Bruton's tyrosine kinase degrader

Abstract

The present invention relates to a compound having formula (I) or a pharmaceutically acceptable salt thereof, wherein the substituents are as defined in the specification; to an intermediate in the preparation of the compound; to a pharmaceutical composition comprising the compound; and to the use of the compound in the treatment of diseases. #imgabs0#

Description

[0001] This application is a divisional application of the international application with application number PCT / IB2019 / 052392 filed on March 25, 2019, and invention name “3-Hydroxy-N-(3-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)pyrrolidine-1-carboxamide derivatives”. The international application entered the Chinese national phase on September 24, 2020, with application number 201980021794.0. Technical Field

[0002] The present invention relates to 3-hydroxy-N-(3-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)pyrrolidine-1-carboxamide derivatives, to their preparation, to pharmaceutical compositions containing them and to their use in the treatment of conditions, diseases and disorders mediated by Bruton's tyrosine kinase. Background Art

[0003] Bruton's tyrosine kinase (BTK) is a key node in B cell receptor (BCR) signaling and an important target in cancer. Many cancers and lymphomas express BTK and are dependent on BTK function, and BCR signaling in tumor-infiltrating B cells is also associated with the tumor-promoting microenvironment of solid cancers (JA Burger and A. Wiestner, Nat Rev Cancer 2018, 18, 148). Pharmacological blockade of BTK using inhibitors, particularly inhibitors that irreversibly bind to BTK via cysteine-481, is an established strategy, with BTK being the primary target of the molecule ibrutinib (JA Burger and JJ Buggy, Leukemia and Lymphoma 2013, 54, 2385), which is indicated for the treatment of various cancers (CS Lee et al., J. Oncol. Pharm. Practice 2016, 22, 92-104. V. Kaur & A. Swami, Ann. Hematol. 2017, 96, 1175), and of the molecule acalabrutinib, which is indicated for the treatment of patients with mantle cell lymphoma who have received at least one prior therapy (Wang M et al., Lancet 2018, 391, No. 10121, 659-667).

[0004] BTK also plays a crucial role in autoimmune diseases. Mice lacking BTK are protected in standard preclinical models of rheumatoid arthritis (L. Jansson and R. Holmdahl, Clinical and experimental immunology 1993, 94, 459; LENyhoff et al., Arthritis Rheumatol. 2016, 68, 1856), systemic lupus erythematosus (Steinberg, BJ et al., J. Clin. Invest. 1982, 70, 587-597), and allergic diseases and anaphylaxis (Hata, D. et al., J. Exp. Med. 1998, 187, 1235-1247), so pharmacological blockade of BTK may be useful for the treatment of immune disorders.

[0005] In view of the above, modulators of BTK may be useful in the treatment of proliferative disorders (eg, cancer) and immune (eg, autoimmune) disorders.

[0006] There remains a need for new drugs to treat BTK-dependent diseases, especially those that are resistant or poorly responsive to existing drugs.

[0007] Molecules designed to reduce or remove BTK protein by inducing its degradation (hereinafter referred to as "BTK degraders") can effectively treat a range of BTK-mediated diseases, such as proliferative disorders (such as cancer) and immune disorders. In addition, BTK degraders can be effective in the case of resistance to irreversible BTK inhibitors (covalently bound to BTK). Resistance can be generated by, for example, mutation of cysteine-481 to serine (or other amino acid substitutions).

[0008] Potential indications for BTK degraders include, but are not limited to, hematopoietic cancers such as Hodgkin lymphoma, non-Hodgkin lymphoma, post-transplant lymphoproliferative disorder, hairy cell leukemia, histiocytic and dendritic tumors, and B-cell tumors such as chronic lymphocytic leukemia (CLL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL), Waldenstrom's macroglobulinemia, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, Burkitt lymphoma, marginal zone lymphoma, immunoglobulinemia, and leukemia. immunoblastic large cell lymphoma, Richter's syndrome, and precursor B-lymphoblastic lymphoma, primary and secondary multiple myeloma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, lymphomatoid granulomatosis, and acute lymphoblastic leukemia.

[0009] Potential indications for BTK degraders also include, but are not limited to, autoimmune disorders such as rheumatoid arthritis, systemic lupus erythematosus, allergic diseases, allergic reactions, and inflammatory conditions. Furthermore, potential indications for BTK degraders include chronic graft-versus-host disease (cGvHD) and immunoglobulin light chain amyloidosis (AL).

[0010] As a potential treatment method, the principle of inducing protein target degradation has been described in, for example, C.M. Crews, 2018, J. Med. Chem. [Journal of Medicinal Chemistry], 61 (2), 403-404 and the references cited therein. A BTK degrader molecule incorporating an ibrutinib structure as a BTK binding portion is described on page 12 of WO2016 / 169989, and the molecule incorporates an E3 ligase IAP binding portion for recruiting the target protein to the E3 ubiquitin ligase IAP for degradation. Two other BTK degrader molecules (which incorporate two structurally different parts as BTK binding components) are described in Huang et al., 2018, Cell Chemical Biology [Cell Chemical Biology] 25, 88-99. The molecule described in this publication incorporates an immunomodulatory imide drug (IMiD) portion (pomalidomide) for recruiting BTK to an E3 ligase complex comprising cerebellum protein (CRBN) for ubiquitination and subsequent degradation. A molecule based on a promiscuous kinase binder (TL12-186) was also described in Huang et al. that degrades multiple targets including BTK and reportedly also degrades certain non-kinase targets including the zinc finger DNA binding protein IKZF1 (Ikaros). IKZF1 and the related protein IKZF3 (Aiolos) are known to be degraded by pomalidomide and lenalidomide ( J. et al. 2014, Science 343, 301-305; Petzold et al. Nature 2016, 532, 127-130; Bjorklund et al. 2015, Blood Cancer Journal, 5, e354; Lu et al. 2014, Science 343, 305-309; Gandhi et al. 2014, Br. J. Haematol. 164, 811-821). Summary of the Invention

[0011] The present invention provides a compound of formula (I) or a pharmaceutically acceptable salt thereof as defined below.The compound of formula (I) is a BTK degrader and is therefore potentially useful in treating conditions, diseases and disorders mediated by BTK.

[0012] In one aspect of the present invention, there is provided a compound having formula (I),

[0013]

[0014] in:

[0015] R 1 isobutyl;

[0016] R 1a It is H;

[0017] R 2 is H or F;

[0018] R 2a is H or F;

[0019] R 6 is H or F;

[0020] R 7 Selected from H, F, Cl, -CH3, -OCH3, and -OCH2CH3;

[0021] X 1 is a group having formula (A) or (B):

[0022] or in,

[0023] *X 1a Selected from *-(CH2) 1-3 - and *-CH2C(CH3)2-, wherein the * represents the X 1a The point of attachment of the group to the phenyl ring in formula (I);

[0024] *X 1b Selected from *-O-, *-OCH2- and *-CH2O-, wherein the * represents the X 1b The point of attachment of the group to the phenyl ring in formula (I);

[0025] X 2a Selected from formula (C), (D), (E), (F) and (G):

[0026]

[0027] Where ** indicates that 1a attachment points;

[0028] X 2b Selected from formulas (E1) and (F1):

[0029]

[0030] Where ** indicates that 1b attachment points;

[0031] X 5 is CH or N;

[0032] X 6 is CH or N;

[0033] R3 is H or -CH3;

[0034] R 4 is H or -CH2OH;

[0035] R 5 is H or -CH2OH;

[0036] Z does not exist or is *-(CH2) 2-3 NH-, where * represents the point of attachment of Z to the N atom in formula (C);

[0037] Z 1 Selected from *-O-, *-C(O)-, *-(CH2) 1-3 -, *-(CH2)2O- and *-CH2CH(CH2OH)O-, where * represents Z in formula (E) and formula (E1) 1 With X 5 attachment points;

[0038] Z 2a Not present or -NH(CH2)4-**;

[0039] Z 2b Yes - (CH2) 3-4 NH(CH2)2-**;

[0040] Z 3 Not present or **-(CH2)4NH-, where Z 2a and Z 3 does not simultaneously not exist; and where Z 2a , Z 2b and Z 3 ** in each of the formulas (F) and (F1) represents the point of attachment to the corresponding N atom;

[0041] q is 0 or 1; and

[0042] n and p are independently 0 or 1; and

[0043] Wherein (i) when Z in formula (E) or formula (E1) 1 If it is *-O-, then X 5 and X 6 is not N, and (ii) when Z in formula (E) or formula (E1) 1 When it is *-(CH2)2-O- or *-CH2CH(CH2OH)O-, then X 6 Not N;

[0044] or a pharmaceutically acceptable salt thereof.

[0045] The present invention relates to novel 3-hydroxy-N-(3-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)pyrrolidine-1-carboxamide compounds of formula (I) that cause degradation of Bruton's tyrosine kinase (BTK). These compounds are designed to induce BTK degradation by recruiting BTK (including BTK mutants, particularly BTK mutants that confer resistance to BTK inhibitors, particularly irreversible BTK inhibitors such as ibrutinib) to E3 ligases, thereby promoting BTK ubiquitination and subsequent degradation by the proteasome. The compounds of the present invention comprise a novel BTK binding domain portion bound to a novel ligand that binds to the E3 ligase cerebellum protein (CRBN).

