, and the culture medium was rinsed with water 3 times to observe whether a transparent circle appeared. If so, it indicated that the strain had the ability to produce cellulase.

[0050] 1.7.6 The Generation of IAA

[0051] The strain HMQ20YJ19 was cultured in a shaking incubator at 30°C for 72 h in TSB medium containing 0.1% L-tryptophan. The bacterial suspension was centrifuged to remove the bacteria. 2.0 mL of Salkawski colorimetric agent (50 mL, 35% perchloric acid, 1 mL 0.5 M ferric chloride) was added to 1.0 mL of sterile filtrate and color was developed at room temperature for 30 min. If a pink color was produced, it indicated that IAA was produced. The culture medium was used as a control.

[0052] 1.7.7 Phosphorus dissolution

[0053] The strain HMQ20YJ19 was selected and inoculated onto PVK medium (0.5 g yeast powder, 10.0 g glucose, 5.0 g calcium phosphate, 0.5 g ammonium sulfate, 0.2 g potassium chloride, 0.1 g magnesium chloride, 0.0001 g manganese sulfate, 0.0001 g ferrous sulfate, 18.0 g agar, and 1000 mL water), and cultured in a 30°C incubator for 14 days. The appearance of a transparent circle was observed. If so, it indicated that the strain had the ability to solubilize phosphate.

[0054] 1.7.8 Potassium dissolution

[0055] The strain HMQ20YJ19 was selected and inoculated onto Aleksandrov medium (5.0 g glucose, 0.5 g magnesium sulfate heptahydrate, 0.005 g ferric chloride, 2.0 g calcium carbonate, 2.5 g yeast powder, 18.0 g agar, and 1000 mL water) containing 0.2% potassium feldspar, and cultured in a 30°C incubator for 14 days to observe whether a transparent circle appears. If so, it means that the strain has the ability to solubilize potassium.

[0056] 1.7.9 Nitrogen fixation

[0057] The strain HMQ20YJ19 was selected and inoculated onto Agar's nitrogen-free medium (10.0 g glucose, 0.2 g potassium dihydrogen phosphate, 0.5 g calcium carbonate, 0.2 g magnesium sulfate heptahydrate, 0.2 g sodium chloride, 0.1 g calcium sulfate, 18.0 g agar, 1000 mL water), and cultured in a 30°C incubator for 14 days to observe whether it grew normally. If so, it indicated that the strain had the ability to fix nitrogen.

[0058] 1.7.10 Production of NH3

[0059] Inoculate 50 µL of HMQ20YJ19 bacterial suspension into 30 mL of peptone ammoniation medium (5.0 g of peptone, 0.5 g of potassium hydrogen phosphate, 0.25 g of sodium chloride, 0.5 g of magnesium sulfate heptahydrate, 0.01 g of ferrous sulfate heptahydrate, and 1000 mL of water), place in a 30°C incubator for 3 days, add 1.0 mL of Nessler color developer (6.0 g of mercuric chloride, 12.4 g of potassium iodide, 30 mL of 20% sodium hydroxide, and 70 mL of water), and if the yellow color turns to brown, it means that NH3 is produced. The culture medium is used as a control.

[0060] 1.8 Determination of the field efficacy of strain HMQ20YJ19 against pepper blight

[0061] During the 2021 pepper growing season, an artificial inoculation field trial was conducted at the Lanzhou Experimental Station of the Gansu Academy of Agricultural Sciences to determine the efficacy of the biocontrol bacterial strain HMQ20YJ19 against pepper blight. The strain HMQ20YJ19 biocontrol agent and pepper seedlings were prepared as described above. On May 17 and 25, pepper seedlings (9 weeks old) were transplanted to 300 m 2 The experimental site of Gansu Academy of Agricultural Sciences in Lanzhou. The row and plant spacing were kept at 50 cm and 30 cm, respectively. The treatments were set with biocontrol bacterial strains HMQ20YJ19 and Bacillus subtilis (ai 1×10 11 spores / g, WP, Deqiang Biological Co., Ltd., Harbin, China), fluazinam (ai 50%, SC, Jiangyin Suli Chemical Co., Ltd., Jiangyin, China) and water (blank control) were randomly divided into two groups, and each treatment was repeated 3 times. On August 1, August 8 and August 15, 100 mL of the culture medium of strain HMQ20YJ19 (viable bacteria concentration 10 8 CFU / mL), Bacillus subtilis and fluazinam (according to the dosage recommended by the supplier) and water were poured into the roots of the plants. On August 15, 10 mL of P. capsici inoculum (1×10 5 Sporangium / mL) was poured into the soil around the roots of each plant. The disease level was investigated on the 15th day after inoculation of the pathogen and the control effect was calculated.

