Artemisia alcohol synthase and its applications
By screening and designing artemisol synthetase and synthesizing artemisol by using the yeast expression system, the complex and cost-effective artemisol extraction process was solved, efficient and economical artemisol production was achieved, and the industrial production of antibacterial, anti-worm and herbicidal products were promoted.
Patent Information
- Application Number
- CN202311101252.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-30
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2043-08-30
AI Technical Summary
In the prior art, the extraction process of artemisol is complex, time-consuming and labor-intensive, and the content of artemisol in natural plant extracts is low, making it difficult to efficiently obtain essential oils with high concentrations of artemisol, resulting in high cost.
Artemisol synthetase was obtained through screening, encoding nucleic acid molecules were designed and recombinant plasmid vectors were prepared, and artemisol was synthesized during the fermentation process using the yeast expression system. Artemisol was recovered by oil-phase extraction method to achieve efficient production.
It has achieved efficient and continuous production of artemisol, reduced production costs, and expanded its application potential in antibacterial, deworming and herbicidal products.
Smart Images

Figure CN117126837B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to artemisia alcohol synthase and its applications. Background Art
[0002] Artemisia argyi is a traditional livelihood plant in China. Its extracts and combustion products are commonly used for mosquito repellent. Existing research shows that Artemisia argyi is rich in volatile terpenoid compounds, and terpenoid compounds have also attracted much attention due to their significant pharmacological activities. However, there has been relatively little systematic characterization of the terpenoid genes in Artemisia argyi.
[0003] Artemisia alcohol is a sesquiterpenoid compound, which has been reported in various plant essential oils (such as grape seed essential oil, citrus essential oil, etc.). It has a special odor and can be used in food or daily chemical products. However, the entire process from planting to extraction of plant essential oils is very complex, time-consuming and laborious, and requires a large amount of plant peels, so its extraction cost is quite high and the value is quite expensive. Moreover, the content of artemisia alcohol in natural plant extracts is very low, and it is difficult to isolate plant essential oils containing high-concentration artemisia alcohol by the separation method of natural products. Therefore, finding a more economical way to obtain essential oil substances with a special odor and high artemisia alcohol concentration is an inevitable trend for achieving economic efficiency, high quality and sustainable development. Summary of the Invention
[0004] The purpose of the present invention is to provide an artemisia alcohol synthase and its application in preparing a composition with a special fragrance mainly composed of artemisia alcohol in an expression system, so as to achieve the purpose of efficient and continuous production.
[0005] To achieve the above purpose, the present invention provides the following technical solutions:
[0006] In a first aspect, the present invention provides an artemisia alcohol synthase, which comprises (a) a complete protein or a functional protein fragment derived from a plant or a fungus; or (b) a derivative artemisia alcohol synthase having at least 80% amino acid sequence homology with (a).
[0007] In an alternative embodiment, the plant is selected from plants of the family Asteraceae.
[0008] In an alternative embodiment, the plant is selected from plants of the genus Artemisia.
[0009] In an alternative embodiment, the plant includes Artemisia argyi.
[0010] In an alternative embodiment, the artemisia alcohol synthase catalyzes the synthesis of artemisia alcohol in an expression system.
[0011] In an alternative embodiment, the expression system includes a fungal expression system.
[0012] In an alternative embodiment, the fungal expression system includes a yeast expression system.
[0013] In an alternative embodiment, the yeast expression system includes a Saccharomyces cerevisiae expression system.
[0014] In an alternative embodiment, the Saccharomyces cerevisiae is recombinant Saccharomyces cerevisiae, and the recombinant Saccharomyces cerevisiae contains a farnesyl pyrophosphate synthase gene.
[0015] In an alternative embodiment, the copy number of the farnesyl pyrophosphate synthase gene in the genome of the recombinant Saccharomyces cerevisiae is 1 to 3, and further preferably 2.
[0016] In an alternative embodiment, the copy number of at least one gene related to the mevalonate pathway in the genome of the recombinant Saccharomyces cerevisiae is above 1.
[0017] In an alternative embodiment, the copy number of at least one of the genes ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1 or IDI1 is 1 to 3, preferably 2 or 3.
[0018] In an alternative embodiment, the inhibitor GAL80 gene and / or the activating cis-element or its fragment within the range of -175 to -220 upstream of the ERG9 promoter are knocked out in the genome of the Saccharomyces cerevisiae.
[0019] In an alternative embodiment, the amino acid sequence of the artemisinol synthase includes (a) or (b):
[0020] (a) SEQ ID NO:1;
[0021] (b) A derivative artemisinol synthase having at least 80%, 81%, 83%, 85%, 87%, 89%, 91%, 93%, 95%, 97% or 99% or more amino acid sequence identity with (a).
[0022] In a second aspect, the present invention provides a nucleic acid molecule, which contains a nucleotide sequence encoding the artemisinol synthase according to any one of the foregoing embodiments or a nucleotide sequence complementary to its base.
[0023] In an alternative embodiment, the nucleic acid molecule contains an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the nucleotide sequence shown in SEQ ID No:3.
[0024] Thirdly, the present invention provides a recombinant expression vector containing the nucleic acid molecule described in any one of the foregoing embodiments, and the original vector of the recombinant expression vector includes pZY900, pYR017, pYR018 or pKlURA100.
[0025] Fourthly, the present invention provides a transformant containing the nucleic acid molecule described in any one of the foregoing embodiments, or containing the recombinant expression vector described in the foregoing embodiment, and the host cell of the transformant is selected from a fungal expression system, preferably a yeast expression system, and more preferably a Saccharomyces cerevisiae expression system.
[0026] Fifthly, the present invention provides a recombinant Saccharomyces cerevisiae containing the nucleic acid molecule described in any one of the foregoing embodiments, or containing the recombinant expression vector described in the foregoing embodiment, and the recombinant Saccharomyces cerevisiae further contains a farnesyl pyrophosphate synthase gene.
[0027] In an alternative embodiment, the copy number of the farnesyl pyrophosphate synthase gene in the genome of the recombinant Saccharomyces cerevisiae is 1 to 3, and further is 2.
[0028] In an alternative embodiment, the copy number of at least one gene related to the mevalonate pathway in the genome of the recombinant Saccharomyces cerevisiae is above 1.
[0029] In an alternative embodiment, the copy number of at least one gene among ERG10 gene, ERG13 gene, tHMG1 gene, ERG12 gene, ERG8 gene, MVD1 gene or IDI1 gene is 1 to 3, preferably 2 or 3.
[0030] In an alternative embodiment, the inhibitor GAL80 gene and / or the activating cis-element or its fragment within the range of -175 to -220 upstream of the ERG9 promoter in the genome of the Saccharomyces cerevisiae are knocked out.
[0031] Sixthly, the present invention provides a preparation method of the recombinant Saccharomyces cerevisiae described in any one of the foregoing embodiments, and the preparation method includes the steps:
[0032] (a) Transforming the nucleic acid molecule described in any one of the foregoing embodiments or the recombinant expression vector described in the foregoing embodiment into a Saccharomyces cerevisiae cell;
[0033] (b) Increasing the copy number of the farnesyl pyrophosphate synthase gene and / or the gene related to the mevalonate pathway in the genome of the Saccharomyces cerevisiae by gene editing;
[0034] The implementation order of the step (a) and the step (b) is not sequential.
[0035] In an alternative embodiment, the copy number of the farnesyl pyrophosphate synthase gene is 1 to 3, and further is 2.
[0036] In an alternative embodiment, the copy number of at least one of the genes ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1 or IDI1 is 1 to 3, preferably 2 or 3.
[0037] In an alternative embodiment, the preparation method includes transforming a GAL80 gene knockout expression cassette and / or an ERG9 promoter upstream activating cis-element knockout or partial knockout expression cassette into Saccharomyces cerevisiae cells.
[0038] In a seventh aspect, the present invention provides a method for preparing artemisia alcohol, the preparation method including fermenting and culturing the transformant described in the foregoing embodiment, or fermenting and culturing the recombinant Saccharomyces cerevisiae described in any one of the foregoing embodiments, or fermenting and culturing the recombinant Saccharomyces cerevisiae prepared by the preparation method described in any one of the foregoing embodiments, and recovering artemisia alcohol from the fermentation product.
[0039] In an alternative embodiment, the recovery method includes using oil phase extraction of the fermentation product.
[0040] In an alternative embodiment, the oil phase includes n-hexane, n-dodecane and / or isopropyl myristate.
[0041] In an alternative embodiment, the recovery method is that during the fermentation process, an oil phase is added, and after the fermentation is completed, the oil phase is collected, and artemisia alcohol enriched in the oil phase is separated and obtained.
[0042] In an alternative embodiment, the method for collecting the oil phase includes centrifugation.
[0043] In an alternative embodiment, the separation method includes rectification.
[0044] In an eighth aspect, the present invention provides the use of artemisia alcohol obtained by the preparation method described in any one of the foregoing embodiments in the preparation of antibacterial products, insecticidal products or herbicidal products.
[0045] In an alternative embodiment, the types of microorganisms that the antibacterial product can inhibit or kill include fungi.
[0046] In an alternative embodiment, the fungi include one or more of the genera Rhizoctonia, Plasmodiophora, Pythium, Phytophthora, Rhizopus, Valsa, Venturia, Monilinia, Erysiphe, Piriformospora, Oidium, Verticillium, Botrytis, Alternaria, Fusarium, Sphaceloma, Gibberella, Colletotrichum, Puccinia.
[0047] In an alternative embodiment, the Rhizoctonia fungi include Rhizoctonia solani.
[0048] In an alternative embodiment, the types of insects that the pesticidal product can repel or kill include insects of the families Culicidae, Miridae or Delphacidae.
[0049] In an alternative embodiment, the insects of the family Culicidae include one or more of the genera Aedes, Anopheles, Armigeres, Coquillettidia, Culex, Culiseta, Ficalbia, Heizmznnia, Hemagogus, Hodgesia, Malaya, Mansonia, Minmomyia, Orthopodomyia, Sabethes, Topomyia, Toxorhynchites, Tripteroides, Udaya, Uranotaenia.
[0050] In an alternative embodiment, the insects of the genus Aedes include Aedes aegypti.
[0051] In an alternative embodiment, the Miridae insects include the genera Acomocera, Adelphococris, Agnocoris, Alcecoris, Alloeotomus, Allorhinocoris, Angerianus, Apilophorus, Apolygopsis, Apolygus, Arbolygus, Argenis, Astroscopometopus, Bertsa, Blepharidopterus, Bothriomiris, Bothynotus, Brachycoleus, Bryocoris, Campylotropis, Capsodes, Capsus, Castanopsides, Charagochilus, Cheilocapsidea, Cheilocapsus, Chilocrates, Chrysorrhanis, Cimicicapsus, Cimidaeorus, Closterotomus, Coridromius, Creontiades, Cylapofulvuitius, Cylapomorpha, Cyllecoris, Cyphodemidea, Cyrtopeltis, Cyrtorhinus,Deraeocoris, Genus Dichrooscytus, Genus Dicyphus, Genus Dimia, Genus Dioclerus, Genus Dolichomiris, Genus Dortus, Genus Dryophilocoris, Genus Ectmetopterus, Genus Elthemidea, Genus Eolygus, Genus Erimiris, Genus Ernestinus, Genus Eupachypeltis, Genus Eurvopicoris, Genus Eurystylomorpha, Genus Eurystylopsis, Genus Eurystylus, Genus Excentricus, Genus Felisacus, Genus Finqulus, Genus Fulvius, Genus Globiceps, Genus Guisardinus, Genus Guisardus, Genus Halticus, Genus Harpedona, Genus Hekista, Genus Helopeltis, Genus Heterolyqus, Genus Heteropantilius, Genus Hyalopeplinus, Genus Hyalopeplus, Genus Hyoidea, Genus Isabel, Genus Isometopidea, Genus Isometopus, Genus Jessopocoris, Genus Labopidea, Genus Labops, Genus Lasiomiris, Genus Lasiomiris, GenusLatizanchius, Genus Leptopterna, Genus Liistonotus, Genus Loristes, Genus Lygidea, Genus Lygocorides, Genus Lygocoris, Genus Lygus, Genus Macrolonius, Genus Macrolophus, Genus Macrolygus, Genus Malacocorisella, Genus Mansoniella, Genus Mecistoscelis, Genus Mecomma, Genus Megacoelum, Genus Mermitelocerus, Genus Metasequoiamiris, Genus Michailocoris, Genus Monalocoris, Genus Myiomma, Genus Myrmecophyes, Genus Myrmecoris, Genus Mystilus, Genus Neolygus, Genus Nesidiocoris, Genus Nicostratus, Genus Notostir, Genus Onomaus, Genus Orientomiris, Genus Orhocephalus, Genus Orthops, Genus Orthotylus, Genus Pachypeltis, Genus Paloniella, Genus Pantilius, Genus Paracyphodema, Genus Paramiridius, Genus Paranx, Genus Parapachypeltis, Genus Peltidolygus, GenusPeritropis, Phytocoridea, Phytocoris, Pinalitus, Polymerus, Poppiocapsidea, Proboscidocoris, Prodromus, Prolygus, Psallops, Pseudodoniella, Pseudoloxops, Raawelellus, Reuterista, Rhabdomiris, Rhinocylapidius, Rhinomiris, Rhopaliceschatus, Sabactiopus, Salignus, Scirtetellus, Sinevi, Singhalesia, Sophianus, Stenodema, Stenotus, Stethoconus, Strongylocoris, Sulawesifaulvius, Tailorilygus, Teratocoris, Termatophylum, Tinginotopsis, Tinginotum, Tolongia, Totta, Trigonotylus, Tupiocoris, Ulmica, Ulmocyllus, Zanchius, Genusone or more of Zonodoropsis).