[0046] Therefore, the compounds of the present invention may therefore potentially be used to treat a range of diseases and disorders, including proliferative and autoimmune diseases, particularly disorders and diseases mediated by BTK, including those in which resistance has been developed, for example, by mutation of cysteine-481 to serine (or other amino acid substitutions). The compounds of the present invention can also show selectivity for BTK degradation (compared to other proteins, particularly other tyrosine kinase proteins and / or (non-tyrosine kinase) IKZF protein families, such as IKZF1 and / or IKZF3, which have been shown to be degraded by IMiDs (e.g., thalidomide, lenalidomide, and pomalidomide) and by the protein degradation molecule TL12-186 mentioned above). The compounds of the present invention can also exhibit kinase selectivity and / or selectivity relative to other off-target proteins such as ion channels and G protein-coupled receptors (GPCRs).

[0047] The compounds of formula (I), including pharmaceutically acceptable salts thereof, are therefore believed to be useful in treating conditions, diseases and disorders mediated by BTK, particularly proliferative conditions, diseases and disorders such as cancer, in particular hematopoietic cancers, including B-cell tumors such as chronic lymphocytic leukemia (CLL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL), Waldenstrom's macroglobulinemia, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, Burkitt's lymphoma, marginal zone lymphoma , immunoblastic large cell lymphoma, Richter's syndrome, and precursor B-lymphoblastic lymphoma, primary and secondary multiple myeloma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, lymphomatoid granulomatosis, and acute lymphoblastic leukemia.

[0048] In another aspect, the present invention provides a compound of formula (I) or a pharmaceutically acceptable salt thereof for use in a method of treating, preventing or ameliorating a BTK-mediated condition, disease or disorder.

[0049] In another aspect, the present invention provides compositions comprising (eg, a therapeutically effective amount of) a compound of formula (I) or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers.

[0050] In another aspect, the present invention provides a combination comprising (eg, a therapeutically effective amount of) a compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more therapeutically active agents. DETAILED DESCRIPTION

[0051] Various embodiments of the present invention are described herein. It should be appreciated that the features specified in each embodiment can be combined with other specified features to provide additional embodiments of the present invention. Various (enumerated) embodiments of the present invention are also described herein.

[0052] The definitions of substituents apply to compounds of formula (I), (I'), (I"), (I'"), (Ia), (Ib), and (Ic), where applicable.

[0053] The definition of substituents applies to the final products as well as to the corresponding intermediates.

[0054] The present invention therefore provides compounds of formula (I):

[0055]

[0056] in:

[0057] R 1 isobutyl;

[0058] R 1a It is H;

[0059] R 2 is H or F;

[0060] R 2a is H or F;

[0061] R 6 is H or F;

[0062] R 7 Selected from H, F, Cl, -CH3, -OCH3, and -OCH2CH3;

[0063] X 1 is a group having formula (A) or (B):

[0064] or in,

[0065] *X 1a Selected from *-(CH2) 1-3 - and *-CH2C(CH3)2-, wherein the * represents the X 1a The point of attachment of the group to the phenyl ring in formula (I);

[0066] *X 1b Selected from *-O-, *-OCH2- and *-CH2O-, wherein the * represents the X 1b The point of attachment of the group to the phenyl ring in formula (I);

[0067] X 2a Selected from formula (C), (D), (E), (F) and (G):

[0068]

[0069] Where ** indicates that 1a attachment points;

[0070] X 2b Selected from formulas (E1) and (F1):

[0071]

[0072] Where ** indicates that 1b attachment points;

[0073] X 5 is CH or N;

[0074] X 6 is CH or N;

[0075] R 3 is H or -CH3;

[0076] R 4 is H or -CH2OH;

[0077] R 5 is H or -CH2OH;

[0078] Z does not exist or is *-(CH2) 2-3 NH-, where * represents the point of attachment of Z to the N atom in formula (C);

[0079] Z 1 Selected from *-O-, *-C(O)-, *-(CH2) 1-3 -, *-(CH2)2O- and *-CH2CH(CH2OH)O-, where * represents Z in formula (E) and formula (E1) 1 With X5 attachment points;

[0080] Z 2a Not present or -NH(CH2)4-**;

[0081] Z 2b Yes - (CH2) 3-4 NH(CH2)2-**;

[0082] Z 3 Not present or **-(CH2)4NH-, where Z 2a and Z 3 does not simultaneously not exist; and where Z 2a , Z 2b and Z 3 ** in each of the formulas (F) and (F1) represents the point of attachment to the corresponding N atom;

[0083] q is 0 or 1; and

[0084] n and p are independently 0 or 1; and

[0085] Wherein (i) when Z in formula (E) or formula (E1) 1 If it is *-O-, then X 5 and X 6 is not N, and (ii) when Z in formula (E) or formula (E1) 1 When it is *-(CH2)2-O- or *-CH2CH(CH2OH)O-, then X 6 Not N;

[0086] or a pharmaceutically acceptable salt thereof.

[0087] The compound having formula (I) can be represented by formula (Ia):

[0088]

[0089] Among them, R 2 、R 2a 、X 1 、R 6 and R 7 is as defined for the compound of formula (I).

[0090] Unless otherwise indicated, the term "compound of the present invention" refers to compounds of formula (I), compounds of subformulas (Ia), (Ib) and (Ic) thereof and exemplary compounds, and salts thereof, as well as all stereoisomers (including diastereomers and enantiomers), rotamers, tautomers (including formula (I') and (I")) and isotopically labeled compounds (including deuterated substitutions, such as compounds of formula (I'")), and inherently occurring moieties.

[0091] Unless otherwise specified, the expressions used in the present invention have the following meanings:

[0092] As used herein, the term -(CH2) 1-3 - refers to (especially) a straight or branched hydrocarbon chain diradical consisting only of carbon and hydrogen atoms, containing no unsaturation, having from 1 to 3 carbon atoms, and attached to the remainder of the molecule at each end by a single bond. The end attached to the remainder of the molecule at a specific position in such a group can be indicated by the indicators * or **. Similar terms such as -(CH2)2O-, -(CH2) 2-3 NH-, -(CH2) 3-4 The radicals NH(CH2)2- and -(CH2)4NH- are to be understood accordingly.

[0093] Examples listed:

[0094] Example 1. A compound of formula (I) or (Ia) or a pharmaceutically acceptable salt thereof, as described above.

[0095] Example 2. The compound according to Example 1, which has formula (1b):

[0096]

[0097] Example 3. The compound according to Example 1, which has formula (1c):

[0098]

[0099] Embodiment 4. The compound according to any one of Embodiments 1 to 3, or a pharmaceutically acceptable salt thereof, wherein R 2 is H and R 2a It's F.

[0100] Embodiment 5. The compound according to any one of Embodiments 1 to 3, or a pharmaceutically acceptable salt thereof, wherein R 2 is F and R 2a It’s H.

[0101] Embodiment 6. The compound according to any one of Embodiments 1 to 5, or a pharmaceutically acceptable salt thereof, wherein R 6 It’s H.

[0102] Embodiment 7. The compound according to any one of Embodiments 1 to 6, or a pharmaceutically acceptable salt thereof, wherein R 7 Selected from -OCH3 and -OCH2CH3.

[0103] Embodiment 8. The compound according to embodiment 7 or a pharmaceutically acceptable salt thereof, wherein R 7 It is -OCH3.

[0104] Embodiment 9. The compound according to any one of Embodiments 1 to 8, or a pharmaceutically acceptable salt thereof, wherein *X 1a Yes*-(CH2) 1-3 -.

[0105] Embodiment 10. The compound according to embodiment 9 or a pharmaceutically acceptable salt thereof, wherein *X 1a Selected from *-CH2- and *-(CH2)2-.

[0106] Embodiment 11. A compound according to any one of Embodiments 1 to 10, or a pharmaceutically acceptable salt thereof, wherein X 2a Selected from formula (C) and (E):

[0107]

[0108] Embodiment 12. The compound according to any one of Embodiments 1 to 8, or a pharmaceutically acceptable salt thereof, wherein *X 1b Selected from *-O-, *-OCH2-, and *-CH2O-.

[0109] Embodiment 13. The compound according to embodiment 12 or a pharmaceutically acceptable salt thereof, wherein *X 1b It's *-O-.

[0110] Embodiment 14. A compound according to any one of Embodiments 1 to 8 or 12 or 13, or a pharmaceutically acceptable salt thereof, wherein X 2b It is formula (E1):

[0111]

[0112] Embodiment 15. The compound according to any one of Embodiments 1 to 14, or a pharmaceutically acceptable salt thereof, wherein R 4 It’s H.

[0113] Embodiment 16. The compound according to any one of Embodiments 1 to 15, or a pharmaceutically acceptable salt thereof, wherein R 5 It’s H.