[0062] Disease grading standards: Level 0: healthy and symptom-free; Level 1: only leaves and fruits above ground have lesions; Level 2: brown rot spots on above ground stems and branches; Level 3: brown rot spots on the base of the stems; Level 4: brown rot spots on above ground stems, branches and base of stems, and some branches are dead; Level 5: the whole plant is dead.

[0063] 1.9 Optimization of fermentation medium components and conditions

[0064] 1.9.1 Optimization of fermentation medium components of strain HMQ20YJ19

[0065] 1.9.1.1 Preparation of fermentation seed solution of strain HMQ20YJ19

[0066] The strain HMQ20YJ19 was inoculated on LB solid culture medium, placed in a constant temperature incubator, and cultured at 28°C for 48 h. A single colony was picked with a transfer loop and added to a 250 mL Erlenmeyer flask containing 100 mL LB liquid culture medium. The culture was shaken in a shaker at 28°C and 180 r / min for 24 h to prepare the seed solution.

[0067] 1.9.1.2 Live bacteria count in fermentation broth of strain HMQ20YJ19

[0068] In an ultra-quiet workbench, use a pipette to draw 1 mL of the fermentation liquid prepared in step 1.9.1.1 and add it to a test tube containing 9 mL of distilled water sterilized at high temperature. After shaking, draw 1 mL of the diluent and add it to the next test tube. Perform gradient dilutions in sequence to make a final concentration of 10 -7 Take 100 μL of the bacterial suspension in the last test tube and add it to the LB plate. Use a sterilized applicator to spread it evenly. Each group has 9 plates (repeated 3 times). Incubate in a 28℃ constant temperature incubator for 24 hours and use the Xunshu MF3 series microscopic colony counter to count the number of live bacteria.

[0069] 1.9.1.3 Selection of carbon sources

[0070] LB liquid medium was used as the basic medium, and the carbon source in the medium was replaced by sucrose, glucose, lactose, maltose and soluble starch with a concentration of 5 g / L, respectively. LB without any carbon source was used as a control. The initial conditions of shaking fermentation were set as follows: the seed liquid inoculation amount was 5%, and the shaking fermentation was carried out at 180 r / min and 28 ℃ for 36 h. Each treatment was repeated 3 times.

[0071] 1.9.1.4 Selection of nitrogen sources

[0072] On the basis of screening out soluble starch as the carbon source, the nitrogen source of the fermentation medium was replaced by 10 g / L NH4HCO3, NaNO2, NH4Cl, (NH4)2SO4, yeast extract and peptone, respectively. The shaking fermentation conditions were consistent with the carbon source screening, and 3 replicates were set for each treatment.

[0073] 1.9.1.5 Screening of inorganic salts

[0074] On the basis of screening out carbon and nitrogen sources as soluble starch and yeast extract, the inorganic salts in the fermentation medium were replaced by MgSO4·7H2O, CuSO4·5H2O, FeSO4·7H2O, NaCl and KCl with a concentration of 5 g / L, respectively. The shaking fermentation conditions were consistent with the carbon source screening, and 3 replicates were set for each treatment.

[0075] 1.9.1.6 Orthogonal test optimization of fermentation medium

[0076] The optimal carbon source was soluble starch, the optimal nitrogen source was yeast extract, and the optimal inorganic salt was NaCl and MgSO4·7H2O. The four factors screened were then added according to L9(3 4) The factors and levels of the orthogonal experiment were designed (Table 1). The seed liquid inoculation amount was 5%, and the shaking fermentation was carried out at 28 ℃ and 180 r / min for 36 h. The number of viable bacteria per unit volume of fermentation liquid was used as the detection index to compare the number of viable bacteria in the fermentation liquid with different group distribution ratios to determine the optimal group distribution ratio of the fermentation medium.