[0052] In an alternative embodiment, the insect of the genus Adelphococris includes Adelphocoris suturalis.
[0053] In an alternative embodiment, the Delphacidae insects include one or more of the genera Nilaparvata, Unkanodes, Neunkanodes, Laodelphax, Ribautodelphax, Megadelphax, Muirodelphax, Fangdelphax, Neoterthrona, Ramidelphax, Neuterthron, Miranus, Sogata, Parasogata, Neometopina, Changeondelphax, Chloriona, Paradelphacodes, Muellerianella.
[0054] In an alternative embodiment, the Delphacidae insects include Nilaparvata lugens.
[0055] In an alternative embodiment, the plant species that the weeding product can inhibit or kill include one or more of the families Brassicaceae, Asteraceae, Solanaceae, Convolvulaceae, Rubiaceae, Crassulaceae, Cannabaceae, Polygonaceae, Caryophyllaceae, Amaranthaceae, Portulacaceae, Ranunculaceae, Rosaceae, Plantaginaceae, Vitaceae, Euphorbiaceae, Apiaceae, Lamiaceae, Malvaceae, Poaceae, Cyperaceae, Juncaceae, Liliaceae, Commelinaceae, Amaryllidaceae, Alismataceae.
[0056] In an alternative embodiment, the cruciferous plant includes Arabidopsis, Alliaria, Alyssum, Aphragmus, Arabidopsis, Arabis, Armoracia, Atelanthera, Barbarea, Berteroa, Berteroella, Brassica, Braya, Bunias, Camelina, Capsella, Cardamine, Cardaria, Cheiranthus, Chorispora, Christolea, Clausia, Cochlearia, Coelonema, Conringia, Coronopus, Crambe, Cryptospora, Descurainia, Dilophia, Dimorphostemon, Diplotaxis, Dipoma, Diptychocarpus, Dontostemon, Draba, Eruca, Erysimum, Euclidium, Eutrema, Goldbachia, Hedinia, Hemilophia, Hesperis, Hymenolobus, Iberis, Isatis, Lachnoloma, Lepidium, Leptaleum, Lignariella, Litwinowia, Lobularia, Loxostemon, Macropodium, Malcolmia, Matthiola, Megacarpaea, Megadenia, Microsisymbrium, Microstigma, Nasturtium,One or more of the genera Neomartinella, Neslia, Orychophragmus, Pachypterygium, Parrya, Parryodes, Pegaeophyton, Phaeonychium, Platycraspedum, Ptilotricum, Pugionium, Pycnoplinthus, Raphanus, Rorippa, Sinapis, Sisymbrium, Smelowskia, Solms-Laubachia, Sophiopsis, Spirorhynchus, Staintoniella, Sterigmostemum, Stevenia, Stroganowia, Synstemon, Syrenia, Taphrospermum, Tauscheria, Tetracme, Thellungiella, Thlaspi, Torularia, Turritis, Yinshania.
[0057] In an alternative embodiment, the Brassicaceae plant includes one or more of the genera Arabidopsis, Capsella, Cardamine, Lepidium, Orychophragmus, Draba, Thellungiella, Erysimum, Descurainia, Rorippa.
[0058] In an alternative embodiment, the Arabidopsis plant includes Arabidopsis thaliana.
[0059] In a ninth aspect, the present invention provides an antibacterial agent, which contains artemisia alcohol obtained by using the preparation method according to any one of the foregoing embodiments.
[0060] In an alternative embodiment, the effective dose of the artemisia alcohol is 10 - 100 ppm.
[0061] In an alternative embodiment, the dosage form of the antibacterial agent includes tablets, injections, capsules, powders, premixes, granules, soluble powders, oral solutions, gels or ointments.
[0062] In an alternative embodiment, the types of microorganisms that the antimicrobial agent can inhibit or kill include fungi.
[0063] In an alternative embodiment, the fungi include one or more of the genera Rhizoctonia, Plasmodiophora, Pythium, Phytophthora, Rhizopus, Valsa, Venturia, Monilinia, Erysiphe, Piriformospora, Oidium, Verticillium, Botrytis, Alternaria, Fusarium, Sphaceloma, Gibberella, Colletotrichum, Puccinia.
[0064] In an alternative embodiment, the Rhizoctonia fungi include Rhizoctonia solani.
[0065] In a tenth aspect, the present invention provides an insecticide, which contains artemisia alcohol obtained by the preparation method according to any one of the foregoing embodiments.
[0066] In an alternative embodiment, the effective dose of the artemisia alcohol is 500 - 5000 ppm.
[0067] In an alternative embodiment, the dosage forms of the insecticide include emulsion in water, suspension concentrate, dry powder, wettable powder, emulsifiable concentrate, thermal fogging agent, aerosol, soluble granule, fumigant, bait, granule or slow release agent.
[0068] In an alternative embodiment, the types of insects that the insecticide can repel or kill include insects of the families Culicidae, Miridae or Delphacidae.
[0069] In an alternative embodiment, the insects of the family Culicidae include one or more of the genera Aedes, Anopheles, Armigeres, Coquillettidia, Culex, Culiseta, Ficalbia, Heizmznnia, Hemagogus, Hodgesia, Malaya, Mansonia, Minmomyia, Orthopodomyia, Sabethes, Topomyia, Toxorhynchites, Tripteroides, Udaya, Uranotaenia.
[0070] In an alternative embodiment, the insects of the genus Aedes include Aedes aegypti.
[0071] In an alternative embodiment, the Miridae insects include the genus Acomocera, Adelphococris, Agnocoris, Alcecoris, Alloeotomus, Allorhinocoris, Angerianus, Apilophorus, Apolygopsis, Apolygus, Arbolygus, Argenis, Astroscopometopus, Bertsa, Blepharidopterus, Bothriomiris, Bothynotus, Brachycoleus, Bryocoris, Campylotropis, Capsodes, Capsus, Castanopsides, Charagochilus, Cheilocapsidea, Cheilocapsus, Chilocrates, Chrysorrhanis, Cimicicapsus, Cimidaeorus, Closterotomus, Coridromius, Creontiades, Cylapofulvuitius, Cylapomorpha, Cyllecoris, Cyphodemidea, Cyrtopeltis, Cyrtorhinus,Deraeocoris, Genus Dichrooscytus, Genus Dicyphus, Genus Dimia, Genus Dioclerus, Genus Dolichomiris, Genus Dortus, Genus Dryophilocoris, Genus Ectmetopterus, Genus Elthemidea, Genus Eolygus, Genus Erimiris, Genus Ernestinus, Genus Eupachypeltis, Genus Eurvopicoris, Genus Eurystylomorpha, Genus Eurystylopsis, Genus Eurystylus, Genus Excentricus, Genus Felisacus, Genus Finqulus, Genus Fulvius, Genus Globiceps, Genus Guisardinus, Genus Guisardus, Genus Halticus, Genus Harpedona, Genus Hekista, Genus Helopeltis, Genus Heterolyqus, Genus Heteropantilius, Genus Hyalopeplinus, Genus Hyalopeplus, Genus Hyoidea, Genus Isabel, Genus Isometopidea, Genus Isometopus, Genus Jessopocoris, Genus Labopidea, Genus Labops, Genus Lasiomiris, GenusLatizanchius), Leptopterna, Liistonotus, Loristes, Lygidea, Lygocorides, Lygocoris, Lygus, Macrolonius, Macrolophus, Macrolygus, Malacocorisella, Mansoniella, Mecistoscelis, Mecomma, Megacoelum, Mermitelocerus, Metasequoiamiris, Michailocoris, Monalocoris, Myiomma, Myrmecophyes, Myrmecoris, Mystilus, Neolygus, Nesidiocoris, Nicostratus, Notostir, Onomaus, Orientomiris, Orhocephalus, Orthops, Orthotylus, Pachypeltis, Paloniella, Pantilius, Paracyphodema, Paramiridius, Paranx, Parapachypeltis, Peltidolygus, PeltisPeritropis, Phytocoridea, Phytocoris, Pinalitus, Polymerus, Poppiocapsidea, Proboscidocoris, Prodromus, Prolygus, Psallops, Pseudodoniella, Pseudoloxops, Raawelellus, Reuterista, Rhabdomiris, Rhinocylapidius, Rhinomiris, Rhopaliceschatus, Sabactiopus, Salignus, Scirtetellus, Sinevi, Singhalesia, Sophianus, Stenodema, Stenotus, Stethoconus, Strongylocoris, Sulawesifaulvius, Tailorilygus, Teratocoris, Termatophylum, Tinginotopsis, Tinginotum, Tolongia, Totta, Trigonotylus, Tupiocoris, Ulmica, Ulmocyllus, Zanchius, GenusOne or more of Zonodoropsis).
[0072] In an alternative embodiment, the insects of the genus Adelphococris include Adelphocoris suturalis.
[0073] In an alternative embodiment, the Delphacidae insects include one or more of the genera Nilaparvata, Unkanodes, Neunkanodes, Laodelphax, Ribautodelphax, Megadelphax, Muirodelphax, Fangdelphax, Neoterthrona, Ramidelphax, Neuterthron, Miranus, Sogata, Parasogata, Neometopina, Changeondelphax, Chloriona, Paradelphacodes, Muellerianella.
[0074] In an alternative embodiment, the Delphacidae insects include Nilaparvata lugens.
[0075] In a tenth aspect, the present invention provides a herbicide, which contains artemisia alcohol obtained by the preparation method described in any one of the foregoing embodiments.
[0076] In an alternative embodiment, the effective dose of artemisia alcohol is 25-200 ppm.
[0077] In an alternative embodiment, the dosage form of the herbicide includes aqueous solution, emulsifiable concentrate, suspension concentrate, emulsion in water, microemulsion, oil suspension, microcapsule suspension, soluble liquid, film-forming oil, wettable powder, soluble powder, soluble granule, dry suspension or water-dispersible granule.
[0078] In an alternative embodiment, the plant species that the herbicide can inhibit or kill include one or more of Cruciferae, Compositae, Solanaceae, Convolvulaceae, Rubiaceae, Crassulaceae, Cannabaceae, Polygonaceae, Caryophyllaceae, Amaranthaceae, Portulacaceae, Ranunculaceae, Rosaceae, Plantaginaceae, Vitaceae, Euphorbiaceae, Umbelliferae, Labiatae, Malvaceae, Gramineae, Cyperaceae, Juncaceae, Liliaceae, Commelinaceae, Amaryllidaceae, Alismataceae, etc.