[0114] Embodiment 17. The compound according to any one of Embodiments 1 to 16, or a pharmaceutically acceptable salt thereof, wherein q is 1.

[0115] Embodiment 18. The compound according to any one of Embodiments 1 to 17, or a pharmaceutically acceptable salt thereof, wherein n and p are both 1.

[0116] Embodiment 19. The compound according to any one of embodiments 1 to 18, or a pharmaceutically acceptable salt thereof, wherein Z is absent.

[0117] Embodiment 20. A compound according to any one of Embodiments 1 to 19, or a pharmaceutically acceptable salt thereof, wherein X 6 It is CH.

[0118] Embodiment 21. A compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1 to 20, wherein Z 1 Selected from *-O-, *-(CH2) 1-3 -, and *-(CH2)2O-.

[0119] Embodiment 22. The compound according to embodiment 21 or a pharmaceutically acceptable salt thereof, wherein Z 1 Selected from *-O-, *-CH2-, *-(CH2)2-, and *-(CH2)2O-.

[0120] Embodiment 23. The compound according to embodiment 22 or a pharmaceutically acceptable salt thereof, wherein Z 1 Selected from *-O-, *-CH2-, and *-(CH2)2O-.

[0121] Embodiment 24. The compound according to any one of Embodiments 1 to 8, or a pharmaceutically acceptable salt thereof, wherein X 1 Selected from

[0122]

[0123]

[0124] wherein * represents the point of attachment to the phenyl ring in Formula (I), Formula (la), Formula (lb), or Formula (lc);

[0125] or a pharmaceutically acceptable salt thereof.

[0126] Embodiment 25. The compound according to embodiment 24 or a pharmaceutically acceptable salt thereof, wherein X1 Selected from:

[0127]

[0128] wherein * represents the atom attached to the phenyl ring in Formula (I), Formula (la), Formula (lb), or Formula (Ic).

[0129] Embodiment 26. The compound according to embodiment 24 or embodiment 25, or a pharmaceutically acceptable salt thereof, wherein R 4 It’s H.

[0130] Embodiment 27. A compound according to any one of Embodiments 24 to 26, or a pharmaceutically acceptable salt thereof, wherein R 5 It’s H.

[0131] Embodiment 28. The compound according to any one of Embodiments 24 to 27, or a pharmaceutically acceptable salt thereof, wherein n, p, and q are each 1.

[0132] Embodiment 29. The compound according to any one of embodiments 24 to 28, or a pharmaceutically acceptable salt thereof, wherein Z is absent.

[0133] Embodiment 30. A compound according to any one of Embodiments 24 to 29, or a pharmaceutically acceptable salt thereof, wherein X 6 It is CH.

[0134] Embodiment 31. A compound according to any one of Embodiments 24 to 30, or a pharmaceutically acceptable salt thereof, wherein Z 1 Selected from *-O-, *-(CH2) 1-3 -, and *-(CH2)2O-.

[0135] Embodiment 32. The compound according to embodiment 31 or a pharmaceutically acceptable salt thereof, wherein Z 1 Selected from *-O-, *-CH2-, *-(CH2)2-, and *-(CH2)2O-.

[0136] Embodiment 33. The compound according to embodiment 32 or a pharmaceutically acceptable salt thereof, wherein Z 1 Selected from *-O-, *-CH2-, and *-(CH2)2O-.

[0137] Embodiment 34. The compound according to any one of embodiments 1 to 8, or a pharmaceutically acceptable salt thereof, wherein:

[0138] X 1 Selected from:

[0139]

[0140] wherein * represents the atom attached to the phenyl ring in Formula (I), Formula (la), Formula (lb), or Formula (Ic).

[0141] Embodiment 35. The compound according to embodiment 34 or a pharmaceutically acceptable salt thereof, wherein X 1 Selected from:

[0142]

[0143] wherein * represents the atom attached to the phenyl ring in formula (I) or (Ia).

[0144] Embodiment 36. A compound having formula (I), wherein the compound is:

[0145] (3S,4R)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0146] (3R,4S)-N-(3-(6-(4-((4-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0147] (3R,4S)-N-(3-(6-(4-((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0148] (cis-rac)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0149] trans-rac-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0150] (3R,4S)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0151] (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0152] (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0153] (cis-rac-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0154] (3S,4R)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0155] (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0156] (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0157] (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0158] (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)methoxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0159] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0160] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-ethoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0161] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0162] (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0163] (3S,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0164] (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0165] (3S,4R)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0166] (3R,4S)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or

[0167] (cis-rac)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0168] or a pharmaceutically acceptable salt thereof.

[0169] Example 37. A compound of formula (I), wherein the compound is

[0170] (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0171] (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0172] (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0173] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0174] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0175] (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or

[0176] (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0177] or a pharmaceutically acceptable salt thereof.

[0178] Example 38. Compound (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0179] or a pharmaceutically acceptable salt thereof.

[0180] Example 39. Compound (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0181] or a pharmaceutically acceptable salt thereof.

[0182] Example 40. Compound (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0183] or a pharmaceutically acceptable salt thereof.

[0184] Example 41. Compound (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0185] or a pharmaceutically acceptable salt thereof.

[0186] Example 42. Compound (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0187] or a pharmaceutically acceptable salt thereof.

[0188] Example 43. Compound (cis-racemic)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0189] or a pharmaceutically acceptable salt thereof.

[0190] Example 44. Compound (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0191] or a pharmaceutically acceptable salt thereof.

[0192] Depending on the choice of starting materials and procedures, the compound can exist in one of the possible stereoisomeric forms or as a mixture thereof (e.g., as a pure optical isomer or as a mixture of stereoisomers, such as a racemate and a diastereomeric mixture), depending on the number of asymmetric carbon atoms. The present invention is intended to include all such possible stereoisomers, including racemic mixtures, diastereomeric mixtures and optically pure forms. Optically active (R)- and (S)-stereoisomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. If the compound contains a double bond, the substituents can be in the E or Z configuration. If the compound contains a disubstituted cycloalkyl group, the cycloalkyl substituent can have a cis or trans configuration. All tautomeric forms are also included.

[0193] Compounds of Formula (I), (Ia), (Ib), or (Ic) can exist in various tautomeric forms. The present invention includes all tautomeric forms of compounds of Formula (I), (Ia), (Ib), or (Ic). For example, a compound of Formula (I) can exist according to tautomeric forms of Formula (I') and (I"), thus:

[0194]

[0195] where R 1 、R 1a 、R 2 、R 2a 、X 1 、R 6 , and R 7 is as defined according to formula (I), (Ia), (Ib), or (Ic).

[0196] As used herein, the term "salt" or "salts" refers to an acid addition salt or a base addition salt of a compound of the present invention. "Salt" specifically includes "pharmaceutically acceptable salts."

[0197] The term "pharmaceutically acceptable salt" refers to salts that retain the biological effectiveness and properties of the compounds of the invention and are generally not biologically or otherwise undesirable. Due to the presence of amino and / or carboxyl groups or groups similar thereto, the compounds of the invention are capable of forming acid salts and / or base salts.

[0198] The pharmaceutically acceptable salts of the present invention can be synthesized from base or acid moieties by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid forms of these compounds with a stoichiometric amount of a suitable base or by reacting the free base forms of these compounds with a stoichiometric amount of a suitable acid. Such reactions are generally carried out in water or an organic solvent or a mixture of the two. Generally, where feasible, it is desirable to use a non-aqueous medium such as ether, ethyl acetate, ethanol, isopropanol, acetonitrile or tetrahydrofuran. A list of other suitable salts can be found in, for example: "Remington's Pharmaceutical Sciences", 20th edition, Mack Publishing Company, Easton, Pa., (1985); and Stahl and Wermuth's "Handbook of Pharmaceutical Salts: Properties, Selection, and Use" (Wiley-VCH, Weinheim, Germany, 2002).

[0199] When both basic and acidic groups are present in the same molecule, the compounds of the present invention may also form internal salts, eg, zwitterionic molecules.

[0200] Since the compounds of the present invention contain at least one basic group, such as an amino group, these compounds are particularly suitable for the formation of acid addition salts.

[0201] Pharmaceutically acceptable acid addition salts can be formed with inorganic and organic acids.

[0202] Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like.

[0203] Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, sulfosalicylic acid, and the like.

[0204] Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases.

[0205] Inorganic bases from which salts can be derived include, for example, ammonium salts and metals from columns I to XII of the periodic table. In certain embodiments, salts are derived from sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, and copper; particularly suitable salts include ammonium, potassium, sodium, calcium, and magnesium salts.

[0206] Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines; substituted amines (including naturally occurring substituted amines); cyclic amines; basic ion exchange resins, etc. Certain organic amines include isopropylamine, benzathine, choline salts, diethanolamine, diethylamine, lysine, meglumine, piperazine, and tromethamine.