[0077] Table 1 Factors and levels of orthogonal optimization experiment of fermentation broth composition of strain HMQ20YJ19

[0078]

[0079] 1.9.2 Optimization of shake flask fermentation conditions

[0080] 1.9.2.1 Single Factor Experiment

[0081] The shake flask fermentation speed, inoculation amount, temperature, time and initial pH of strain HMQ20YJ19 were optimized by using the above-screened soluble starch 5g / L, yeast extract 10g / L, MgSO4·7H2O 5g / L and NaCl7.5g / L as the basic culture medium components. Each experimental group was set up for 3 replicates. During the optimization of one factor, other conditions were kept unchanged, and the number of viable bacteria in the shake flask fermentation broth under different conditions was counted. The speed was set to 140, 160, 180, 200, and 220 r / min; the inoculation amount was set to 1%, 3%, 5%, 7% and 9%; the temperature was set to 26 ℃, 28 ℃, 30 ℃, 32 ℃ and 34 ℃; the time was set to 24, 36, 48, 60 and 72 h; the initial pH was set to 6.5, 7.0, 7.5, 8.0 and 8.5.

[0082] 1.9.2.2 Plackett-Burman test

[0083] On the basis of the optimization of single-factor shake flask fermentation conditions, the viable count of strain HMQ20YJ19 was used as the response value to screen five factors, including rotation speed, inoculation amount, temperature, time and initial pH, to identify the main effect factors. Each factor was set at the lowest (-1) and highest (1) levels. The experimental factors and level values ​​are shown in Table 2.

[0084] Table 2 Factor levels and coding of Plackett-Burman experimental design

[0085]

[0086] 1.9.2.3 Response surface methodology to optimize experimental design

[0087] According to the results of Plackett-Burman experimental design, five factors, namely, rotation speed, inoculation amount, temperature, time and initial pH, were selected, and the number of viable bacteria in the fermentation broth was used as the response value to carry out a five-factor three-level Box-Behnken experimental design (Table 3). A fitting regression model was established and analyzed for the results of Box-Behnken experimental design.

[0088] Table 3 Box-Behnken test design factors and level coding

[0089]

[0090] 1.10 Greenhouse potted plant experiment

[0091] The effect test of potted plant prevention and control of tomato gray mold was carried out in the greenhouse of the Institute of Plant Protection, Gansu Academy of Agricultural Sciences. The BC-03 block of Botrytis cinerea was inoculated in the center of the half-sugar (glucose) PDA medium, cultured in the dark at 25°C for 5 to 7 days until spores were produced, and 10 mL of 0.5% Tween 80 was added to the culture dish, left to stand for 2 min, and then the hyphae and spores were scraped off and filtered with 4 layers of gauze to obtain a spore suspension, which was examined under a microscope using a hemocytometer, and the spore concentration was adjusted to 1×10 6 spores / mL for later use.

[0092] After soaking the tomato seeds in 55 ℃ warm water for 7 min, they were placed in a petri dish covered with wet filter paper and cultured at 28 ℃ for 4 days. After germination, they were transplanted into flower pots. They were placed in a greenhouse at 28 ℃ to 35 ℃, with a light intensity of 14 h / d and a relative humidity of about 73%. They were watered regularly and disease prevention tests were conducted when the tomato plants were about 15 cm tall. There were four treatments in the experiment, namely T1 (strain HMQ20YJ19, 1×10 8 CFU / mL), T2 (25% pyraclostrobin, Zhejiang Shijia Technology Co., Ltd., 1000 times diluted), T3 (commodity: 100 billion spores / g Bacillus subtilis, Langfang Pesticide Pilot Plant, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, 750 times diluted) and T4 (blank control, water). Each treatment was evenly sprayed on the tomato seedlings. After 7 days, the second spraying was carried out. After the second treatment, 100 mL of 1×10 6 Spray the spore suspension of Botrytis cinerea with spores / mL evenly on the leaves of tomato seedlings in each treatment until they flow through, and cultivate them at a temperature of 18℃~23℃ and a humidity of more than 90%. After 3 days, spray the pesticide for the third time. Each treatment has 30 pots of tomatoes, and the process is repeated 3 times. Seven days after the third pesticide treatment, investigate the disease status of the plants, and calculate the disease index and control effect.