[0079] In an alternative embodiment, the cruciferous plant includes Arabidopsis, Alliaria, Alyssum, Aphragmus, Arabidopsis, Arabis, Armoracia, Atelanthera, Barbarea, Berteroa, Berteroella, Brassica, Braya, Bunias, Camelina, Capsella, Cardamine, Cardaria, Cheiranthus, Chorispora, Christolea, Clausia, Cochlearia, Coelonema, Conringia, Coronopus, Crambe, Cryptospora, Descurainia, Dilophia, Dimorphostemon, Diplotaxis, Dipoma, Diptychocarpus, Dontostemon, Draba, Eruca, Erysimum, Euclidium, Eutrema, Goldbachia, Hedinia, Hemilophia, Hesperis, Hymenolobus, Iberis, Isatis, Lachnoloma, Lepidium, Leptaleum, Lignariella, Litwinowia, Lobularia, Loxostemon, Macropodium, Malcolmia, Matthiola, Megacarpaea, Megadenia, Microsisymbrium, Microstigma, Nasturtium, Neomartinella, Neslia, Orychophragmus, Pachypterygium, Parrya, Parryodes, Pegaeophyton, Phaeonychium,One or more of the following genera: Platycraspedum, Ptilotricum, Pugionium, Pycnoplinthus, Raphanus, Rorippa, Sinapis, Sisymbrium, Smelowskia, Solms-Laubachia, Sophiopsis, Spirorhynchus, Staintoniella, Sterigmostemum, Stevenia, Stroganowia, Synstemon, Syrenia, Taphrospermum, Tauscheria, Tetracme, Thellungiella, Thlaspi, Torularia, Turritis, Yinshania, etc.
[0080] In an alternative embodiment, the Brassicaceae plant includes one or more of the following genera: Arabidopsis, Capsella, Cardamine, Lepidium, Orychophragmus, Draba, Thellungiella, Erysimum, Descurainia, Rorippa.
[0081] In an alternative embodiment, the Arabidopsis plant includes Arabidopsis thaliana.
[0082] In the present invention, synthases with artemisia alcohol synthesis activity are screened from Artemisia argyi and fungi respectively. According to the amino acid sequences of the screened artemisia alcohol synthases, nucleic acid molecules for encoding are designed, and then recombinant plasmid vectors and expression systems for expressing artemisia alcohol synthases are prepared, which have the potential to be applied to the high-yield synthesis of artemisia alcohol, make up for the time-consuming and laborious plant extraction, and promote the industrial production of antibacterial, insecticidal and herbicidal products. BRIEF DESCRIPTION OF THE DRAWINGS
[0083] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0084] Figure 1 Schematic diagrams for the construction of plasmids p900A19, p905A19 and p908A19;
[0085] Figure 2Schematic diagrams for the construction of plasmids p900-V5-15 and p900-VvPNSelnt;
[0086] Figure 3 GC-MS detection results of the fermentation products of strain J900A19;
[0087] Figure 4 For the product of A19 1 1H NMR spectrum (600 MHz, CDCl3);
[0088] Figure 5 For the product of A19 13 13C NMR spectrum (150 MHz, CDCl3);
[0089] Figure 6 Topological structure diagrams of COSY and ROESY for the product of A19;
[0090] Figure 7 COSY spectrum of the product of A19;
[0091] Figure 8 ROESY spectrum of the product of A19;
[0092] Figure 9 X-RAY crystal structure diagram of the product of A19;
[0093] Figure 10 Mosquito repellency rate of (+)-intermedeol against Aedes aegypti. The abscissa is the concentration of (+)-intermedeol, and the ordinate is the repellency rate. Different letters indicate significant differences (P < 0.05);
[0094] Figure 11 Repellent effect of (+)-intermedeol against Nilaparvata lugens. The abscissa is the concentration of (+)-intermedeol, and the ordinate is the proportion of Nilaparvata lugens choosing different odor sources. Different letters indicate significant differences (P < 0.05);
[0095] Figure 12 The abscissa is the concentration of (+)-intermedeol, and the ordinate is the proportion of Adelphocoris suturalis choosing different odor sources. Different letters indicate significant differences (P < 0.05), and different letters indicate significant differences (P < 0.05);
[0096] Figure 13 Antibacterial effect experiment of (+)-intermedeol against Rhizoctonia solani. The abscissa is the concentration of (+)-intermedeol, and the ordinate is the diameter and inhibition rate of the inhibition zone;
[0097] Figure 14For the experiment on the inhibitory effect of (+)-intermedeol on the growth of Arabidopsis thaliana seedlings, the abscissa represents the concentration of (+)-intermedeol, and the ordinate represents the length of the seedlings' roots. Detailed implementation manners
[0098] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are some but not all of the embodiments of the present invention.
[0099] (Ⅰ) Definitions or terms
[0100] Regarding the relevant definitions or terms involved in the present invention, the following abbreviations are used. Unless otherwise defined, all scientific and technical terms used herein have the meanings commonly understood by those of ordinary skill in the art. The following terms are provided below.
[0101] 1. Artemisia alcohol synthase
[0102] The artemisia alcohol synthase described in the present invention refers to the artemisia alcohol synthase that has not been successfully isolated and purified before the present invention. This is because artemisia alcohol is a terpene compound, and traditional terpene synthases are usually natural enzymes. Enzymes with terpene synthesis expressed in plant cells in the natural environment are usually adapted to the plant cell expression system and terpene synthesis system. However, the artemisia alcohol synthase provided by the present invention is a novel enzyme that can be successfully expressed in an artificially constructed expression system and can synthesize artemisia alcohol.
[0103] 2. Homology
[0104] The "homology" described in the present invention has the generally recognized meaning in the art, and the percentage of sequence identity between two nucleic acids or polypeptides or regions can be calculated using publicly available techniques. For example, sequence identity can be measured along the entire length of a polynucleotide or polypeptide or along a region of the molecule. Currently, there are many methods for measuring the identity between two polynucleotides or polypeptides available for those skilled in the art to make a conventional selection according to actual needs.
[0105] 3. Expression
[0106] The expression described in the present invention refers to the process of producing a polypeptide through the transcription and translation of a polynucleotide. The expression level of a polypeptide can be evaluated using any method known in the art, including, for example, methods for measuring the amount of polypeptide produced from a host cell. Such methods can include, but are not limited to, quantifying the polypeptide in cell lysates by ELISA, Coomassie blue staining after gel electrophoresis, Lowry protein assay, and Bradford protein assay.
[0107] 4. Host cell
[0108] The host cell described in the present invention is a cell used to receive, maintain, replicate, and amplify a vector. The host cell can also be used to express the polypeptide encoded by the vector. When the host cell divides, the nucleic acid contained in the vector replicates, thereby amplifying the nucleic acid. The host cell can be a eukaryotic cell or a prokaryotic cell.
[0109] 5. Vector
[0110] The vector described in the present invention is a replicable nucleic acid, and when the vector is transformed into an appropriate host cell, one or more heterologous proteins can be expressed from the vector. Regarding vectors, those typically include vectors into which nucleic acids encoding polypeptides or fragments thereof can be introduced through restriction enzyme digestion and ligation. Regarding vectors, those also include vectors containing nucleic acids encoding polypeptides. The vector is used to introduce the nucleic acid encoding the polypeptide into the host cell for amplifying the nucleic acid or for expressing / displaying the polypeptide encoded by the nucleic acid. The vector usually remains free, but can be designed to integrate a gene or a part thereof into the chromosome of the genome. Vectors of artificial chromosomes are also considered, such as yeast artificial vectors and mammalian artificial chromosomes. The selection and use of such mediators are well known to those skilled in the art.
[0111] (Ⅱ) Detailed technical solution
[0112] In a specific embodiment, in a first aspect, the present invention provides an artemisia alcohol synthase, and the artemisia alcohol synthase includes (a) a complete protein or a functional protein fragment derived from a plant or a fungus; or (b) a derived artemisia alcohol synthase having at least 80% amino acid sequence homology with (a).
[0113] Since the growth cycle of plants is long and the yield is difficult to control. Compared with bacteria, the cultivation of fungi is more difficult and the growth rate is slower. Therefore, developing a microbial alternative production method for proteins derived from plants or fungi has greater economic value and social significance compared with the method of culturing plants and fungi to extract the corresponding proteins.
[0114] In some preferred embodiments, the above-mentioned derivation process may be that another amino acid of the same type (having similar chemical properties or functions) is used to replace the amino acid site. As an example, amino acids can be classified according to the properties of their side chains: (1) non-polar amino acids: Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar amino acids: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gln (Q); (3) acidic amino acids: Asp (D), Glu (E); (4) basic amino acids: Lys (K), Arg (R), His (H). Alternatively, amino acids can be classified based on common side chain characteristics: (1) hydrophobic amino acids: Met, Ala, Val, Leu, Ile; (2) neutral hydrophilic amino acids: Cys, Ser, Thr, Asn, Gln; (3) acidic amino acids: Asp, Glu; (4) basic amino acids: His, Lys, Arg; (5) amino acids that affect chain orientation: Gly, Pro; (6) aromatic amino acids: Trp, Tyr, Phe. Conservative substitutions between amino acids within the same property classification have little or no effect on the function, activity, or other biological properties of the polypeptide.
[0115] In an alternative embodiment, the plant is selected from plants of the family Asteraceae.
[0116] In an alternative embodiment, the plant is selected from plants of the genus Artemisia.
[0117] In an alternative embodiment, the plant includes Artemisia argyi.
[0118] In an alternative embodiment, the artemisia alcohol synthase catalyzes the synthesis of artemisia alcohol in an expression system.
[0119] In an alternative embodiment, the expression system includes a fungal expression system.
[0120] In an alternative embodiment, the fungal expression system includes a yeast expression system.
[0121] In an alternative embodiment, the yeast expression system includes a Saccharomyces cerevisiae expression system.
[0122] In an alternative embodiment, the Saccharomyces cerevisiae is a recombinant Saccharomyces cerevisiae, and the recombinant Saccharomyces cerevisiae contains a farnesyl pyrophosphate synthase gene.
[0123] In an alternative embodiment, the copy number of the farnesyl pyrophosphate synthase gene in the recombinant Saccharomyces cerevisiae genome is 1 to 3, and further preferably 2.
[0124] In an alternative embodiment, the copy number of at least one mevalonate pathway-related gene in the recombinant Saccharomyces cerevisiae genome is more than 1.
[0125] In an alternative embodiment, the copy number of at least one of the genes ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, or IDI1 is 1 to 3, preferably 2 or 3.
[0126] In the present invention, artemisia alcohol synthase genes are introduced into Saccharomyces cerevisiae by gene editing, the metabolic pathways related to artemisia alcohol expression in the Saccharomyces cerevisiae genome are adjusted, and the copy numbers of genes related to enzymes involved in the mevalonate pathway and the farnesyl pyrophosphate synthase gene in the recombinant Saccharomyces cerevisiae are increased, thereby significantly improving the yield of artemisia alcohol.
[0127] In an alternative embodiment, the inhibitory factor GAL80 gene and / or the activating cis-element or its fragment within the range of -175 to -220 upstream of the ERG9 promoter are knocked out in the Saccharomyces cerevisiae genome.
[0128] In an alternative embodiment, the amino acid sequence of the artemisia alcohol synthase includes (a) or (b):
[0129] (a) SEQ ID NO:1;
[0130] (b) A derivative artemisia alcohol synthase having at least 80%, 81%, 83%, 85%, 87%, 89%, 91%, 93%, 95%, 97%, or 99% or more amino acid sequence identity with (a).
[0131] In a second aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding the artemisia alcohol synthase according to any one of the foregoing embodiments or a nucleotide sequence complementary to its bases.