[0207] In another aspect, the present invention provides compounds of the invention in the form of acetate, ascorbate, adipate, aspartate, benzoate, benzenesulfonate, bromide / hydrobromide, bicarbonate / carbonate, bisulfate / sulfate, camphorsulfonate, decanoate, chloride / hydrochloride, chlortheophyllonate, citrate, edisylate, fumarate, glucoheptonate, gluconate, glucuronate, glutamate, glutarate, glycolate, hippurate, hydroiodide / iodide, isethionate, The invention also includes but is not limited to the following salts: methylsulfate, malate, maleate, malonate, mandelate, methanesulfonate, methylsulfate, mucate, naphthoate, naphthosulfate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate, pamoate, phosphate / hydrogenphosphate / dihydrogenphosphate, polygalacturonate, propionate, sebacate, stearate, succinate, sulfosalicylate, sulfate, tartrate, tosylate, trifenatate, trifluoroacetate, or xinafoate salts.

[0208] Any formula given herein is also intended to represent unlabeled forms of the compounds as well as isotopically labeled forms. Isotopically labeled compounds have structures represented by the formulas given herein, except that one or more atoms are replaced by atoms having a selected atomic mass or mass number. Isotopes that can be incorporated into the compounds of the invention include, for example, isotopes of hydrogen.

[0209] In another aspect of the present invention, there is provided a compound having the formula (I'"):

[0210]

[0211] where R 1 、R 1a 、R 2 、R 2a 、R 6 is as defined for formula (I) or (Ia), R7 Yes-C(R 10 )3,-OC(R 10 )3 or -OC(R 10 )2C(R 10 )3, and X 1 Selected from:

[0212]

[0213] Each R 8 、R 9 and R 10 is independently selected at each occurrence from H or deuterium, and the symbol # indicates that the indicated positions are substituted with H, which positions may be substituted independently at each occurrence with H or deuterium.

[0214] Incorporation of certain isotopes, especially deuterium (i.e. 2 Deuterium (H or D) can provide certain therapeutic advantages resulting from higher metabolic stability, such as increased in vivo half-life or reduced dosage requirements or improvements in therapeutic index or tolerability. It should be understood that deuterium in this context is considered to be a substituent of a compound of formula (I) and (Ia). The concentration of deuterium can be defined by an isotopic enrichment factor. As used herein, the term "isotopic enrichment factor" means the ratio between the isotopic abundance of a given isotope and its natural abundance. If a substituent in a compound of the invention indicates deuterium, such compound has an isotopic enrichment factor for each designated deuterium atom of at least 3500 (52.5% deuterium incorporation on each designated deuterium atom), at least 4000 (60% deuterium incorporation), at least 4500 (67.5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82.5% deuterium incorporation), at least 6000 (90% deuterium incorporation), at least 6333.3 (95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation), at least 6600 (99% deuterium incorporation), or at least 6633.3 (99.5% deuterium incorporation). It will be understood that the term "isotopic enrichment factor" can be applied to any isotope in the same manner as described for deuterium.

[0215] Other examples of isotopes that may be incorporated into the compounds of the present invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, for example 3 H. 11 C. 13 C. 14 C. 15 N. 18 F. 31 P. 32 P. 35 S. 36 Cl, and 125I. Thus, it will be understood that the present invention includes compounds incorporating one or more of any of the above isotopes, including, for example, radioactive isotopes, e.g. 3 H and 14 C, or into which non-radioactive isotopes such as 2 H and 13 C. Such isotope-labeled compounds can be used for metabolic studies (using 14 C), reaction kinetics studies (using e.g. 2 H or 3 H), detection or imaging techniques (such as positron emission tomography (PET) or single photon emission computed tomography (SPECT), including drug or substrate tissue distribution assays), or radiotherapy for patients. In particular, 18 F-labeled compounds may be particularly desirable for PET or SPECT studies. Isotopically labeled compounds of formula (I) can generally be prepared by conventional techniques known to those skilled in the art or by methods analogous to those described in the accompanying Examples, using an appropriate isotopically labeled reagent in place of the unlabeled reagent previously used.

[0216] As used herein, the term "pharmaceutical composition" refers to a compound of the present invention or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier in a form suitable for oral or parenteral administration.

[0217] As used herein, the term "pharmaceutically acceptable carrier" refers to a substance that can be used to prepare or use a pharmaceutical composition and includes, for example, suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffers, emulsifiers, absorption delaying agents, salts, pharmaceutical stabilizers, binders, excipients, disintegrants, lubricants, wetting agents, sweeteners, flavorings, dyes, and combinations thereof, as known to those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, 18th ed. Mack Printing Company, 1990, pp. 1289-1329).

[0218] The term "therapeutically effective amount" of a compound of the present invention refers to an amount of a compound of the present invention that will cause a biological or medical response in a subject (e.g., reduction or inhibition of enzyme or protein activity) or improve symptoms, alleviate symptoms, slow or delay disease progression, or prevent disease, etc. In one embodiment, the term "therapeutically effective amount" refers to an amount of a compound of the present invention that, when administered to a subject, is effective to (1) at least partially alleviate, prevent and / or improve (i) a condition or disorder or disease mediated by BTK, or (ii) associated with BTK activity, or (iii) characterized by BTK activity (normal or abnormal); or (2) reduce or inhibit BTK activity; or (3) reduce or inhibit BTK expression. For example, these effects can be achieved by reducing the amount of BTK by degrading BTK. In another embodiment, the term "therapeutically effective amount" refers to an amount of a compound of the present invention that, when administered to a cell, or tissue, or non-cellular biological material, or medium, is effective to at least partially reduce or inhibit BTK activity; or at least partially reduce or inhibit BTK expression, for example, by degrading BTK.

[0219] As used herein, the term "subject" refers to primates (e.g., humans (male or female)), dogs, rabbits, guinea pigs, pigs, rats, and mice. In certain embodiments, the subject is a primate. In embodiments, the subject is a human.

[0220] As used herein, the term "inhibition" or "inhibiting" refers to the reduction or suppression of a given condition, symptom or disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process.

[0221] As used herein, the term "degrades, degrading or degradation" refers to the extent to which the cellular proteasome system degrades a target protein, such as BTK, partially or completely to reduce or eliminate the biological activity (particularly abnormal activity) of BTK. Degradation can be achieved by mediating an E3 ligase, particularly an E3 ligase complex comprising the protein cerebellin. As used herein, the term "modulation of BTK activity or modulatingBTK activity" refers to a change, especially a reduction, inhibition or elimination of BTK activity. This can be achieved by degrading BTK. The amount of degraded BTK can be measured by comparing the amount of BTK remaining after treatment with the compound of the present invention with the amount or level of the initial BTK present measured before treatment with the compound of the present invention. In an embodiment, at least about 30% of BTK is degraded compared to the initial level. In an embodiment, at least about 40% of BTK is degraded compared to the initial level. In an embodiment, at least about 50% of BTK is degraded compared to the initial level. In an embodiment, at least about 60% of BTK is degraded compared to the initial level. In embodiments, at least about 70% of BTK is degraded compared to initial levels. In embodiments, at least about 80% of BTK is degraded compared to initial levels. In embodiments, at least about 90% of BTK is degraded compared to initial levels. In embodiments, at least about 95% of BTK is degraded compared to initial levels. In embodiments, greater than 95% of BTK is degraded compared to initial levels. In embodiments, at least about 99% of BTK is degraded compared to initial levels.

[0222] In embodiments, the amount of BTK degradation is from about 30% to about 99% compared to the initial level. In embodiments, the amount of BTK degradation is from about 40% to about 99% compared to the initial level. In embodiments, the amount of BTK degradation is from about 50% to about 99% compared to the initial level. In embodiments, the amount of BTK degradation is from about 60% to about 99% compared to the initial level. In embodiments, the amount of BTK degradation is from about 70% to about 99% compared to the initial level. In embodiments, the amount of BTK degradation is from about 80% to about 99% compared to the initial level. In embodiments, the amount of BTK degradation is from about 90% to about 99% compared to the initial level. In embodiments, the amount of BTK degradation is from about 95% to about 99% compared to the initial level. In embodiments, the amount of BTK degradation is from about 90% to about 95% compared to the initial level.

[0223] As used herein, the term "selective for BTK" means, for example, that the compounds of the present invention degrade BTK preferentially over, or to a greater extent than, another protein or proteins.

[0224] As used herein, the terms "treat," "treating," or "treatment" of any disease or disorder refers to alleviating or relieving the disease or disorder (i.e., slowing or arresting the progression of the disease or at least one clinical symptom thereof); or alleviating or improving at least one physical parameter or biomarker associated with the disease or disorder, including those that may not be discernible by the patient.

[0225] As used herein, the terms "prevent," "preventing," or "prevention" of any disease or disorder refer to prophylactic treatment of a disease or disorder; or delaying the onset or progression of a disease or disorder.

[0226] As used herein, a subject is "in need of" a treatment if such subject would benefit biologically, medically, or in quality of life from such treatment.

[0227] As used herein, the terms “a”, “an”, “the” and similar terms used in the context of the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0228] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (such as "such as" or "for example") provided herein is intended only to better illustrate the invention and does not limit the scope of the invention otherwise claimed.