[0093] The disease classification standard is: Level 0: no disease spots; Level 1: 3 disease spots on a single leaf; Level 3: 4-6 disease spots on a single leaf; Level 5: 7-10 disease spots on a single leaf; Level 7: 11-20 disease spots on a single leaf, some of which are densely packed; Level 9: The disease spots on a single leaf are densely packed and occupy more than a quarter of the leaf area. Disease index = ∑ (disease level × number of plants with the disease level) / (total number of plants surveyed × highest disease level) × 100; control effect (%) = (control disease index - treatment disease index) / control disease index × 100.

[0094] 2 Results and Analysis

[0095] 2.1 Isolation, purification and antagonistic ability determination

[0096] Saline soil was collected from salinized land in Minqin County, Wuwei City, Gansu Province. A total of 20 bacterial isolates were isolated by directly observing the colony morphology and color of bacteria. After screening and testing the antagonistic ability by plate confrontation culture method, 6 bacterial strains could antagonize 13 pathogenic fungi, among which strain HMQ20YJ19 showed a strong antagonistic ability (Table 4). Therefore, this strain will be used for the next step of the experiment.

[0097] Table 4 Antagonistic ability of strain HMQ20YJ19 against various plant pathogens

[0098]

[0099] 2.2 Greenhouse disease prevention effect

[0100] The greenhouse experiment of the Institute of Plant Protection, Gansu Academy of Agricultural Sciences was conducted to test the effectiveness of greenhouse seedling trays and potted plants in preventing and controlling pepper blight. The disease of each treatment was investigated 7 days after the seedling trays were inoculated with the pathogen, and the disease of each treatment was investigated 14 days after the potted plants were inoculated with the pathogen, and the prevention and control effect was calculated. The prevention and control effects of strain HMQ20YJ19 on pepper blight were 60.33% and 69.52% ( Figure 1 ). The greenhouse pot experiment repeatedly verified that the strain HMQ20YJ19 had a stable protective effect against pepper blight and could be further tested in the field.

[0101] Figure 1 The results show the effect of strain HMQ20YJ19 in greenhouse seedling trays and potted plants on preventing and controlling pepper blight. AD, greenhouse seedling tray pepper, EH, greenhouse potted pepper; A and E, strain HMQ20YJ19; B and F, Bacillus subtilis; C and G, fluazinam; D and H, water control.

[0102] 2.3 Gene sequence analysis and identification of strain HMQ20YJ19

[0103] The genome of strain HMQ20YJ19 was extracted, and 16S rRNA, gyrA and cheA genes were amplified by PCR using primer combinations 27F and 1492R, GyrA-F and GyrA-R, CheA-F and CheA-R, respectively. The target fragments were sent to Sangon Biotech (Shanghai) Co., Ltd. for base sequence determination. The lengths of 16S rRNA, gyrA and cheA gene sequences of strain HMQ20YJ19 were 1444 bp, 972 bp and 850 bp, respectively. The obtained sequences were compared with the 16S rRNA, gyrA and cheA gene sequences of some strains in the NCBI database for homology analysis. The results showed that the similarities of 16S rRNA, gyrA and cheA gene sequences of strain HMQ20YJ19 with those of Bacillus spizizenii were 99.86%, 95.10% and 95.98%, respectively. Based on the results of homology comparison analysis, strain HMQ20YJ19 was identified as Bacillus spizizenii, the 16S rRNA gene sequence accession number was OR053811, the gyrA and cheA gene sequences were shown in the sequence listing SEQ ID NO.1 and SEQ ID NO.2, and the strain HMQ20YJ19 was deposited in the China Center for Type Culture Collection (CCTCC) on June 25, 2023. The storage address is: China Center for Type Culture Collection, Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the storage number is CCTCC M 20231085.