[0132] In an alternative embodiment, the nucleic acid molecule comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the nucleotide sequence shown in SEQ ID No:3.
[0133] In a third aspect, the present invention provides a recombinant expression vector containing the nucleic acid molecule according to any one of the foregoing embodiments, and the original vector of the recombinant expression vector includes pZY900, pYR017, pYR018, or pKlURA100.
[0134] Fourth aspect, the present invention provides a transformant, which contains the nucleic acid molecule described in any one of the foregoing embodiments, or a transformant containing the recombinant expression vector described in the foregoing embodiment, and the host cell of the transformant is selected from a fungal expression system, preferably a yeast expression system, and more preferably a Saccharomyces cerevisiae expression system.
[0135] Fifth aspect, the present invention provides a recombinant Saccharomyces cerevisiae, which contains the nucleic acid molecule described in any one of the foregoing embodiments, or contains the recombinant expression vector described in the foregoing embodiment, and the recombinant Saccharomyces cerevisiae further contains a farnesyl pyrophosphate synthase gene.
[0136] In an alternative embodiment, the copy number of the farnesyl pyrophosphate synthase gene in the recombinant Saccharomyces cerevisiae genome is 1 to 3, and further is 2.
[0137] In an alternative embodiment, the copy number of at least one gene related to the mevalonate pathway in the recombinant Saccharomyces cerevisiae genome is more than 1.
[0138] In an alternative embodiment, the copy number of at least one gene among ERG10 gene, ERG13 gene, tHMG1 gene, ERG12 gene, ERG8 gene, MVD1 gene or IDI1 gene is 1 to 3, preferably 2 or 3.
[0139] In an alternative embodiment, the inhibitor GAL80 gene and / or the activating cis-element or its fragment in the range of -175 to -220 upstream of the ERG9 promoter are knocked out in the Saccharomyces cerevisiae genome.
[0140] Sixth aspect, the present invention provides a method for preparing the recombinant Saccharomyces cerevisiae described in any one of the foregoing embodiments, and the preparation method includes the steps:
[0141] (a) Transforming the nucleic acid molecule described in any one of the foregoing embodiments or the recombinant expression vector described in the foregoing embodiment into Saccharomyces cerevisiae cells;
[0142] (b) Increasing the copy number of the farnesyl pyrophosphate synthase gene and / or the gene related to the mevalonate pathway in the Saccharomyces cerevisiae genome through gene editing;
[0143] The implementation order of step (a) and step (b) is not sequential.
[0144] In an alternative embodiment, the copy number of the farnesyl pyrophosphate synthase gene is 1 to 3, and further is 2.
[0145] In an alternative embodiment, the copy number of at least one gene among the ERG10 gene, ERG13 gene, tHMG1 gene, ERG12 gene, ERG8 gene, MVD1 gene or IDI1 gene is 1 to 3, preferably 2 or 3.
[0146] In an alternative embodiment, the preparation method includes transforming a GAL80 gene knockout expression cassette and / or a cis - acting upstream activating element knockout or partial knockout expression cassette of the ERG9 promoter into Saccharomyces cerevisiae cells.
[0147] In a seventh aspect, the present invention provides a method for preparing artemisia alcohol, the preparation method including fermenting and culturing the transformant described in the foregoing embodiments, or fermenting and culturing the recombinant Saccharomyces cerevisiae described in any one of the foregoing embodiments, or fermenting and culturing the recombinant Saccharomyces cerevisiae prepared by using the preparation method described in any one of the foregoing embodiments, and recovering artemisia alcohol from the fermentation product.
[0148] In an alternative embodiment, the recovery method includes using oil - phase extraction of the fermentation product.
[0149] In an alternative embodiment, the oil phase includes n - hexane, n - dodecane and / or isopropyl myristate.
[0150] In an alternative embodiment, the recovery method is that during the fermentation process, an oil phase is added, and after the fermentation ends, the oil phase is collected, and artemisia alcohol enriched in the oil phase is separated and obtained.
[0151] In an alternative embodiment, the method for collecting the oil phase includes centrifugation.
[0152] In an alternative embodiment, the separation method includes rectification.
[0153] In an eighth aspect, the present invention provides the application of artemisia alcohol obtained by using the preparation method described in any one of the foregoing embodiments in the preparation of antibacterial products, insecticidal products or herbicidal products.
[0154] In an alternative embodiment, the types of microorganisms that the antibacterial product can inhibit or kill include fungi.
[0155] In an alternative embodiment, the fungi include one or more of the genera Rhizoctonia, Plasmodiophora, Pythium, Phytophthora, Rhizopus, Valsa, Venturia, Monilinia, Erysiphe, Piriformospora, Oidium, Verticillium, Botrytis, Alternaria, Fusarium, Sphaceloma, Gibberella, Colletotrichum, Puccinia.
[0156] In an alternative embodiment, the Rhizoctonia fungi include Rhizoctonia solani.
[0157] In an alternative embodiment, the types of insects that the pesticidal product can repel or kill include insects of the families Culicidae, Miridae or Delphacidae.
[0158] In an alternative embodiment, the insects of the family Culicidae include one or more of the genera Aedes, Anopheles, Armigeres, Coquillettidia, Culex, Culiseta, Ficalbia, Heizmznnia, Hemagogus, Hodgesia, Malaya, Mansonia, Minmomyia, Orthopodomyia, Sabethes, Topomyia, Toxorhynchites, Tripteroides, Udaya, Uranotaenia.
[0159] In an alternative embodiment, the insects of the genus Aedes include Aedes aegypti.
[0160] In an alternative embodiment, the Miridae insects include the genus Acomocera, the genus Adelphococris, the genus Agnocoris, the genus Alcecoris, the genus Alloeotomus, the genus Allorhinocoris, the genus Angerianus, the genus Apilophorus, the genus Apolygopsis, the genus Apolygus, the genus Arbolygus, the genus Argenis, the genus Astroscopometopus, the genus Bertsa, the genus Blepharidopterus, the genus Bothriomiris, the genus Bothynotus, the genus Brachycoleus, the genus Bryocoris, the genus Campylotropis, the genus Capsodes, the genus Capsus, the genus Castanopsides, the genus Charagochilus, the genus Cheilocapsidea, the genus Cheilocapsus, the genus Chilocrates, the genus Chrysorrhanis, the genus Cimicicapsus, the genus Cimidaeorus, the genus Closterotomus, the genus Coridromius, the genus Creontiades, the genus Cylapofulvuitius, the genus Cylapomorpha, the genus Cyllecoris, the genus Cyphodemidea, the genus Cyrtopeltis, the genus Cyrtorhinus, the genusDeraeocoris, Genus Dichrooscytus, Genus Dicyphus, Genus Dimia, Genus Dioclerus, Genus Dolichomiris, Genus Dortus, Genus Dryophilocoris, Genus Ectmetopterus, Genus Elthemidea, Genus Eolygus, Genus Erimiris, Genus Ernestinus, Genus Eupachypeltis, Genus Eurvopicoris, Genus Eurystylomorpha, Genus Eurystylopsis, Genus Eurystylus, Genus Excentricus, Genus Felisacus, Genus Finqulus, Genus Fulvius, Genus Globiceps, Genus Guisardinus, Genus Guisardus, Genus Halticus, Genus Harpedona, Genus Hekista, Genus Helopeltis, Genus Heterolyqus, Genus Heteropantilius, Genus Hyalopeplinus, Genus Hyalopeplus, Genus Hyoidea, Genus Isabel, Genus Isometopidea, Genus Isometopus, Genus Jessopocoris, Genus Labopidea, Genus Labops, Genus Lasiomiris, GenusLatizanchius, Leptopterna, Liistonotus, Loristes, Lygidea, Lygocorides, Lygocoris, Lygus, Macrolonius, Macrolophus, Macrolygus, Malacocorisella, Mansoniella, Mecistoscelis, Mecomma, Megacoelum, Mermitelocerus, Metasequoiamiris, Michailocoris, Monalocoris, Myiomma, Myrmecophyes, Myrmecoris, Mystilus, Neolygus, Nesidiocoris, Nicostratus, Notostir, Onomaus, Orientomiris, Orhocephalus, Orthops, Orthotylus, Pachypeltis, Paloniella, Pantilius, Paracyphodema, Paramiridius, Paranx, Parapachypeltis, Peltidolygus, PeltidolygusPeritropis, Phytocoridea, Phytocoris, Pinalitus, Polymerus, Poppiocapsidea, Proboscidocoris, Prodromus, Prolygus, Psallops, Pseudodoniella, Pseudoloxops, Raawelellus, Reuterista, Rhabdomiris, Rhinocylapidius, Rhinomiris, Rhopaliceschatus, Sabactiopus, Salignus, Scirtetellus, Sinevi, Singhalesia, Sophianus, Stenodema, Stenotus, Stethoconus, Strongylocoris, Sulawesifaulvius, Tailorilygus, Teratocoris, Termatophylum, Tinginotopsis, Tinginotum, Tolongia, Totta, Trigonotylus, Tupiocoris, Ulmica, Ulmocyllus, Zanchius, Genusone or more of Zonodoropsis).
[0161] In an alternative embodiment, the insect of the genus Adelphococris includes Adelphocoris suturalis.
[0162] In an alternative embodiment, the Delphacidae insects include one or more of the genera Nilaparvata, Unkanodes, Neunkanodes, Laodelphax, Ribautodelphax, Megadelphax, Muirodelphax, Fangdelphax, Neoterthrona, Ramidelphax, Neuterthron, Miranus, Sogata, Parasogata, Neometopina, Changeondelphax, Chloriona, Paradelphacodes, Muellerianella.
[0163] In an alternative embodiment, the Delphacidae insects include Nilaparvata lugens.
[0164] In an alternative embodiment, the plant species that the weeding product can inhibit or kill include one or more of Brassicaceae, Asteraceae, Solanaceae, Convolvulaceae, Rubiaceae, Crassulaceae, Cannabaceae, Polygonaceae, Caryophyllaceae, Amaranthaceae, Portulacaceae, Ranunculaceae, Rosaceae, Plantaginaceae, Vitaceae, Euphorbiaceae, Apiaceae, Lamiaceae, Malvaceae, Poaceae, Cyperaceae, Juncaceae, Liliaceae, Commelinaceae, Amaryllidaceae, Alismataceae.
[0165] In an alternative embodiment, the cruciferous plant includes Arabidopsis, Alliaria, Alyssum, Aphragmus, Arabidopsis, Arabis, Armoracia, Atelanthera, Barbarea, Berteroa, Berteroella, Brassica, Braya, Bunias, Camelina, Capsella, Cardamine, Cardaria, Cheiranthus, Chorispora, Christolea, Clausia, Cochlearia, Coelonema, Conringia, Coronopus, Crambe, Cryptospora, Descurainia, Dilophia, Dimorphostemon, Diplotaxis, Dipoma, Diptychocarpus, Dontostemon, Draba, Eruca, Erysimum, Euclidium, Eutrema, Goldbachia, Hedinia, Hemilophia, Hesperis, Hymenolobus, Iberis, Isatis, Lachnoloma, Lepidium, Leptaleum, Lignariella, Litwinowia, Lobularia, Loxostemon, Macropodium, Malcolmia, Matthiola, Megacarpaea, Megadenia, Microsisymbrium, Microstigma, Nasturtium,One or more of the genera Neomartinella, Neslia, Orychophragmus, Pachypterygium, Parrya, Parryodes, Pegaeophyton, Phaeonychium, Platycraspedum, Ptilotricum, Pugionium, Pycnoplinthus, Raphanus, Rorippa, Sinapis, Sisymbrium, Smelowskia, Solms-Laubachia, Sophiopsis, Spirorhynchus, Staintoniella, Sterigmostemum, Stevenia, Stroganowia, Synstemon, Syrenia, Taphrospermum, Tauscheria, Tetracme, Thellungiella, Thlaspi, Torularia, Turritis, Yinshania.