[0229] Any asymmetric atom (e.g., carbon, etc.) of one or more compounds of the present invention may exist in a racemic or enantiomerically enriched form, such as an (R)-, (S)-, or (R,S)-configuration. In certain embodiments, each asymmetric atom has at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70% enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess, or at least 99% enantiomeric excess in the (R)- or (S)-configuration. Substituents on atoms with unsaturated double bonds may exist in cis-(Z)- or trans-(E)-form, if possible.

[0230] Thus, as used herein, the compounds of the invention may be in the form of one of the possible stereoisomers, rotamers, atropisomers, tautomers, or mixtures thereof, for example, as substantially pure geometric (cis or trans) stereoisomers, diastereomers, optical isomers (enantiomers), racemates, or mixtures thereof.

[0231] Any resulting mixtures of stereoisomers can be separated on the basis of the physicochemical differences of the constituents, into the pure or substantially pure geometric or optical isomers, diastereomers, racemates, for example, by chromatography and / or fractional crystallization.

[0232] The racemate of any gained compounds of the present invention or intermediate can be split into optical antipodes by known methods, for example, by separating its diastereomeric salt obtained with optically active acid or alkali, and releasing optically active acidic or basic compounds. In particular, the compound of the present invention can be split into its optical antipodes using a basic moiety, for example, by fractional crystallization of a salt formed with an optically active acid, such as tartaric acid, dibenzoyltartaric acid, diacetyltartaric acid, two-O, O'-p-toluoyltartaric acid, mandelic acid, malic acid or camphor-10-sulfonic acid. The racemic compound of the present invention or racemic intermediate can also be split by chiral chromatography (for example, high pressure liquid chromatography (HPLC) using a chiral adsorbent).

[0233] The compound of the present application can use the starting material that can be obtained commercially, the compound known in the literature, or by the intermediate that is easily prepared, by adopting well known to those skilled in the art or according to the teaching content of this paper to skilled chemists by obvious standard synthesis method and procedure, prepare with the multiple method that organic synthesis field technicians are well aware of.For all examples, according to as for example in Protective Groups in Organic Synthesis [protective group in organic synthesis], the 3rd edition, John Wiley and Sons Publishing House: New York, 1999 or Protecting Groups [protective group], the 3rd edition, Thieme publishing house, Stuttgart, the standard textbook knowledge described in 2004, potential alternative orthogonal protecting group strategy can be applied.It will be appreciated by those skilled in the art that there is stereocenter in the compound disclosed herein.

[0234] The compounds of the present invention can be synthesized according to the following schemes. The compounds can be assembled in various ways, using related reaction procedures to build up the final molecules in a modular manner to allow for different reaction orders.

[0235] Several reaction types are particularly useful for preparing these compounds. All compounds of the present invention contain an amide functional group, which is typically formed by an amide coupling reaction between an amine and a carboxylic acid using a coupling agent (e.g., HATU or HBTU) and a base (e.g., DIPEA or NMM) in a solvent (e.g., DMF or DMA). Alternatively, the carboxylic acid can first be converted into its pentafluorophenol ester. This allows the amine to readily react with the amine in a solvent such as DMF in the presence of a base such as TEA to form an amide. Compounds of the present invention containing a carbon-nitrogen bond can typically be prepared using a reductive amination reaction starting from an amine and an aldehyde or ketone. In a solvent mixture such as THF and MeOH, conditions such as NaBH3CN, ZnCl2, and TEA are used to react. The carbon-nitrogen bond can also be formed by an amine and a suitable reaction partner containing a leaving group, typically in the presence of a base (e.g., TEA) in a solvent (e.g., THF), by a nucleophilic substitution reaction, such as an alkyl halide or alkyl methanesulfonate. Compounds containing ethers can also be prepared by nucleophilic substitution reactions, in which case an alcohol is reacted with a suitable partner containing a leaving group (e.g., a benzyl halide) in the presence of a base (e.g., TEA) in a solvent (e.g., THF). Another generally useful method for preparing compounds of the present invention containing ethers is the Mitsunobu reaction. In this reaction, phenol and another alcohol are reacted in the presence of a phosphine (e.g., triphenylphosphine) and an azodicarboxylate (e.g., diethyl azodicarboxylate or diisopropyl azodicarboxylate) in a solvent (e.g., THF). Another highly useful reaction for synthesizing compounds of the present invention is a palladium (Pd)-catalyzed cross-coupling reaction in which two aromatic groups are connected together. Particularly useful is the Suzuki coupling reaction between an aromatic halide and an aromatic boronic acid or ester using a catalyst (e.g., PdCl2(dppf)) and a base (e.g., Na2CO3 or Cs2CO3) in a solvent mixture (e.g., dioxane / water).

[0236] Specifically, compounds having formula (I) can be prepared as shown in Scheme 1, wherein R 1 、R 1a 、R 2 、R 2a 、X 1 、R 6 、R 7 、X 1a and X 2a As previously defined. M is defined as H or a protecting group, such as -SO2Ph or -SEM, and LG is defined as a leaving group, such as mesylate (OMs).

[0237] Thus, compounds of formula (I) can be prepared from compounds of formula (II) and compounds of formula (III) by amide coupling between an amine and a carboxylic acid using a coupling agent (e.g., HATU) and a base (e.g., DIPEA or NMM) in a solvent (e.g., DMF or DMA). Alternatively, compounds of formula (I) can be prepared by amide coupling between an amine of formula (II) and a pentafluorophenyl ester of an acid (IIIa) by treatment with TEA in a solvent such as DMF. Compounds of formula (II) can be prepared from compounds of formula (IV). For compounds of formula (IV) where M is a protecting group such as -SO2Ph, deprotection can be accomplished using a base (e.g., NaOH) in a solvent mixture (e.g., DMSO, THF, and water). When M is a -SEM protecting group, deprotection using an acid such as TFA in a solvent such as DCM can be utilized and may be combined with a subsequent amine deprotection step. Further deprotection of the tert-butoxycarbonyl (Boc) group using an acid such as TFA in a solvent such as DCM affords compounds of formula (II).

[0238] Solution 1

[0239]

[0240] Compounds of formula (IV) can be provided by reacting a compound of formula (V) with a compound of formula (VI) using a base (e.g., KCO) in a solvent mixture (e.g., DMF and ACN), for example, in a nucleophilic substitution reaction. Alternatively, compounds of formula (IV) can be provided by reacting a compound of formula (VII) with a compound of formula (VI) in a solvent mixture (e.g., THF and MeOH) using NaBHCN, ZnCl, and TEA, for example, in a reductive amination reaction.

[0241] Compounds of formula (V) can be prepared according to Scheme 2, wherein R 1 、R 1a 、R 2 、R 2a 、X 1a , M and LG are as previously defined. Group -B(OR x )2 defines a boronic acid or boronic acid ester functional group (including cyclic boronic acid esters, such as pinacol boronate). Thus, a Pd-catalyzed coupling, such as a Suzuki reaction between a compound of formula (VIII) and a compound of formula (IX) using a catalyst (e.g., PdCl2(dppf)) and a base (e.g., Cs2CO3) in a solvent mixture (e.g., dioxane / water), is then reacted with X in a second step. 1aThe attached alcohol functional group is converted into a leaving group LG, for example, by mesylation using Ms2O and TEA in a solvent such as THF, to give a compound of formula (V). Compounds of formula (VIII) can be prepared by Pd-catalyzed coupling, for example, by Suzuki reaction between a compound of formula (X) and a compound of formula (XI) using a catalyst such as PdCl2(dppf) and a base such as Cs2CO3 in a solvent mixture such as dioxane / water.

[0242] Option 2

[0243]

[0244] By analogy, compounds of formula (VII) can be prepared according to Scheme 3, wherein R 1 、R 1a 、R 2 、R 2a , M, LG and -B(OR x )2As previously defined.

[0245] Thus, a Pd-catalyzed coupling, such as a Suzuki reaction between a compound of formula (XII) and a compound of formula (IX) using a catalyst (e.g., PdCl(dppf)) and a base (e.g., CsCO) in a solvent mixture (e.g., dioxane / water), yields a compound of formula (VII). Compounds of formula (XII) can also be prepared by a Pd-catalyzed coupling, such as a Suzuki reaction between a compound of formula (X) and a compound of formula (XIII) using a catalyst (e.g., PdCl(dppf)) and a base (e.g., CsCO) in a solvent mixture (e.g., dioxane / water).

[0246] Option 3

[0247]

[0248] Compounds of formula (II) can also be prepared according to Scheme 4. Thus, when M is H, reductive amination between compounds of formula (XIV) and (XV) in a solvent mixture such as THF and MeOH using conditions such as NaBH3CN, ZnCl2, and TEA, followed by deprotection of the amine with an acid such as TFA in a solvent such as DCM, affords compounds of formula (II). Starting from compounds of formula (VII), compounds of formula (XIV) are prepared by a similar sequence, which can be reductively aminated with N-(tert-butyloxycarbonyl)piperazine in a solvent mixture such as THF and MeOH using conditions such as NaBH3CN, ZnCl2, and TEA, followed by deprotection of the amine with an acid such as TFA in a solvent such as DCM, affording (XIV).