[0104] cheA gene sequence

[0105] TACCGGACTTAGCACATCTAACCCACCTGCTTGAGAATGTGCTGGATGCAATCCGAAACGGAGACATGGCAGTTACCCCAGAATGGCTGGATATTTTGTTTGAAGCCCTGGATCACCTGGAAGCCATGGTTCAATCTATTATTGATGGCGGGGATGGTAAAAGAGATATCTCAGAAGTGAGTGCAAAGCTTGATGTGAATGGTGCACACACTGAAATAGCTGCCTCTGCGGAACCTGCAGAAGCACAGAATACAGCATCTGATTGGAAATATGATGAATTTGAGCGGACTGTCATACAAGAAGCGGAGGAGCAAGGTTTCAAACGATATGAAGTCAAGATTTCTCTAAACGAAAACTGTATGTTAAAAGCAGTTCGTGTCTATATGGTGTTTGAGAAACTTAATGAAATTGGAGAAGTAGCCAAAACAATTCCGAGTGCGGAAGTGCTTGAAACAGAAGATTTCGGCACTGACTTTCAAGTTTGTTTCTTAACACATCAATCAGCGGAAGAGATTGCACAATTAATCAATGGTGTCTCAGAAATTGAGCATGTTGAAGTCATTCAAGGGGCTCCTTTAACAACAGCTGAAAAGCCGGAAGAATCTAAGCCGGCAGATTTGCCAGCACCTGTACCTGTGAAGCAGGAGAAACCAAAGCAGCCTGCTAAAAACGAAGAACAGGCGAAGCATACAGCCGGCGGTTCTAAAACAATTCGTGTCAACATTGACAGACTTGATTCTTTAATGAACTTATTTGAAGAGCTTGTCATTGACCGCGGGCGTCTCGAGCAGATTGCAAAAGAACTTGAGCACAATGAACTGACTGAAACGGTTGAACGAATGTACGGTAG

[0106] gyrA gene sequence

[0107] CTGTGAAAAGCAATGAAGCGTTATTGTGTCACGTGCTCTTCCAGATGTTCGTGACGGTTTAAAACCGGTTCATAGACGGATTCTGTATGCAATGAATGATTTGGGCATGACGAGTGACAAGCCTTATAAAAAATCGGCGCGTATCGTCGGAGAAGTTATCGGGAAATACCACCCGCACGGTGATTCAGCGGTATATGAATCCATGGTCAGAATGGCGCAGGATTTTAACTACCGTTACATGCTCGTTGACGGTCACGGGAACTTCGGTTCTGTTGACGGAGACTCAGCGGCTGCCATGCGTTATACAGAAGCAAGAATGTCTAAGATTTCGATGGAAATTCTTCGAGATATCACAAAAGACACAATCGATTATCAGGACAACTATGACGGGTCAGAAAGAGAACCCGTTGTAATGCCTTCAAGATTTCCGAATCTGCTTGTAAACGGCGCTGCCGGCATTGCGGTAGGTATGGCAACAAACATTCCTCCGCATCAGCTTGGAGAAATCATTGACGGTGTACTAGCTGTCAGTGAGAATCCGGACATGACAATCTCAGAGCTTATGGAAGTTATTCCAGGGCCAGATTTCCCGACTGCCGGTCAAATCTTGGGTCGAAGCGGTATACGGAAGGCATACGAAACGGGCCGAGGCTCTATTACGATTCGGGCAAAAGCTGAGATTGAACAAACATCTTCAGGTAAAGAAAGAATTATCGTTACAGAGTTACCTTACCAGGTAAATAAGGCGAAATTAATCGAGAAAATTGCTGATCTCGTTAGGGACAAAAAGATAGAGGGCATTACAGATCTGCGTGATGAGTCAGATCGTACAGGTATGAGAATTGTCATTGAAATCAGACGCGATGGCAATGCGAATGTTATTTTAAACAACCTATACAAACAAACTGCGCTACAAACATCTTTTGGTATCAATCTGCTTGCACTTGTGACGGCCAGCCCGAAAGTTAATTA

[0108] 2.4 Determination of in vitro disease prevention and growth promotion related characteristic substances

[0109] The results of in vitro disease prevention and growth promotion related characteristic substances test showed that strain HMQ20YJ19 can produce siderophore, α-amylase, protease, pectinase, cellulase, IAA and NH3, has nitrogen fixation and phosphorus solubilization ability, and has no potassium solubilization ability ( Figure 2 ).

[0110] Figure 2 The strain HMQ20YJ19 produces disease prevention and growth promotion related characteristic substances. Among them, A, phosphate solubilization; B, iron carrier; C, protease; D, α-amylase; E, cellulase; F, pectinase; G, NH3; H, IAA.