[0166] In an alternative embodiment, the Brassicaceae plant includes one or more of the genera Arabidopsis, Capsella, Cardamine, Lepidium, Orychophragmus, Draba, Thellungiella, Erysimum, Descurainia, Rorippa.
[0167] In an alternative embodiment, the Arabidopsis plant includes Arabidopsis thaliana.
[0168] In a ninth aspect, the present invention provides an antibacterial agent, which contains artemisia alcohol obtained by using the preparation method described in any one of the foregoing embodiments.
[0169] In an alternative embodiment, the effective dose of the artemisia alcohol is 10 - 100 ppm.
[0170] In an alternative embodiment, the dosage form of the antibacterial agent includes tablets, injections, capsules, powders, premixes, granules, soluble powders, oral solutions, gels or ointments.
[0171] In an alternative embodiment, the types of microorganisms that the antibacterial agent can inhibit or kill include fungi.
[0172] In an alternative embodiment, the fungi include one or more of the genera Rhizoctonia, Plasmodiophora, Pythium, Phytophthora, Rhizopus, Valsa, Venturia, Monilinia, Erysiphe, Piriformospora, Oidium, Verticillium, Botrytis, Alternaria, Fusarium, Sphaceloma, Gibberella, Colletotrichum, Puccinia, etc.
[0173] In an alternative embodiment, the Rhizoctonia fungi include Rhizoctonia solani.
[0174] In a tenth aspect, the present invention provides an insecticide, which contains artemisia alcohol obtained by the preparation method according to any one of the foregoing embodiments.
[0175] In an alternative embodiment, the effective dose of artemisia alcohol is 500 - 5000 ppm.
[0176] In an alternative embodiment, the dosage forms of the insecticide include aqueous emulsion, suspension concentrate, dry powder, wettable powder, emulsifiable concentrate, thermal fogging agent, aerosol, soluble granule, fumigant, bait, granule or sustained release agent.
[0177] In an alternative embodiment, the types of insects that the insecticide can repel or kill include insects of the families Culicidae, Miridae or Delphacidae.
[0178] In an alternative embodiment, the insects of the family Culicidae include one or more of the genera Aedes, Anopheles, Armigeres, Coquillettidia, Culex, Culiseta, Ficalbia, Heizmznnia, Hemagogus, Hodgesia, Malaya, Mansonia, Minmomyia, Orthopodomyia, Sabethes, Topomyia, Toxorhynchites, Tripteroides, Udaya, Uranotaenia.
[0179] In an alternative embodiment, the insects of the genus Aedes include Aedes aegypti.
[0180] In an alternative embodiment, the Miridae insects include the genus Acomocera, the genus Adelphococris, the genus Agnocoris, the genus Alcecoris, the genus Alloeotomus, the genus Allorhinocoris, the genus Angerianus, the genus Apilophorus, the genus Apolygopsis, the genus Apolygus, the genus Arbolygus, the genus Argenis, the genus Astroscopometopus, the genus Bertsa, the genus Blepharidopterus, the genus Bothriomiris, the genus Bothynotus, the genus Brachycoleus, the genus Bryocoris, the genus Campylotropis, the genus Capsodes, the genus Capsus, the genus Castanopsides, the genus Charagochilus, the genus Cheilocapsidea, the genus Cheilocapsus, the genus Chilocrates, the genus Chrysorrhanis, the genus Cimicicapsus, the genus Cimidaeorus, the genus Closterotomus, the genus Coridromius, the genus Creontiades, the genus Cylapofulvuitius, the genus Cylapomorpha, the genus Cyllecoris, the genus Cyphodemidea, the genus Cyrtopeltis, the genus Cyrtorhinus, the genusDeraeocoris, Genus Dichrooscytus, Genus Dicyphus, Genus Dimia, Genus Dioclerus, Genus Dolichomiris, Genus Dortus, Genus Dryophilocoris, Genus Ectmetopterus, Genus Elthemidea, Genus Eolygus, Genus Erimiris, Genus Ernestinus, Genus Eupachypeltis, Genus Eurvopicoris, Genus Eurystylomorpha, Genus Eurystylopsis, Genus Eurystylus, Genus Excentricus, Genus Felisacus, Genus Finqulus, Genus Fulvius, Genus Globiceps, Genus Guisardinus, Genus Guisardus, Genus Halticus, Genus Harpedona, Genus Hekista, Genus Helopeltis, Genus Heterolyqus, Genus Heteropantilius, Genus Hyalopeplinus, Genus Hyalopeplus, Genus Hyoidea, Genus Isabel, Genus Isometopidea, Genus Isometopus, Genus Jessopocoris, Genus Labopidea, Genus Labops, Genus Lasiomiris, GenusLatizanchius, Leptopterna, Liistonotus, Loristes, Lygidea, Lygocorides, Lygocoris, Lygus, Macrolonius, Macrolophus, Macrolygus, Malacocorisella, Mansoniella, Mecistoscelis, Mecomma, Megacoelum, Mermitelocerus, Metasequoiamiris, Michailocoris, Monalocoris, Myiomma, Myrmecophyes, Myrmecoris, Mystilus, Neolygus, Nesidiocoris, Nicostratus, Notostir, Onomaus, Orientomiris, Orhocephalus, Orthops, Orthotylus, Pachypeltis, Paloniella, Pantilius, Paracyphodema, Paramiridius, Paranx, Parapachypeltis, Peltidolygus, PeltisPeritropis, Phytocoridea, Phytocoris, Pinalitus, Polymerus, Poppiocapsidea, Proboscidocoris, Prodromus, Prolygus, Psallops, Pseudodoniella, Pseudoloxops, Raawelellus, Reuterista, Rhabdomiris, Rhinocylapidius, Rhinomiris, Rhopaliceschatus, Sabactiopus, Salignus, Scirtetellus, Sinevi, Singhalesia, Sophianus, Stenodema, Stenotus, Stethoconus, Strongylocoris, Sulawesifaulvius, Tailorilygus, Teratocoris, Termatophylum, Tinginotopsis, Tinginotum, Tolongia, Totta, Trigonotylus, Tupiocoris, Ulmica, Ulmocyllus, Zanchius, Genusone or more of Zonodoropsis).
[0181] In an alternative embodiment, the insect of the genus Adelphococris includes Adelphocoris suturalis.
[0182] In an alternative embodiment, the Delphacidae insects include one or more of the genera Nilaparvata, Unkanodes, Neunkanodes, Laodelphax, Ribautodelphax, Megadelphax, Muirodelphax, Fangdelphax, Neoterthrona, Ramidelphax, Neuterthron, Miranus, Sogata, Parasogata, Neometopina, Changeondelphax, Chloriona, Paradelphacodes, Muellerianella.
[0183] In an alternative embodiment, the Delphacidae insects include Nilaparvata lugens.
[0184] In a tenth aspect, the present invention provides a herbicide, which contains arteannuin alcohol obtained by the preparation method according to any one of the foregoing embodiments.
[0185] In an alternative embodiment, the effective dose of the arteannuin alcohol is 25 to 200 ppm.
[0186] In an alternative embodiment, the formulations of the herbicide include aqueous solutions, emulsifiable concentrates, suspensions, emulsions in water, microemulsions, oil suspensions, microcapsule suspensions, soluble concentrates, film-forming oils, wettable powders, soluble powders, soluble granules, dry suspensions or water-dispersible granules. In an alternative embodiment, the types of plants that the herbicide can inhibit or kill include one or more cruciferous plants such as Cruciferae, Compositae, Solanaceae, Convolvulaceae, Rubiaceae, Crassulaceae, Cannabaceae, Polygonaceae, Caryophyllaceae, Amaranthaceae, Portulacaceae, Ranunculaceae, Rosaceae, Plantaginaceae, Vitaceae, Euphorbiaceae, Umbelliferae, Lamiaceae, Malvaceae, Gramineae, Cyperaceae, Juncaceae, Liliaceae, Commelinaceae, Amaryllidaceae, Alismataceae, etc. In an alternative embodiment, the cruciferous plants include Arabidopsis, Alliaria, Alyssum, Aphragmus, Arabidopsis, Arabis, Armoracia, Atelanthera, Barbarea, Berteroa, Berteroella, Brassica, Braya, Bunias, Camelina, Capsella, Cardamine, Cardaria, Cheiranthus, Chorispora, Christolea, Clausia, Cochlearia, Coelonema, Conringia, Coronopus, Crambe, Cryptospora, Descurainia, Dilophia, Dimorphostemon, Diplotaxis, Dipoma, Diptychocarpus, Dontostemon, Draba, Eruca, Erysimum, Euclidium, Eutrema, Goldbachia, Hedinia, Hemilophia, Hesperis, Hymenolobus, Iberis, Isatis, Lachnoloma, Lepidium, Leptaleum, Lignariella, Litwinowia, Lobularia, Loxostemon, Macropodium,One or more of the following genera: Malcolmia, Matthiola, Megacarpaea, Megadenia, Microsisymbrium, Microstigma, Nasturtium, Neomartinella, Neslia, Orychophragmus, Pachypterygium, Parrya, Parryodes, Pegaeophyton, Phaeonychium, Platycraspedum, Ptilotricum, Pugionium, Pycnoplinthus, Raphanus, Rorippa, Sinapis, Sisymbrium, Smelowskia, Solms-Laubachia, Sophiopsis, Spirorhynchus, Staintoniella, Sterigmostemum, Stevenia, Stroganowia, Synstemon, Syrenia, Taphrospermum, Tauscheria, Tetracme, Thellungiella, Thlaspi, Torularia, Turritis, Yinshania, etc.
[0187] In an alternative embodiment, the Brassicaceae plant includes one or more of the genera Arabidopsis, Capsella, Cardamine, Lepidium, Orychophragmus, Draba, Thellungiella, Erysimum, Descurainia, Rorippa.
[0188] In an alternative embodiment, the Arabidopsis plant includes Arabidopsis thaliana.
[0189] The following will describe in detail some embodiments of the present invention with reference to the accompanying drawings. Without conflict, the following embodiments and the features in the embodiments may be combined with each other.
[0190] Example 1 Construction of Artemisia argyi-derived Artemisia alcohol synthase expression vector
[0191] Analyze the transcriptome data of Artemisia argyi in the NCBI database bioproject: PRJNA722539 to obtain a synthase (AaTPS19) with potential Artemisia alcohol synthesis function, and its amino acid sequence is shown in SEQ ID NO.1:
[0192] MATVDVNTNLQVNTKTTIEHVRPLAKFPPSIWGDCFLSFVLDNSKMQTYAKTMEEPKEQLRQMIVDPTIDINEKLNLIYFVYRLGLTYLFVEEIDGQLDSLFNELNLIDYQEADLYTISVHFQVFRTHGYKLSCDVFNKFKDCNTGAFKEEIVADVKGMLTFYESAQLRIREESILDEAFSFTEAQLIKSLEKTIERKLAQQVKHALETPVHRGHPMVEARLFFIHFEEECSRYDSLVKLAKVHFNYLQLLQKEELRIVSKWWKDMDFQVITPYVRDRVPELYLWILSLFFEPYYSQARIITTKIILLLLVLDDTYDAYATIEEIRLLTDAINRWDVSAMERLPEYIKPFYEILLNEYVGFNKQVSQEGKAHLVDASKQAFQEIARGYLKEAEWRHSGEVPSFEEYIKIGLTTSTHDLLCKSSLIGMGKIVTEEAFTWYLSHPPIMTASELISRLSDDVMTFEFERERAPTATSVDAYIKTYGVSETVAIEKLKKMAENAWKDINEGCLKPRKVPMDLLAPIVSLARMIEVAYKYNDGFTFPEKTLKEYITLLFQVSVPM。
[0193] The coding gene of the above synthase was synthesized after codon optimization according to Saccharomyces cerevisiae, and the nucleotide sequence is shown in SEQ ID NO.3:
[0194]
[0195] Using SEQ ID NO.3 as a template, specific gene primer pairs P1 / P2 were designed. The gene fragment of the codon-optimized synthase was obtained by PCR amplification using Phanta high-fidelity enzyme from VAZYME. After gel extraction using the Tiangen Gel Extraction Kit, it was ligated into the yeast expression vector pZY900 digested with BsaI (using the same method as in Patent CN202210473488.4) by homologous recombination using the homologous recombination kit from Yisheng. After sequencing and confirmation, the yeast expression vector containing this gene was obtained and named p900A19. The schematic diagram of plasmid p900A19 construction is shown in Figure 1 .