[0249] Option 4

[0250]

[0251] Compounds of formula (IV) can be prepared from compounds of formula (XVI) by reacting with compounds of formula (IX) using a catalyst (e.g., PdCl2(dppf)) and a base (e.g., Cs2CO3) in a solvent mixture (e.g., dioxane / water) using a Pd-catalyzed coupling, such as a Suzuki reaction, using a catalyst (e.g., PdCl2(dppf)) and a base (e.g., Cs2CO3) in accordance with Scheme 5. Conversely, compounds of formula (XVI) can also be prepared from compounds of formula (XVII) by a Pd-catalyzed coupling, such as a Suzuki reaction, using a catalyst (e.g., PdCl2(dppf)) and a base (e.g., Cs2CO3) in a solvent mixture (e.g., dioxane / water).

[0252] Option 5

[0253]

[0254] Compounds of formula (XVII) can be prepared from compound (XVIII) by a halogen-boron exchange reaction using a boronate dimer (e.g., bis(pinacolato)diboron), a Pd catalyst such as PdCl2(dppf), and a base such as KOAc in a solvent such as dioxane as shown in Scheme 6. For example, when both Hal and LG in formula (XIX) are bromine, a nucleophilic substitution reaction can be used to obtain compound (XVIII) in which Hal represents a halogen from compounds (XIX) and (VI) using a base such as K2CO3 in a solvent such as acetonitrile.

[0255] A specific subset of compounds (XVIII) described by formula (XVIIIa) can be synthesized from a halophenylacetic acid derivative (XX) and a compound having formula (VI) by a two-step process comprising an amide coupling reaction using a coupling agent (e.g., HATU) and a base (e.g., DIPEA or NMM) in a solvent (e.g., DMF or DMA), followed by the addition of a Grignard reagent (e.g., MeMgBr) in the presence of a catalyst (e.g., ZrCl4) in a solvent (e.g., THF). Compound (XVIIIa) can be converted to compound (XVII) by halogen-boron exchange in a manner similar to that described for compound (XVIII).

[0256] Option 6

[0257]

[0258] Compounds of formula (I) can be prepared from compounds of formula (XXI) and compounds of formula (VIIa), a specific example of compound type (VII) where M = H, using, for example, NaBHCN, ZnCl and TEA in a solvent mixture (e.g., THF and MeOH) using a reductive amination coupling according to Scheme 7. Alternatively, compounds of formula (I) can be prepared by reacting compounds of formula (Va), a specific example of compound type (V) where M = H, with compounds of formula (XXI), using a base (e.g., KCO) in a solvent mixture (e.g., DMF and ACN) in a nucleophilic substitution reaction.

[0259] Option 7

[0260]

[0261] The compound of formula (XXI) is synthesized from the compound of formula (VI) and the compound of formula (III) by an amide coupling reaction using a coupling agent (e.g., HATU) and a base (e.g., DIPEA or NMM) in a solvent such as DMF or DMA, followed by deprotection of the tert-butyloxycarbonyl (Boc) group of the amine using an acid (e.g., TFA) in a solvent such as DCM.

[0262] Compounds of formula (I) wherein Z is absent can be prepared by reacting a compound of formula (XXII) with a compound of formula (XXIII) in a reductive amination coupling using, for example, NaBH3CN, ZnCl2 and TEA in a solvent mixture such as THF and MeOH, wherein Z, R 1 、R 1a 、R 2 、R 2a 、X 1a、R 4 、R 5 、R 6 、R 7 , n, p and q are as previously defined. By analogy, according to Scheme 8, compounds (XXIV) and (XXIII) can be reacted under similar conditions to provide compounds of formula (I).

[0263] Option 8

[0264]

[0265] Compounds of formula (XVI) can be synthesized from compounds of formula (X) and compounds of formula (XXV) according to Scheme 9 using a Pd-catalyzed coupling, such as the Suzuki reaction, in a solvent mixture (e.g., dioxane / water) using a catalyst (e.g., PdCl2(dppf)) and a base (e.g., Cs2CO3).

[0266] Option 9

[0267]

[0268] Compounds of formula (XXV) can be prepared using a variety of methods under the aforementioned reaction conditions. For example, in Scheme 10, starting from common boronic acid / ester starting materials (XXVIII), a compound having structure (XXIX) is subjected to a Mitsunobu reaction followed by deprotection to yield an intermediate of formula (XXVI), which can then be nucleophilically substituted with a compound of formula (XXVII) to provide a compound of formula (XXV). In some cases, (XXVIII) can be subjected to a Mitsunobu reaction with a compound of formula (XXX) to directly yield (XXV).

[0269] Plan 10

[0270]

[0271] Compounds of formula (XXV) can be synthesized from common starting materials, 4-bromobenzyl bromide (XXXI). In these cases, as shown in Scheme 11, a nucleophilic substitution reaction with compound (XXX) using a base (e.g., potassium tert-butoxide) in a solvent (e.g., THF) followed by a halogen-boron exchange using the above-described conditions can directly produce (XXV). In other cases, a nucleophilic substitution reaction with compound (XXXII) followed by a halogen-boron exchange and Boc deprotection yields a new intermediate (XXXIII), which can react with a compound of type (XXVII) in a further nucleophilic substitution reaction under similar reaction conditions to those described above to produce (XXV).

[0272] Plan 11

[0273]

[0274] It is well known to those skilled in the art that, when producing similar compounds, the order of reaction sequences can often be changed. Scheme 12 shows an alternative method for constructing a compound with formula (IV) using methods similar to those described. Therefore, in a solvent mixture (such as dioxane / water), catalyst (such as PdCl (dppf)) and alkali (such as Cs CO ) are used, compound (X) and (XXVIII) are used to carry out Pd-catalyzed coupling, such as Suzuki reaction generates intermediate (XXXIV), which can be subjected to Mitsunobu reaction with a compound with formula (XXXII) to provide intermediate (XXXV). Compound (XXXV) can then further undergo Suzuki coupling, this time with a compound with formula (IX) and subsequent deprotection sequence, to obtain a compound with formula (XXXVI). Compound with formula (XXXVI) can undergo reductive amination with a compound with formula (XXXVII), to obtain a compound with formula (IV).

[0275] Plan 12

[0276]

[0277] Compounds of formula (XXXVI) can also be subjected to reductive amination with compounds of formula (XXXVIII) to give compounds of formula (IV). In this case, two products (where Q is H or Q is CHOH) can be produced as shown in Scheme 13. Compounds (IV) where Q is H can alternatively be prepared using masked aldehydes (XXXIX) in place of (XXXVIII).

[0278] Plan 13

[0279]

[0280] Scheme 14 shows more methods for providing a compound with formula (IV). Therefore, the intermediate with formula (XL) can be produced by the Mitsunobu reaction between, for example, compound (XXVIII) and (XXIX). Alternatively, (XL) can be prepared in two steps, that is, nucleophilic substitution is carried out between the compound with formula (XXXI) and (XXXII), followed by halogen-boron exchange reaction. Intermediate (XL) reacts with the compound with formula (X) in a Pd-catalyzed coupling reaction to obtain a compound with formula (XLI), which can be further Pd-catalyzed with the compound with formula (IX), and then deprotected to obtain a compound with formula (XLII). Compound (XLII) can be subjected to a reductive amination reaction with a compound with formula (XXXVII) to provide (IV).

[0281] Plan 14

[0282]

[0283] Compounds of formula (I) can be prepared as shown in Scheme 15 from intermediates of formula (XLIV), which themselves can be prepared by a direct analogous method to compound (XL) in Scheme 14. Thus, intermediate (XLIV) is derived from (XXVIII) or (XXXI) combined with (XLIII). Compound (XLIV) is then subjected to two Pd-catalyzed coupling reactions and a deprotection sequence to provide (XLV). Compound (XLV) can be reacted with a compound of formula (XLVI) in a reductive amination reaction to provide (I). Compound (XLVI) is prepared from a compound of formula (III) using an amide coupling reaction with N-(2-hydroxyethyl)piperazine, followed by an oxidation reaction such as Swern oxidation using, for example, oxalyl chloride and DMSO, followed by the addition of TEA in a solvent such as DCM.

[0284] Plan 15

[0285]

[0286] Dihydrouracil molecules of formula (III) can be prepared by cyclizing molecules of formula (XLVII) using urea in acetic acid heated to about 120° C. Compound (XLVII) is synthesized from the corresponding aniline derivative (XLVIII) by heating in acrylic acid (Scheme 16), typically at a temperature of about 100° C.

[0287] Plan 16

[0288]

[0289] According to Scheme 17, a urea-forming reaction between compounds of formula (XLIX) and (L) is used to prepare compounds of formula (IX) (wherein R 1 、R 1a 、R 2 、R 2a AND-B(OR x )2 as previously defined).