[0111] 2.5 Disease prevention effect in the field

[0112] The artificial inoculation field test was conducted at the Lanzhou Experimental Station of Gansu Academy of Agricultural Sciences. The disease of each treatment was investigated on the 15th day after inoculation of the pathogen, and the control effect was calculated. The control effect of strain HMQ20YJ19 on pepper blight was 64.51±1.02% ( Figure 3 ).

[0113] Figure 3 The results of controlling pepper blight in the field are shown in Figure 1. A, strain HMQ20YJ19; B, Bacillus subtilis; C, fluazinam; and D, clean water control.

[0114] 2.6 Single factor screening of fermentation medium components

[0115] Different carbon sources had a great influence on the viable bacterial count of strain HMQ20YJ19. The viable bacterial count per unit volume of the medium with soluble starch as the carbon source was the largest, which was 3.96 × 10 9 CFU / mL, the effects of other carbon sources on the number of viable bacteria were maltose>lactose>sucrose>glucose, so soluble starch was selected as the carbon source of the culture medium for subsequent experiments.

[0116] When different nitrogen sources were used as culture medium components, the number of viable bacteria per unit volume of strain HMQ20YJ19 was, from largest to smallest, yeast extract, peptone, (NH4)2SO4, NH4Cl, NaNO2, and NH4HCO3. Strain HMQ20YJ19 did not grow in the culture medium with NH4HCO3 as the nitrogen source. The number of viable bacteria in the culture medium with yeast extract as the nitrogen source was significantly higher than that in the culture medium with other nitrogen sources (P<0.05). Therefore, yeast extract was selected as the culture medium nitrogen source for subsequent experiments.

[0117] Different inorganic salt culture media had significant effects on the viable count of strain HMQ20YJ19 (P<0.05). When FeSO4 and CuSO4 were used as inorganic salts, strain HMQ20YJ19 hardly grew. When MgSO4 and NaCl were used as culture medium components, the viable count per unit volume reached the maximum, and the viable counts of the two were consistent. Therefore, MgSO4 and NaCl were selected as culture medium inorganic salts for component ratio optimization ( Figure 4 ).

[0118] Figure 4 This is a single factor screening experiment for the fermentation medium components of strain HMQ20YJ19.

[0119] 2.7 Orthogonal experiment optimization of fermentation medium composition ratio

[0120] Table 5 Variance evaluation results of orthogonal test optimization culture medium

[0121]

[0122] According to the results of the single factor experiment, soluble starch, yeast extract, MgSO4·7H2O, and NaCl were selected as the culture medium components for orthogonal optimization. The results of variance analysis showed that R B >R C >R A >R D , indicating that yeast extract has the greatest impact on the number of viable bacteria in the fermentation broth. D >P A >P C >P B >0.05, indicating that the four factors had no significant effect on the number of viable bacteria, and there was no need to conduct multiple comparisons between the levels of each factor, but to conduct range analysis.

[0123] Table 6 The range evaluation results of orthogonal test optimization culture medium

[0124]

[0125] The results of range analysis showed that yeast extract had the greatest effect on the number of viable cells per unit volume of strain HMQ20YJ19, and the effects of other culture medium components on the number of viable cells were MgSO4·7H2O>soluble starch>NaCl, and the best ratio combination was A3B2C2D3.

[0126] Therefore, the optimal formula of the fermentation medium for strain HMQ20YJ19 was determined to be soluble starch 7.5 g / L, yeast extract 10 g / L, MgSO4·7H2O 5 g / L, and NaCl 7.5 g / L.

[0127] 2.8 Single factor experiment on fermentation conditions

[0128] The effects of different rotation speeds on the number of viable bacteria per unit volume of strain HMQ20YJ19 were significant (P<0.05). At 180 r / min, the number of viable bacteria per unit volume reached the maximum value of 3.96 × 10 9 CFU / mL, so the speed of 180 r / min was selected as the optimal fermentation speed of strain HMQ20YJ19.

[0129] The effects of different fermentation inoculation amounts (also known as "inoculation amounts") on the number of viable bacteria were significantly different (P<0.05). When the inoculation amounts were 1%, 3%, 7%, and 9%, there was no significant effect on the number of viable bacteria in the fermentation broth. However, when the inoculation amount was 5%, the number of viable bacteria in the fermentation broth reached the maximum value of 3.96 × 10 9 CFU / mL, so 5% was selected as the optimal fermentation inoculum size of strain HMQ20YJ19.