[0196]
[0197] Using primers P3 / P4 and P5 / P6, long fragments (including the left homologous arm of Ura3, histidine selection marker, CYC1 terminator, tHMG1 gene, GAL1-GAL10 promoter, PGK1 terminator, right homologous arm of Ura3, plasmid backbone) and the coding gene of AaTPS19 were amplified using pYR017 (see Patent 202210473488.4) and p900A19 as templates respectively. Subsequently, using the yeast assembly method, the above fragments were recombinantly constructed into p905A19 in Saccharomyces cerevisiae. The schematic diagram of plasmid p905A19 construction is shown in Figure 1 .
[0198] Primer Sequence (5’-3’) P3 CAAGTTTCTGTTCCAATGtaaATTGAATTGAATTGAAATCGATAG (SEQ ID NO.7) P4 GTATTAACATCAACAGTAGCCATtatagttttttctccttgacg (SEQ ID NO.8) P5 cgtcaaggagaaaaaactataATGGCTACTGTTGATGTTAATAC (SEQ ID NO.9) P6 CTATCGATTTCAATTCAATTCAATttaCATTGGAACAGAAACTTG (SEQ ID NO.10)
[0199] Using primers P7 / P8 and P9 / P10, long fragments (including the left homologous arm of yprcdelta15, tryptophan selection marker, GPM1 terminator, GAL1-GAL10 promoter, PGK1 terminator, right homologous arm of yprcdelta15, plasmid backbone) and the AaTPS19 coding gene were amplified using pYR018 (see Patent 202210473488.4) and p900A19 as templates respectively. Subsequently, using the yeast assembly method, the above fragments were recombinantly constructed into p908A19 in Saccharomyces cerevisiae. The schematic diagram of plasmid p908A19 construction is shown in Figure 1 .
[0200] Primer Sequence (5’-3’) P7 CAAGTTTCTGTTCCAATGtaaATTGAATTGAATTGAAATCGATAG (SEQ ID NO.11) P8 GTATTAACATCAACAGTAGCCATtatagttttttctccttgacg (SEQ ID NO.12) P9 cgtcaaggagaaaaaactataATGGCTACTGTTGATGTTAATAC (SEQ ID NO.9) P10 CTATCGATTTCAATTCAATTCAATttaCATTGGAACAGAAACTTG (SEQ ID NO.10)
[0201] Example 2 Construction of Gene Editing Plasmids and Knockout Cassettes
[0202] The fragment was amplified using primers P11 / P12 with plasmid pKlURA100 (see Zhang, Yueping et al. “A gRNA-tRNA array for CRISPR-Cas9 based rapid multiplexed genome editing in Saccharomyces cerevisiae.” Nature communications vol. 10, 1 1053.5 Mar. 2019, doi:10.1038 / s41467-019-09005-3) as the template. Subsequently, using the method of Goldengate (Zhang, Yueping et al. “A gRNA-tRNA array for CRISPR-Cas9 based rapid multiplexed genome editing in Saccharomyces cerevisiae.” Nature communications vol. 10, 1 1053.5 Mar. 2019, doi:10.1038 / s41467-019-09005-3), the above fragment and pCas were assembled to construct plasmid pYH395.
[0203] Primer Sequence (5’-3’) P11 aaaggtctcagatcttttccactgcactttgcatgttttagagctagaaatagcaagtt (SEQ ID NO.20) P12 aaaggtctcaaaactctagactttttcgatgatgtagtttct (SEQ ID NO.21)
[0204] Two fragments were amplified using primers P13 / P14 and P15 / P16 with the whole genome of Saccharomyces cerevisiae CEN.PK2-1D as the template. Subsequently, using primers P13 and P16, with the two obtained fragments as the templates, overlap extension PCR was carried out to obtain the cis-element (-220 to -175) knockout element upstream of the ERG9 promoter.
[0205] Primer Sequence (5’-3’) P13 atagaagacgaacattgtacgatac (SEQ ID NO.22) P14 acccaaaaccgataacgccttccgataagtcggtattgttgttgaagatg (SEQ ID NO.23) P15 tcaacaacaataccgacttatcggaaggcgttatcggttttgg (SEQ ID NO.24) P16 aatttctcgtggaagtgacg (SEQ ID NO.25)
[0206] The left homologous arm of fragment X-4 was amplified using primers P33 / P34 with the yeast CEN.PK2-1D genome as the template, the terminator TADH1 of the fragment was amplified using primers P35 / P36 with the yeast CEN.PK2-1D genome as the template, the fragment containing pGAL1-pGAL10 and AaTPS19 genes was amplified using primers P37 / P38 with p900A19 as the template, the right homologous arm of X-4 was amplified using primers P39 / P40 with the yeast CEN.PK2-1D genome as the template, and the terminator TCPS1 fragment was amplified using primers P41 / P42 with the yeast CEN.PK2-1D genome as the template. Using overlap extension PCR and primers P33 / P40, with all the above fragments as the templates, the AaTPS19-C4 knock-in cassette was obtained.
[0207]
[0208] The left homologous arm of fragment XI-1 was amplified using primers P43 / P44 with the yeast CEN.PK2-1D genome as a template. TADH1, pGAL1-pGAL10, the AaTPS19 gene fragment, and the TCPS1 region were amplified using primers P45 / P46 with the AaTPS19-C4 knock-in cassette as a template. The right homologous arm containing XI-1 was amplified using primers P47 / P48 with the yeast CEN.PK2-1D genome as a template. Using overlap extension PCR with primers P43 / P48 and all of the above fragments as templates, the AaTPS19-C5 knock-in cassette was obtained.
[0209]
[0210] The left homologous arm of fragment XII-5 was amplified using primers P49 / P50 with the yeast CEN.PK2-1D genome as a template. TADH1, pGAL1-pGAL10, the AaTPS19 gene fragment, and the TCPS1 region were amplified using primers P51 / P52 with the AaTPS19-C4 knock-in cassette as a template. The right homologous arm containing XII-5 was amplified using primers P53 / P54 with the yeast CEN.PK2-1D genome as a template. Using overlap extension PCR with primers P49 / P54 and all of the above fragments as templates, the AaTPS19-C6 knock-in cassette was obtained.
[0211]
[0212] Three fragments were amplified using primers 5211-F / R, 5212-F / R, and 5213-F / R with the whole genome of Saccharomyces cerevisiae CEN.PK2-1D, the pRS426 plasmid, and the whole genome of Saccharomyces cerevisiae CEN.PK2-1D as templates, respectively. Subsequently, overlap extension PCR was performed using primers 5211-F and 5213-R with the three obtained fragments as templates to obtain the pZY521 knockout cassette.
[0213] Primer Sequence (5’-3’) 5211_F caatggtctaggtagtggcattcg (SEQ ID NO.48) 5211-R cgactcactatagggcgaattgggtacgacgggagtggaaagaacgg (SEQ ID NO.49) 5212-F tcccgttctttccactcccgtcgtacccaattcgccctatagtgag(SEQ ID NO.50) 5212-R gccaagcacagggcaagatgctttcacagcttgtctgtaagcgga(SEQ ID NO.51) 5213-F gcatccgcttacagacaagctgtgaaagcatcttgccctgtgctt(SEQ ID NO.52) 5213-R gattccatgctaccttccatggttg(SEQ ID NO.53)
[0214] pHM012 is a gRNA plasmid targeting X-4, XI-1, and XII-5 sites, which is a tool plasmid for identifying and cleaving genomic DNA of Saccharomyces cerevisiae in the Crispr-Cas9 gene editing technology. (1) Using the pstgRNA plasmid as a template, which is derived from the reference: A gRNA-tRNA array for CRISPR-Cas9 based rapid multiplexed genome editing in Saccharomyces cerevisiae (DOI: 10.1038 / s41467-019-09005-3), a plasmid fragment containing the gRNA of X-4 site, gRNA scaffold, tGly, and partial gRNA of XI-1 site was amplified by PCR with primers X-4_scaffold F and tGly_XI-1R; (2) Using the pstgRNA plasmid as a template, a plasmid fragment containing partial gRNA of XI-1 site, gRNA scaffold, tGly, and partial gRNA of XII-5 site was amplified by PCR with primers XI-1_scaffold F and tGly_XII-5R; (3) Using the pKlURA3 100 plasmid (the source of the pKlURA3 100: A gRNA-tRNA array for CRISPR-Cas9 based rapid multiplexed genome editing in Saccharomyces cerevisiae) as a template, a fragment containing the gRNA of XII-5 site, gRNA scaffold, SUF17 terminator, and URA selection tag was amplified by PCR with primers XII-5_scaffold F and pKIURA3-R-common; (4) The above three fragments were assembled with the pCas9 vector using the Golden Gate assembly method, followed by Escherichia coli transformation, restriction enzyme digestion verification, and correct sequencing to obtain the plasmid pHM012.
[0215]
[0216]
[0217] 4) Strain construction (Artemisia gene)
[0218] The p900A19 plasmid was transformed into the competent cells of yeast strain JCR27 by the PEG / LiAC method and spread on an SD-URA screening plate. After culturing for 3 days, the Novoprotein PCR reagent was used for colony PCR verification, and the positive bacteria were named J900A19. (For the construction of yeast strain JCR27, see the literature Siemon, T., et al. (2020). "Semisynthesis of plant-derived englerin A enabled by microbe engineering of guaia-6,10(14)-diene as building block." Journal of the American Chemical Society 142(6):2760-2765.).
[0219] The plasmid p900A19 was linearized with the restriction endonuclease MssI, and the fragment containing the farnesyl pyrophosphate synthase gene and the AaTPS19 gene was recovered. This fragment was introduced into the competent cells of yeast strain JCR27 by the PEG / LiAC method. After yeast colony PCR verification, the positive bacteria were named JA191.
[0220] Compared with the CEN.PK2-1D strain, strain JA191 enhanced the MVA pathway and overexpressed the entire MVA pathway. On this basis, the farnesyl pyrophosphate synthase gene and the AaTPS19 gene were also overexpressed. The copy numbers of each gene in strain JA191 were ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, ERG20, AaTPS19 = 2, 2, 2, 2, 2, 2, 2, 2, 1.
[0221] Furthermore, the AaTPS19 gene-containing fragment was recovered by digesting p908A19 with the NotI endonuclease. Similarly, after transforming the competent cells of yeast strain JA191, yeast colony PCR verification was carried out to obtain the positive bacteria JA192. The copy numbers of each gene in strain JA192 were ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, ERG20, AaTPS19 = 2, 2, 2, 2, 2, 2, 2, 2, 2.
[0222] Similarly, the p905A19 was digested with MssI endonuclease to recover the AaTPS19 gene fragment, and this fragment was introduced into the competent cells of yeast strain JA192 by the PEG / LiAC method. After verifying by yeast colony PCR, the positive bacteria were named JA193. The copy numbers of each gene in strain JA193 were ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, ERG20, AaTPS19 = 2, 2, 3, 2, 2, 2, 2, 2, 3.
[0223] The plasmid pYH395 and the knockout element of the cis-acting element (-220 to -175) upstream of the ERG9 promoter were co-transformed into strain JA193 by the lithium acetate method. The colonies were verified by PCR for the correctness of the knockout. Subsequently, the colonies were cultured in YPD liquid medium (20 g / L tryptone, 10 g / L yeast extract, 20 g / L glucose) at 220 rpm on a shaker at 30 °C for 8 hours, then washed with water, and the bacteria were streaked on a 5-FOA plate (Li Xiaowei. Construction of an engineered acetyl-CoA pathway to build a high-efficiency synthesis platform for Saccharomyces cerevisiae [D]. Wuhan University, 2015.), and cultured in an incubator at 30 °C for 3 days. Bacteria were picked from the plate and further verified by colony PCR for the correctness of the knockout. The correct strain was named JA194.