[0290] Plan 17

[0291]

[0292] Finally, amines of formula (L) can be prepared from protected pyrrolidines (LIII) (wherein PG is defined as a protecting group, such as -Boc or -CBz (benzyloxycarbonyl)) according to Scheme 18. Grignard reagents are added using additives such as Cu(I) bromide dimethyl sulfide complex in a solvent such as ether or THF to stereoselectively open the epoxide to provide a racemic material (LII) - the relative stereochemistry is depicted. This material can be deprotected to provide a racemic mixture of trans isomers of compound (L). Alternatively, chiral separation is performed before deprotection to produce the individual trans enantiomers of compound (L). Compound (LII) can also be subjected to a Mitsunobu transformation reaction using reagents such as 4-nitrobenzoic acid to provide molecules of formula (LI) - the relative stereochemistry is depicted. Material (LI) can be deprotected to provide a racemic mixture of cis isomers of compound (L). Alternatively, chiral separation is performed prior to deprotection to produce the individual cis enantiomers of compound (L). Thus, all enantiomers of (L) are accessible via this route, and one skilled in the art will also appreciate that specific enantiomers can also be prepared starting from non-racemic, chirally pure compound (LIII), thereby affecting chiral resolution at an early stage of the synthesis.

[0293] Plan 18

[0294]

[0295] The experimental section provides details of specific preparations of intermediates and examples using the general methods described above.

[0296] In further embodiments, there is provided a compound according to formula (III) or a salt thereof,

[0297]

[0298] where R6 is selected from H and F; and R 7 Selected from H, F, Cl, -CH3, -OCH3 and -OCH2CH3.

[0299] In other embodiments, there is provided a compound according to formula (IIIa) or a salt thereof,

[0300]

[0301] where R 6 is selected from H and F; and R 7 is selected from H, F, Cl, -CH3, -OCH3 and -OCH2CH3. In other embodiments, a compound according to formula (XXIa) or a salt thereof is provided,

[0302]

[0303] where R 6 is selected from H and F; and R 7 is selected from H, F, Cl, -CH3, -OCH3 and -OCH2CH3. In other embodiments, a compound according to formula (IX) or a salt thereof is provided,

[0304]

[0305] where R 1 、R 1a 、R 2 and R 2a is as defined for formula (I).

[0306] In further embodiments, provided is a compound or salt thereof selected from the group consisting of: 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid:

[0307]

[0308] Pentafluorophenyl 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoate:

[0309]

[0310] 1-(2-methoxy-5-(3,9-diazaspiro[5.5]undecane-3-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione:

[0311]

[0312] N-(5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, in particular (cis-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or (trans-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide:

[0313]

[0314] (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide:

[0315]

[0316] (3S,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide:

[0317]

[0318] (3R,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide:

[0319]

[0320] The compounds of these examples can be used to prepare the compounds of the present invention.

[0321] The present invention further includes any variant of the process of the invention in which an intermediate obtainable at any stage thereof is used as starting material and the remaining steps are carried out, or in which the starting material is formed in situ under the reaction conditions, or in which the reaction components are used in the form of their salts or optically pure materials. The compounds of the invention and the intermediates may also be converted into one another according to methods generally known to those skilled in the art, for example by reduction, oxidation and / or other functionalization of the resulting compounds and / or by cleavage of any one or more protecting groups or linker moieties optionally present, and recovery of the compounds thus obtained.

[0322] In another aspect, the present invention provides a pharmaceutical composition comprising a compound of the present invention or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

[0323] In another aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound of the present invention or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

[0324] In another embodiment, the composition comprises at least two pharmaceutically acceptable carriers, such as those described herein. The pharmaceutical composition can be formulated for specific routes of administration, such as oral administration, parenteral administration (e.g., by injection, infusion, transdermal or topical administration), and rectal administration. Topical administration can also involve inhalation or intranasal application. The pharmaceutical composition of the present invention can be made in solid form (including but not limited to capsules, tablets, pills, granules, powders or suppositories) or in liquid form (including but not limited to solutions, suspensions or emulsions). Tablets can be film-coated or enteric-coated according to methods known in the art.

[0325] Typically, the pharmaceutical composition is a tablet or gelatin capsule containing the active ingredient and one or more of the following:

[0326] a) diluents, such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine;

[0327] b) lubricants, such as silicon dioxide, talc, stearic acid, its magnesium or calcium salts and / or polyethylene glycol; in the case of tablets, also

[0328] c) binders, such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or polyvinyl pyrrolidone; if desired,

[0329] d) disintegrants, for example starch, agar, alginic acid or its sodium salt, or effervescent mixtures; and

[0330] e) Adsorbents, colorants, flavorings and sweeteners.

[0331] There is the compound of formula (I) or (Ia) or its pharmaceutically acceptable salt and shows valuable pharmacological properties, such as regulating BTK activity, for example, by acting as a BTK degradation agent. This can be determined in vitro, for example, in cells, by using an engineered cell line overexpressing BTK or BTK C481S mutant fusion protein as described herein, for fluorescence readings, and in a cell line expressing endogenous BTK. The pharmacological effects of the compounds of the present invention can also be determined in vivo, for example, by administering the compounds of the present invention to animals (such as mice) having tumors such as TMD8 tumors, and measuring the reduction of BTK in tumor tissue and the reduction of tumor volume after administration of the compound. Therefore, there is the compound of formula (I) or (Ia) and can be used to treat diseases mediated by BTK.

[0332] Compounds of formula (I) or (Ia) are useful in studying diseases mediated by BTK, for example as tool compounds.

[0333] The compounds of the present invention in free form or in pharmaceutically acceptable salt form can be used to prevent or treat cancer, for example, cancer selected from solid tumor cancer and hematopoietic cancer.

[0334] Examples of solid tumor cancers include central nervous system cancers, brain cancer, breast cancer, head and neck cancer, lung cancer; esophageal and esophagogastric junction cancer, stomach cancer, colorectal cancer, rectal cancer, anal cancer, hepatobiliary cancer, pancreatic cancer, non-melanoma skin cancer, melanoma, kidney cancer, prostate cancer, bladder cancer, uterine cancer, cervical cancer, ovarian cancer, bone cancer, neuroendocrine cancer, mesothelioma cancer, testicular cancer, thymoma and thymic cancer, and thyroid cancer.

[0335] Examples of hematopoietic cancers include B-cell neoplasms (including rare B-cell malignancies), Hodgkin lymphoma, non-Hodgkin lymphoma, post-transplant lymphoproliferative disorder, hairy cell leukemia, histiocytic and dendritic tumors.

[0336] Examples of B-cell neoplasms include chronic lymphocytic leukemia (CLL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL), Waldenstrom's macroglobulinemia, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, Burkitt's lymphoma, marginal zone lymphoma, immunoblastic large cell lymphoma, Richter's syndrome, and precursor B-lymphoblastic lymphoma, primary and secondary multiple myeloma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, lymphomatoid granulomatosis, and acute lymphoblastic leukemia.

[0337] In specific embodiments, the cancer is selected from chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL), and Waldenstrom's macroglobulinemia.

[0338] In further embodiments, the cancer is chronic lymphocytic leukemia (CLL).

[0339] In another embodiment, the cancer is diffuse large B-cell lymphoma (DLBCL).

[0340] The compounds of the present invention can be particularly useful in treating subjects in which cancers (e.g., CLL, DLBCL, MCL, SLL, and Waldenstrom's macroglobulinemia) have acquired resistance to ibrutinib, for example, in cancers in which resistance has developed by mutation of cysteine-481 to serine (i.e., mutation C481S). Such subjects may, for example, have been treated with ibrutinib or are continuing to be treated with ibrutinib, and in which the subject's response decreases or no longer responds to treatment with ibrutinib. Therefore, the compounds of the present invention can be beneficially used to treat cancers that are resistant to ibrutinib, particularly CLL, DLBCL, MCL, SLL, and Waldenstrom's macroglobulinemia that are resistant to ibrutinib, particularly CLL that is resistant to ibrutinib.

[0341] In another embodiment, the compounds of the present invention in free form or in the form of a pharmaceutically acceptable salt can be used to prevent or treat autoimmune disorders, inflammatory disorders, allergic diseases, allergic reactions, allergic asthma and airway diseases, as well as for transplantation. For example, the compounds of the present invention in free form or in the form of a pharmaceutically acceptable salt can be used to prevent or treat asthma; chronic obstructive pulmonary disease (COPD); transplant rejection; diseases in which antibody production, antigen presentation, cytokine production or lymphoid organogenesis is abnormal or undesirable; rheumatoid arthritis; systemic juvenile idiopathic arthritis (SOJIA); gout; pemphigus vulgaris; idiopathic thrombocytopenic purpura; systemic lupus erythematosus; multiple sclerosis; myasthenia gravis; Sjögren's syndrome; autoimmune hemolytic anemia; antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis; cryoglobulinemia; thrombotic thrombocytopenic purpura; chronic autoimmune urticaria; allergies (atopic dermatitis, contact dermatitis, allergic rhinitis); atherosclerosis; type 1 diabetes mellitus; type 2 diabetes mellitus; inflammatory bowel disease; ulcerative colitis; Crohn's disease; pancreatitis; glomerulonephritis; Goodpasture's syndrome; Hashimoto's thyroiditis; Graves' disease; antibody-mediated transplant rejection (AMR); graft-versus-host disease (GvHD); chronic graft-versus-host disease (cGvHD); B-cell-mediated hyperacute; acute and chronic transplant rejection; thromboembolic disorders; myocardial infarction; angina pectoris; stroke; ischemic disorders; pulmonary embolism; polycythemia vera; essential thrombocythemia; and myeloid metaplastic myelofibrosis.