[0130] The effects of different temperatures on the number of viable bacteria in the fermentation broth were significantly different (P<0.05). When the temperature was between 26℃ and 30℃, there was no significant difference in the bacterial content of the fermentation broth. At 32℃, the number of viable bacteria in the fermentation broth was significantly higher than that at other temperatures, which was 4.36 × 10 9 CFU / mL, therefore, 32°C was selected as the optimal fermentation temperature for strain HMQ20YJ19.

[0131] At 24 h of fermentation, the number of viable bacteria of strain HMQ20YJ19 was almost 0, indicating that the growth cycle conditions of strain HMQ20YJ19 were not met in 24 h. The maximum number of viable bacteria per unit volume in the fermentation broth was 6.54 × 10 9 CFU / mL, so 72 h of fermentation was selected as the optimal fermentation time for strain HMQ20YJ19.

[0132] The effects of different initial pH values ​​on the number of viable bacteria in the fermentation broth were significantly different (P<0.05). When the initial pH was between 6.5 and 7.5, there was no significant difference in the number of viable bacteria in the fermentation broth. When the initial pH was 7, the number of viable bacteria in the fermentation broth reached the maximum value of 6.98 × 10 9 CFU / mL, so the initial pH of 7 was selected as the optimal initial pH value for fermentation culture of strain HMQ20YJ19 ( Figure 5 ).

[0133] Figure 5 This is a single factor screening test for fermentation conditions of strain HMQ20YJ19.

[0134] 2.9 Plackett-Burman test

[0135] Table 7 Plackett-Burman test design and response values

[0136]

[0137] Table 8 Evaluation of the effects of each factor in Plackett-Burman experimental design

[0138]

[0139] Minitab 17 software was used to perform multiple regression analysis on the data in Table 7, and the regression equation Y=1.650-0.073X1+0.597X2+0.130X3+0.177X4+0.073X5 with the number of viable bacteria as the response value was obtained, and the effect evaluation of each factor was obtained. According to the size of the effect value, the key factors affecting the number of viable bacteria per unit volume of strain HMQ20YJ19 are: X2 (inoculation amount) > X4 (time) > X3 (temperature) > X5 (initial pH) > X1 (speed). The five factors all reached a significant level for the number of viable bacteria per unit volume of fermentation broth (P<0.05). Therefore, speed, inoculation amount, temperature, time and initial pH were selected as key factors for response surface optimization design.

[0140] 2.10 Response surface analysis and optimization

[0141] According to the five key factors screened out by the Plackett-Burman test, the Box-Behnken test design was carried out. The variance analysis of the test design factors, response values ​​and regression equations is shown in Tables 9 and 10.

[0142] Table 9 Box-Behnken response surface experimental design and results

[0143]

[0144] Table 10 Results of variance analysis of regression model

[0145]

[0146] Design-Expert 10.0.3 was used to perform quadratic linear fitting regression on the test data in Table 9, and the quadratic polynomial regression equation was obtained:

[0147] Y=2.16-0.15X1+0.27X2-0.50X3+0.14X4-1.15X5+0.18X1X2-1.13X1X3+0.045X1X4- 0.75X1X5-0.055X2X3+0.14X2X4-0.56X2X5-0.26X3X4+1.09X3X5-0.030X4X5+1.08X1 2+2.917E-003X2 2 +0.31X3 2 -0.24X4 2 +0.89X5 2 .

[0148] The regression model was subjected to variance analysis. As shown in Table 10, the model (P<0.0001) was extremely significant, and the lack of fit term P=0.1723>0.05 (not significant), indicating that the regression model was reliable and could be used to optimize the number of viable bacteria in the fermentation of strain HMQ20YJ19. The coefficient of determination R2=0.93, indicating a high degree of fit, R Adj 2 (0.87) and R Pre 2 The difference between (0.73) and (0.73) is <0.2, indicating that the model prediction value has a high degree of fit with the actual value, so the model can be used for the prediction and analysis of the number of viable bacteria in the fermentation of strain HMQ20YJ19.