[0224] This step is used to knockout the cis-acting element (-220 to -175) upstream of the ERG9 promoter. The squalene synthase encoded by ERG9 synthesizes squalene using FPP as a substrate, which is a competing pathway for the sesquiterpene compound synthesis pathway. The knockout of the cis-acting element upstream of the ERG9 promoter can down-regulate the squalene synthesis pathway, reduce the competition of the squalene synthesis pathway for consuming the substrates required for sesquiterpene compound synthesis, and is beneficial to further improving the yield of sesquiterpene compounds.
[0225] Furthermore, the plasmid pHM012 and the AaTPS19-C4 knock-in cassette, AaTPS19-C5 knock-in cassette, and AaTPS19-C6 knock-in cassette were co-transformed into strain JA194 by the lithium acetate method. The operation steps were the same as those for knocking out the knockout element of the cis-acting element (-220 to -175) upstream of the ERG9 promoter. After verifying by colony PCR, strain JA196 was obtained. The positive bacteria JA196 strain was obtained, and the copy numbers of each gene in JA195 were ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, ERG20, AaTPS19 = 2, 2, 3, 2, 2, 2, 2, 2, 6.
[0226] Finally, the pZY521 knockout cassette was transferred into strain JA196 by the lithium acetate method to obtain strain JA197. The function of this step is to knockout the transcriptional repressor GAL80, so that the target gene in the transformed bacteria can be autonomously expressed without the need for an inducer, which is beneficial to reducing the fermentation product and can further increase the yield of sesquiterpene compounds.
[0227] Example 3 Shake Flask Fermentation
[0228] The J900A19 and J900V5-15 strains were inoculated into 50 mL of YPD medium supplemented with 1% (w / v) galactose and cultured at 30 °C. After 3 days, the cells were collected by centrifugation at 8000 rpm for 10 min. The cells were extracted with 10 mL of the extractant n-hexane and then prepared for GC-MS detection. Specific sesquiterpene products were detected in the J900A19 strain, such as Figure 3 shown. This compound was temporarily named A19. The same specific sesquiterpene product was detected in the J900V5-15 strain, such as Figure 4 shown.
[0229] The JA191-JA197 strains were fermented for 72 h using a similar method with 10% (w / ) isopropyl myristate (IPM) covering. After centrifugation, the oil phase was taken for GC-MS detection. The yields of the sesquiterpene A19 product (finally identified as (+)-intermedeol) in the strains JA191, JA192, JA193, JA194, JA196, JA197 were 18.97 mg / L, 37.7 mg / L, 60.8 mg / L, 70.65 mg / L, 88.6 mg / L, 167 mg / L, 186 mg / L, respectively.
[0230] Example 4 Fermentation in a Fermenter
[0231] Using the fermentation medium described in the reference (van Hoek, P.; de Hulster, E.; van Dijken, J.P.; Pronk, J.T. Fermentative capacity in high-cell-density fed-batch cultures of baker’s yeast. Biotechnol. Bioeng. 2000, 68, 517-523.), fed-batch fermentation was carried out on the constructed strain JA197. During the fermentation process, a covering agent was added to achieve in-situ extraction, and the covering agents were n-dodecane or isopropyl myristate respectively. The dissolved oxygen was controlled above 20% during the fermentation process, the pH was 5, the glucose concentration was 1-2 g / L, and the ethanol concentration was below 5 g / L. Finally, in a fermenter (15L steel tank), the yields of sesquiterpene products (finally identified as (+)-intermedeol) reached 12 g / L (covering agent was n-dodecane) and 9.5 g / L (covering agent was isopropyl myristate) respectively.
[0232] Product Identification in Example 5
[0233] To determine the structure of the sesquiterpene product, strain JA197 was fermented under fermentation conditions without covering the organic solvent IPM. The fermentation control was the same as that during covering, with the only difference being that no covering agent was added. After the fermentation was completed, the bacterial solution was extracted with an equal volume of methanol, and then extracted with n-hexane. After standing and separating, the upper organic phase was obtained for vacuum concentration. After vacuum concentration, it was further purified using semi-preparative HPLC. The purified product was 1 H and 13C NMR nuclear magnetic resonance identification, and the COSY, ROESY and X-RAY identification results are shown in Figures 4-9 respectively, and the chemical structure of the sesquiterpene was determined to be It was named (+)-intermedeol.
[0234] Expression of Known Intermedeol Synthases from the Fungal Source Termitomyces and Vitis vinifera as a Comparative Example
[0235] There are two reported intermedol synthases, which are from Termitomyces and Vitis vinifera respectively
[0236] The amino acid sequence of the fungal source V5-15 from Termitomyces is shown in SEQ ID NO.2:
[0237] MVQFRIPDLLSCLPACIKATNADNDILQAGLVEVIDQCHLTDHYKKDLKRAEIPHLAIRAFPESDLKYLRICVEYLIAAFLLDRLTDKPATAAQAQEWADIYKQEFRKTLQGTKGPARINQYLTKKCDIYPQAFSKTFEKTKGPAEIIKYLTSHMSNTIKDPYWSCLVENNILLADGMAKEAVDRENPGTEMDLETYIKVRRDTIGARQLFDLGRWIHELNITPETLTHPDIVRMEEQFIDLISLANDLYSYKKEYLAKDAKHNYLTIALRDPTVDLHENDLQGAINYTYDKFCRVLADLEHQKKVLPRFRKSEEAKVDKYFWLMMNVVIGTIQWSLECERYGHFVDADGPNQGDVVFNL。
[0238] The coding gene of this enzyme was synthesized after codon optimization according to Saccharomyces cerevisiae, and its nucleotide sequence is shown in SEQ ID NO.4:
[0239]
[0240] Using SEQ ID NO.4 as a template, specific gene primer pair P55 / P56 was designed. The V5-15 gene fragment was obtained by PCR amplification using Phanta high-fidelity enzyme from Vazyme. After gel extraction using Tiangen Gel Extraction Kit, it was ligated into the yeast expression vector pZY900 digested with BsaI by homologous recombination method using the homologous recombination kit from Yisheng. After sequencing and confirmation, the yeast expression vector containing this gene was obtained and named p900-V5-15. The schematic diagram of plasmid p900-V5-15 construction is shown in Figure 2 。
[0241]
[0242] The amino acid sequence of VvPNSeInt from Vitis vinifera is as follows:
[0243] MSVPLSVSVTPILSQRIDPEVARHEATYHPNFWGDRFLHYNPDDDFCGTHACKEQQIQELKEEVRKSLEATAGNTSQLLKLIDSIQRLGLAYHFEREIEEALKAMYQTYTLVDDNDHLTTVSLLFRLLRQEGYHIPSDVFKKFMDEGGNFKESLVGDLPGMLALYEAAHLMVHGEDILDEALGFTTAHLQSMAIDSDNPLTKQVIRALKRPIRKGLPRVEARHYITIYQEDDSHNESLLKLAKLDYNMLQSLHRKELSEITKWWKGLDFATKLPFARDRIVEGYFWILGVYFEPQYYLARRILMKVFGVLSIVDDIYDAYGTFEELKLFTEAIERWDASSIDQLPDYMKVCYQALLDVYEEMEEEMTKQGKLYRVHYAQAALKRQVQAYLLEAKWLKQEYIPRMDEYMSNALVSSACSMLTTTSFVGMGDIVTKEAFDWVFSDPKMIRASNVICRLMDDIVSHEFEQKRGHVASAVECYMKQYGVSKEEAYDEFKKQVESAWKDNNEEFLQPTAVPVPLLTRVLNFSRMMDVLYKDEDEYTLVGPLMKDLVAGMLIDPVPM(SEQ ID NO.15).
[0244] The coding gene of this enzyme was synthesized after codon optimization according to Saccharomyces cerevisiae, and its nucleotide sequence is as follows:
[0245]
[0246] Using the above sequence as a template, specific gene primer pairs P71 / P72 were designed. The gene fragment was obtained by PCR amplification using Phanta high-fidelity enzyme from VAZYME. After gel extraction using Tiangen Gel Extraction Kit, it was ligated into the yeast expression vector pZY900 digested with BsaI by homologous recombination method using the homologous recombination kit from Yisheng. After confirmed by sequencing, the yeast expression vector containing this gene was obtained and named p900-VvPNSeInt. The schematic diagram of plasmid p900-VvPNSeInt construction is shown in Figure 2 .
[0247]
[0248] The plasmid p900-V5-15 was linearized using the restriction endonuclease MssI, and the fragment containing the farnesyl pyrophosphate synthase gene and V5-15 gene was recovered. This fragment was introduced into the competent cells of yeast strain JCR27 by PEG / LiAC method. After verification by yeast colony PCR, the positive bacteria were named JV151.
[0249] Compared with the CEN.PK2-1D strain, strain JV151 strengthened the MVA pathway and overexpressed the entire MVA pathway. On this basis, the farnesyl pyrophosphate synthase gene and V5-15 gene were also overexpressed. The copy numbers of each gene in strain JV151 were ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, ERG20, V5-15 = 2, 2, 2, 2, 2, 2, 2, 2, 1.
[0250] The plasmid p900-VvPNSeInt was linearized using the restriction endonuclease MssI, and the fragment containing the farnesyl pyrophosphate synthase gene and VvPNSeInt gene was recovered. This fragment was introduced into the competent cells of yeast strain JCR27 by PEG / LiAC method. After verification by yeast colony PCR, the positive bacteria were named JVVvPNSeInt.
[0251] Compared with the CEN.PK2-1D strain, strain JVVvPNSeInt strengthened the MVA pathway and overexpressed the entire MVA pathway. On this basis, the farnesyl pyrophosphate synthase gene and VvPNSeInt gene were also overexpressed. The copy numbers of each gene in strain JVVvPNSeInt were ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, ERG20, VvPNSeInt = 2, 2, 2, 2, 2, 2, 2, 2, 1.
[0252] Flask fermentation was carried out on strains JV151 and JVVvPNSeInt under the same flask fermentation conditions as strain JA191. After the fermentation was completed, the yields of intermedeol were detected to be 0.35 mg / L and 0.04 mg / L respectively, which were much lower than that of strain JV191. It can be seen that AaTPS19 is superior to the reported intermedeol synthases.
[0253] Example 6A19 Insecticidal Effect Monitoring
[0254] (1) Use the hand-in-cage test to evaluate the repellent effect of A19 ((+)-intermedeol) on Aedes aegypti
[0255] The hand-in-cage experimental device consists of a mosquito cage measuring 30 cm × 30 cm × 30 cm, in which a modified glove is placed. A digital camera for video recording is installed at the top of the cage. To create a test window, a square is cut out on the back of the nitrile rubber glove and a magnetic frame slightly larger than the window size is glued on as the basis for stacking additional magnetic window frames. A gauze net treated with the test compound is placed on the fixed magnetic frame, about 3.0 mm away from the glove. A second untreated gauze net is placed about 8.0 mm above the treated net with another magnetic frame. The stacked magnetic frames are fixed with adhesive clips to ensure there is enough space between the treated and untreated nets to prevent mosquitoes from contacting the treated net or piercing the skin of the hand in the glove.
[0256] The experiment was carried out in a room with a relative humidity of about 50% and a temperature range of 28°C to 30°C. Non-blood-fed mosquitoes fed on 2% glucose were transferred to the mosquito cage, about 10 to 20 days old (about 50 - 70). Eight hours before the test, the glucose was removed, and each test was carried out between 16:00 and 21:00. Before the experiment, a researcher took 800 μl of A19 dissolved in acetone from a 2 mL EP tube and treated a gauze net, with acetone as the control. After allowing the acetone to evaporate for about 7 minutes, the researcher assembled and wore the modified glove. At the same time, a laboratory assistant transferred the prepared cage from the incubator to a bench in the laboratory.