[0149] In summary, the optimal conditions for the number of viable bacteria in the fermentation of strain HMQ20YJ19 are: speed 200 r / min, inoculation amount 4.49%, temperature 30.59℃, time 55.90 h and initial pH 6.60. According to the experimental design and actual production conditions, the optimal adjustment conditions are speed 200 r / min, inoculation amount 5%, temperature 31℃, time 56 h and initial pH 7.0. Under these conditions, the model predicts that the maximum number of viable bacteria is 6.75 × 10 9 CFU / mL. The validation test was carried out under this optimal condition and the number of viable bacteria was 6.51 × 10 9 CFU / mL, which was close to the model prediction value (96.44%), indicating that the model had high credibility and could be applied to the fermentation of strain HMQ20YJ19.

[0150] 2.11 Effect of fermentation liquid of strain HMQ20YJ19 on the prevention of tomato gray mold in potted plants

[0151] The effect test of potted plants on the prevention and control of tomato gray mold was conducted in the greenhouse of the Institute of Plant Protection, Gansu Academy of Agricultural Sciences. The disease situation of each treated plant was investigated 7 days after the third treatment, and the disease index and control effect were calculated. The control effect of strain HMQ20YJ19 on tomato gray mold was 66.52% ( Figure 6 ).

[0152] Figure 6 The effect of the fermentation liquid of strain HMQ20YJ19 on preventing and controlling gray mold in tomato potted plants. A, strain HMQ20YJ19; B, Bacillus subtilis; C, pyraclostrobin; D, water control.

[0153] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A strain of Bacillus sp. Bacillus spizizenii )HMQ20YJ19, its deposit number is CCTCCNO: M 20231085.

2. A method comprising the Bacillus spitzeicheni ( Bacillus spizizenii )HMQ20YJ19 microbial agent.

3. The Bacillus sp. Bacillus spizizenii ) The preparation method of HMQ20YJ19 microbial agent is characterized by: Bacillus spitzeizenii ( Bacillus spizizenii )HMQ20YJ19 was added into the culture medium for fermentation; the formula of the culture medium was: 7.5 g / L soluble starch, 10 g / L yeast extract, 5 g / L MgSO4·7H2O and 7.5 g / L NaCl.

4. According to the Bacillus spizenzae described in claim 3 ( Bacillus spizizenii ) The preparation method of HMQ20YJ19 microbial agent is characterized by: The specific conditions of the fermentation are: fermentation at a rotation speed of 160-220 r / min, a bacterial inoculation amount of 3-7%, a fermentation temperature of 30-34° C., a fermentation time of 48-72 h and an initial pH of 6.5-7.

5.

5. The preparation method according to claim 4, characterized in that: Bacillus spitzeizenii ( Bacillus spizizenii )HMQ20YJ19 was added into the culture medium, and fermentation was carried out at a speed of 200 r / min, an inoculum size of 5%, a fermentation temperature of 31 °C, a fermentation time of 56 h and an initial pH of 7.

0.

6. The Bacillus spizezenii of claim 1 ( Bacillus spizizenii ) HMQ20YJ19 strain or the microbial agent described in claim 2 in the preparation of a drug for preventing and treating pathogenic fungi; the pathogenic fungi is any one of the following: Alternaria bean Alternaria azukiae )、Botrytis cinerea( Botrytis aclada )、Botrytis cinerea( B . cinerea ), Botrytis cinerea ( B . elliptica ) Colletorichum fioriniae graminearum ( Fusarium graminearum ), Fusarium oxysporum ( F . oxysporum ) F. solani )、Verticillium spp.( F. verticillioides )、Phytophthora capsici( Phytophthora capsici ), Pyricularia oryzae Pyricularia oryzae ) Rhizoctonia solani ) and Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ).

7. The Bacillus spizenzae according to claim 1 ( Bacillus spizizenii ) Use of the HMQ20YJ19 strain or the microbial agent described in claim 2 in the preparation of a drug for preventing and treating plateau summer vegetable diseases in Gansu Province; the plateau summer vegetable diseases are pepper blight or tomato gray mold.

8. A medicine, characterized in that: The active ingredient comprises the Bacillus spitzeicheni described in claim 1 ( Bacillus spizizenii )HMQ20YJ19 strain or the microbial agent described in claim 2.

9. The drug according to claim 8, characterized in that: The drug also includes pharmaceutically acceptable excipients.

Images