[0257] At the start of the experiment, the researchers inserted their hands wearing the modified gloves into the cages, and a digital camera recorded the number of mosquitoes landing on the test window within 10 minutes. Subsequently, the number of mosquito landings was counted and recorded. For each cage, two solvent (acetone) control groups were tested first, and then the test compound was administered. There was at least a 0.5-hour interval between the two trials to allow the mosquitoes to fully recover and to ventilate any residual vapors from the previous experiment out of the room. The data from the control groups were also included in the statistics to establish the baseline activity of the mosquitoes' response to the solvent, and any data from cages with low landing numbers in the control group trials were excluded. The repellency rate for each cage was determined using the following formula: Repellency rate = [1 - (number of landings on the dosing window of mosquitoes / number of landings on the solvent window of mosquitoes)] × 100. Each cage was tested by at least two different testers, including both male and female. Additionally, each cage was only tested once a day. After the experiment was completed, the cages were immediately returned to the incubator. A new pair of modified gloves and their magnetic frames were used for each experiment. In this experiment, two concentration gradients of (+)-intermedeol, namely 500 ppm and 5000 ppm, were tested. The test results are as Figure 10 shown. It can be seen that at both concentrations, A19 has a good repellent effect on mosquitoes and has the potential to be used as a mosquito repellent.
[0258] (2) Evaluation of the repellent effect of A19 on brown planthoppers using an H-tube experiment
[0259] The attractiveness of compound A19 to brown planthoppers was tested using an H-tube olfactometer. The method was modified from the method described by Lou and Cheng (Lou, Y.-G. and J.-A. Cheng (2003). "Role of rice volatiles in the foraging behaviour of the predator Cyrtorhinus lividipennis for the rice brown planthopper Nilaparvata lugens." Biocontrol(48:73 - 86.). The H-tube was set up as follows: Two cylindrical glass tube arms (3 cm in diameter and 15 cm in height), each open at the top, with a hole (3 cm in diameter) at 4.5 cm from the bottom. Another cylindrical "connector" glass tube (3 cm in diameter and 17 cm in length) connects the two "tube arms" through the hole at 4.5 cm from the bottom. At the center of the connector, there is a hole with a diameter of 1 cm for releasing the test insects. The experiment was conducted between 09:00 and 17:00, during which the brown planthopper was very active. The final concentration of compound A19 prepared with acetone was 500 ppm. The rice seedlings at the three-leaf stage were thoroughly soaked in the A19 solution for 20 seconds and then volatilized for 7 minutes. Acetone was used as a control. Double-layer gauze was placed at the top of the glass arm and sealed with a rubber band. The brown planthoppers that had been starved for 0.5 h were introduced into the H-tube through the release hole, and then the release hole was plugged with cotton. The device was placed in an incubator at 26 ± 2°C and 70 ± 5% RH. After 1 h, the number of brown planthoppers in the control group and the treatment group was recorded. If the distance from the release hole to the area where the insects rested was no more than 3 cm, it was considered "no choice". Otherwise, it was considered "choice". Each repetition detected 17 - 20 individuals, and each treatment was repeated more than 7 times. The test results are as Figure 11 shown. It can be seen that A19 has a good repellent effect on the rice pest brown planthopper and has the potential to be used as a pesticide.
[0260] (3) Use the H-tube experiment to evaluate the repellent effect of A19 on Adelphocoris suturalis
[0261] For Adelphocoris suturalis, the H-tube was set up as described above. The experiment was conducted between 15:00 and 18:00 because Adelphocoris suturalis was very active during this period. 5-cm-long green beans were placed in the two arms of the H-tube to attract Adelphocoris suturalis that had been starved for 1 h. At the same time, 150 μl of A19 (500 ppm) and acetone were respectively added to two pieces of filter paper measuring 4 cm × 2 cm. The filter paper was volatilized for 2 minutes, and then they were placed in the H-tube arm together with the green beans. The device was placed in an incubator at 26 ± 2°C and 70 ± 5% RH. In the next 1.5 h - 2.5 h, Adelphocoris suturalis made a choice between the treatment group and the control group. Each repetition detected 15 individuals, and each treatment was repeated more than 5 times. The test results are as Figure 12 shown. It can be seen that A19 has a good repellent effect on the cotton pest Adelphocoris suturalis and has the potential to be used as a pesticide.
[0262] Example 7 Detection of the antibacterial effect of A19
[0263] Use the inhibition zone experiment to evaluate the inhibitory effect of A19 on Rhizoctonia solani
[0264] To determine the inhibitory effect of A19 against Rhizoctonia solani (a phytopathogenic fungus that causes destructive diseases to various important cash crops worldwide), a 7-mm mycelial plug was cut from the edge of a 3-day-old colony and transferred to PDA medium (20% potato, 2% glucose, and 2% agar) containing a specific concentration of the test compound. A19 was dissolved in DMSO at concentrations of 10 ppm, 25 ppm, 50 ppm, and 100 ppm, and DMSO was used as a control group. After incubation at 28 °C for 24 h, the colony diameter was measured using the hybridization method described in Liu, K., et al. (2022). "Biological and molecular characterizations of fluxapyroxad-resistant isolates of Botrytis cinerea." Phytopathology Research 4(1):2. The original mycelial plug diameter (7 mm) was subtracted from the measured data. Each experiment was tested with at least 3 replicates, and the test results are as Figure 13 shown. It can be seen that A19 has a good inhibitory effect against Rhizoctonia solani and has the potential to be used as a pesticide.
[0265] Example 8 Detection of the herbicidal effect of A19
[0266] The potential of A19 to develop herbicides was evaluated using an Arabidopsis thaliana seedling inhibition experiment.
[0267] Arabidopsis thaliana ecotype Columbia (Col-0) was selected for root system determination. First, the seeds were surface-sterilized and vernalized by incubating at 4 °C for 3 days, and then sown in a square petri dish (130 mm × 130 mm) containing half-strength MS medium (pH = 5.7). The petri dish was placed vertically in a growth chamber with a light cycle of 16 h light (150 μmol m - 2 S -1 ) / 8 h dark, and the day / night temperature was 23 / 21 °C. After 3 - 5 days of germination, the seedlings were transferred to a petri dish (diameter 35 mm) containing 1 / 2 MS medium, and A19 dissolved in DMSO was added to the medium at concentrations of 25 ppm, 50 ppm, 100 ppm, and 200 ppm, and DMSO was used as a control group. After 4 - 5 days, the lengths of the roots and leaves were measured using ImageJ software (NIH, USA, http: / / rsb.info.nih.gov / ij) and a calibration scale. Each experiment was tested with at least 10 seedlings, and the test results are as Figure 14 shown. It can be seen that A19 has a good inhibitory effect on Arabidopsis thaliana seedlings and has the potential to be used as a pesticide.
[0268] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than limiting them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the various embodiments of the present invention.
Claims
1. Artemisia alcohol synthase, characterized in that, The artemisia alcohol synthase is derived from Artemisia argyi Artemisia argyi ), and the amino acid sequence of the artemisia alcohol synthase is shown in SEQ ID NO:
1.
2. A nucleic acid molecule comprising a nucleotide sequence encoding the Artemisia argyi alcohol synthase according to claim 1 or a nucleotide sequence complementary to its bases.
3. The nucleic acid molecule according to claim 2, wherein The nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO:
3.
4. A recombinant expression vector containing the nucleic acid molecule according to claim 2 or 3, characterized in that, The original vectors of the recombinant expression vectors include pZY900, pYR017, pYR018 or pKlURA100.
5. A transformant containing the nucleic acid molecule according to claim 2 or 3, or containing the recombinant expression vector according to claim 4, wherein the host cell of the transformant is a Saccharomyces cerevisiae expression system.
6. Recombinant Saccharomyces cerevisiae, characterized in that, The recombinant Saccharomyces cerevisiae contains the nucleic acid molecule according to claim 2 or 3, or contains the recombinant expression vector according to claim 4, and the recombinant Saccharomyces cerevisiae also contains the farnesyl pyrophosphate synthase gene.
7. The recombinant Saccharomyces cerevisiae according to claim 6, wherein The copy number of the farnesyl pyrophosphate synthase gene in the genome of the recombinant Saccharomyces cerevisiae is 1 - 3.
8. The recombinant Saccharomyces cerevisiae according to claim 6, wherein The copy number of the farnesyl pyrophosphate synthase gene in the genome of the recombinant Saccharomyces cerevisiae is 2.
9. The recombinant Saccharomyces cerevisiae according to claim 6, wherein The copy number of at least one gene related to the mevalonate pathway in the genome of the recombinant Saccharomyces cerevisiae is more than 1.
10. The recombinant Saccharomyces cerevisiae according to claim 9, characterized in that, The copy number of at least one of the genes ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1 or IDI1 is 1 - 3.
11. The recombinant Saccharomyces cerevisiae according to claim 10, wherein, The copy number of at least one of the genes ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1 or IDI1 is 2 or 3.
12. The recombinant Saccharomyces cerevisiae according to claim 6, wherein The inhibitor GAL80 gene and / or the activating cis - element within the range of - 175 to - 220 upstream of the ERG9 promoter are knocked out in the genome of the Saccharomyces cerevisiae.
13. The preparation method of the recombinant Saccharomyces cerevisiae according to any one of claims 6 to 12, characterized in that, The preparation method includes the steps: (a) Transforming the nucleic acid molecule according to claim 2 or 3 or the recombinant expression vector according to claim 4 into Saccharomyces cerevisiae cells; (b) Increasing the copy number of the farnesyl pyrophosphate synthase gene and / or genes related to the mevalonate pathway in the genome of Saccharomyces cerevisiae by gene editing; The implementation order of step (a) and step (b) is not in sequence.
14. The preparation method according to claim 13, wherein, The copy number of the farnesyl pyrophosphate synthase gene is 1 - 3.
15. The preparation method according to claim 13, characterized in that, The copy number of the farnesyl pyrophosphate synthase gene is 2.
16. The preparation method according to claim 13, characterized in that, The copy number of at least one of the genes ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1 or IDI1 is 1 - 3.
17. The preparation method according to claim 16, wherein, The copy number of at least one of the genes ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1 or IDI1 is 2 or 3.
18. The preparation method according to claim 13, wherein, The preparation method includes transforming an expression cassette for knocking out the inhibitor GAL80 gene and / or an expression cassette for knocking out the activating cis - element upstream of the ERG9 promoter into Saccharomyces cerevisiae cells.
19. Preparation method of artemisia alcohol, characterized in that, The preparation method includes fermenting and culturing the transformant described in claim 5, or fermenting and culturing the recombinant Saccharomyces cerevisiae described in any one of claims 6 to 12, or fermenting and culturing the recombinant Saccharomyces cerevisiae prepared by the preparation method described in any one of claims 13 to 18, and recovering artemisia alcohol from the fermentation product.
20. The preparation method according to claim 19, wherein, The recovery method includes using oil-phase extraction of the fermentation product.
21. The preparation method according to claim 20, wherein The oil phase includes n-hexane, n-dodecane and / or isopropyl myristate.
22. The preparation method according to claim 20, wherein, The recovery method is that during the fermentation process, an oil phase is added, and after the fermentation is completed, the oil phase is collected, and artemisia alcohol enriched in the oil phase is separated and obtained.
23. The preparation method according to claim 22, characterized in that, The method for collecting the oil phase includes centrifugation.
24. The preparation method according to claim 22, characterized in that, The separation method includes rectification.
25. Application of artemisia alcohol obtained by the preparation method described in any one of claims 19 to 24 in the preparation of antibacterial products or herbicidal products, wherein the microorganisms that the antibacterial products can inhibit are Rhizoctonia solani, and the plants that the herbicidal products can inhibit are Arabidopsis thaliana.
Citation Information
Patent Citations
A kind of nerolidol synthase and its application
CN115873836B
Nerolidol synthetase and application thereof
CN115873836A
Novel clerodanes and methods for repelling arthropods
US20060235071A1