[0342] In another embodiment, the compounds of the present invention in free form or in pharmaceutically acceptable salt form can be used to prevent or treat immunoglobulin light chain amyloidosis (AL).

[0343] In a further aspect, the present invention provides the use of a compound of the present invention or a pharmaceutically acceptable salt thereof in therapy. In an embodiment, the present invention provides the use of a compound of the present invention or a pharmaceutically acceptable salt thereof in preventing or treating a disease mediated by BTK. In another embodiment, the present invention provides the use of a compound of the present invention or a pharmaceutically acceptable salt thereof in preventing or treating cancer. In a further embodiment, cancer is a hematopoietic cancer. In a further embodiment, the hematopoietic cancer is chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL) and Waldenstrom's macroglobulinemia, particularly CLL or DLBCL.

[0344] In an embodiment, the compound is (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0345] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0346] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0347] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0348] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0349] In an embodiment, the compound is (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0350] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0351] In another aspect, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof, for use in therapy. In an embodiment, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof, for use in preventing or treating a disease mediated by BTK. In an embodiment, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof, for use in preventing or treating cancer. In another embodiment, cancer is a hematopoietic cancer. In another embodiment, the hematopoietic cancer is chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL) and Waldenstrom's macroglobulinemia, particularly CLL or DLBCL.

[0352] In an embodiment, the compound is (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0353] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0354] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0355] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0356] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0357] In an embodiment, the compound is (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0358] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0359] In another aspect, the present invention provides a method for treating a disease mediated by BTK, the method comprising administering a therapeutically acceptable amount of a compound of the present invention or a pharmaceutically acceptable salt thereof to a patient in need. In an embodiment, the present invention provides a method for treating cancer, the method comprising administering a therapeutically acceptable amount of a compound of the present invention or a pharmaceutically acceptable salt thereof to a patient in need. In another embodiment, the cancer is a hematopoietic cancer. In another embodiment, the hematopoietic cancer is chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL) and Waldenstrom's macroglobulinemia, particularly CLL or DLBCL.

[0360] In an embodiment, the compound is (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0361] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0362] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0363] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0364] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0365] In an embodiment, the compound is (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0366] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0367] In another aspect, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof for use in the manufacture of a drug. In an embodiment, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof for use in the manufacture of a drug, for preventing or treating a disease mediated by BTK. In an embodiment, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof for use in the manufacture of a drug, for preventing or treating cancer. In another embodiment, cancer is a hematopoietic cancer. In another embodiment, the hematopoietic cancer is chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL) and Waldenstrom's macroglobulinemia, particularly CLL or DLBCL.

[0368] In an embodiment, the compound is (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0369] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0370] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0371] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0372] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0373] In an embodiment, the compound is (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0374] In an embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or a pharmaceutically acceptable salt thereof.

[0375] For a subject of about 50-70 kg, the pharmaceutical composition of the present invention or combination can be in a unit dose of about 1-1000 mg of one or more active ingredients, or about 1-500 mg or about 1-250 mg or about 1-150 mg or about 0.5-100 mg or about 1-50 mg of active ingredient. The therapeutically effective dose of a compound, pharmaceutical composition or combination thereof depends on the species, body weight, age and individual condition of the subject, the disorder or disease being treated or its severity. A physician, clinician or veterinarian with ordinary skills can easily determine the effective amount of each active ingredient necessary to prevent, treat or suppress the progression of a disorder or disease.

[0376] The above dosage characteristics can be demonstrated in vitro and in vivo using advantageous mammals, such as mice, rats, dogs, monkeys, or isolated organs, tissues, and preparations thereof. The compounds of the present invention can be applied in vitro in the form of a solution (e.g., an aqueous solution), and in vivo in the form of an enteral, parenteral (advantageously, intravenous) suspension or aqueous solution. The in vitro dosage range can be about 10 -6 Molar concentration and 10 -10 Depending on the route of administration, a therapeutically effective amount in vivo may range from about 0.1 to 500 mg / kg, or from about 1 to 100 mg / kg.

[0377] The compounds of the present invention can be administered simultaneously with one or more other therapeutic agents or before or after them. The compounds of the present invention can be administered separately by the same or different routes of administration as the other agents, or can be administered together in the same pharmaceutical composition. The therapeutic agent is, for example, a chemical compound, peptide, antibody, antibody fragment, or nucleic acid, which, when administered to a patient in combination with the compounds of the present invention, has therapeutic activity or enhances therapeutic activity.

[0378] In one embodiment, the present invention provides a product comprising a compound of the present invention and at least one other therapeutic agent, as a combined preparation for simultaneous, separate or sequential use in therapy. In one embodiment, the therapy is to treat a disease or condition mediated by BTK. In another embodiment, the therapy is to treat cancer as described herein. The product provided as a combined preparation includes a composition comprising a compound of the present invention and one or more other therapeutic agents together in the same pharmaceutical composition, or a compound of the present invention and one or more other therapeutic agents in separate form (e.g., in the form of a kit).

[0379] In one embodiment, the present invention provides a pharmaceutical composition comprising a compound of the present invention and one or more other therapeutic agents. In another embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound of the present invention and one or more other therapeutic agents.

[0380] Optionally, the pharmaceutical composition may comprise a pharmaceutically acceptable carrier as described above.

[0381] In one embodiment, the present invention provides a kit comprising two or more separate pharmaceutical compositions, at least one of which comprises a compound of the present invention. In one embodiment, the kit comprises a device for separately retaining the compositions, such as a container, a separate bottle, or a separate foil pouch. An example of such a kit is a blister pack, such as is commonly used for packaging tablets, capsules, etc.

[0382] The kits of the invention can be used for administering different dosage forms (e.g., oral and parenteral), for administering the separate compositions at different dosage intervals, or for titrating the separate compositions relative to each other. To aid compliance, the kits of the invention typically contain instructions for administration.

[0383] In the combination therapy of the present invention, the compound of the present invention and the other therapeutic agent may be produced and / or formulated by the same or different manufacturers. In addition, the compound of the present invention and another therapeutic agent may be used together to form a combination therapy: (i) before the combination product is released to the physician (for example, in the case of a kit comprising the compound of the present invention and the other therapeutic agent); (ii) by the physician himself (or under the guidance of the physician) shortly before administration; (iii) in the patient himself, for example, during the sequential administration of the compound of the present invention and the other therapeutic agent.

[0384] Thus, the present invention also provides the use of another therapeutic agent for treating a disease or condition mediated by BTK, wherein the other therapeutic agent is administered with a compound of the present invention.

[0385] The present invention also provides a compound of the invention for use in a method of treating a disease or condition mediated by BTK, wherein the compound of the invention is administered with another therapeutic agent.

[0386] The present invention also provides another therapeutic agent for use in a method of treating a disease or condition mediated by BTK, wherein the other therapeutic agent is administered with a compound of the present invention.

[0387] The present invention also provides the use of a compound of the invention for treating a disease or condition mediated by BTK, wherein the patient has been previously (eg, within 24 hours) treated with another therapeutic agent.

[0388] The invention also provides the use of another therapeutic agent for treating a disease or condition mediated by BTK, wherein the patient has previously (eg, within 24 hours) been treated with a compound of the invention.

[0389] The present invention also provides the use of another therapeutic agent for treating cancer, wherein the other therapeutic agent is administered together with a compound of the present invention.

[0390] The present invention also provides a compound of the present invention for use in a method of treating cancer wherein the compound of the present invention is administered with another therapeutic agent.

[0391] The present invention also provides another therapeutic agent for use in a method of treating cancer, wherein the other therapeutic agent is administered with a compound of the present invention.

[0392] The invention also provides the use of a compound of the invention for treating cancer wherein the patient has previously (eg within 24 hours) been treated with another therapeutic agent.

[0393] The invention also provides the use of another therapeutic agent for treating cancer, wherein the patient has previously (eg within 24 hours) been treated with a compound of the invention.

[0394] In one embodiment, the additional therapeutic agent is selected from:

[0395] Apoptosis regulators, anti-CD20 antibodies, anti-CD22 antibodies, PI3K inhibitors, tyrosine kinase inhibitors, immune checkpoint agents, CART therapeutics, immunomodulators, bispecific antibodies targeting CD20 and CD3, antibody-drug conjugates (ADCs), proteasome inhibitors, epigenetic modifiers, anti-CD38 mAb, anti-SLAMF7 agents, XPO1 inhibitors and other agents (e.g., chemotherapeutic agents).

[0396] In embodiments, the apoptosis modulator is selected from a Bcl2 inhibitor (e.g., antimycin, obatolac, venetoclax, Ethyl-2-amino-6-cyclopentyl-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromone-3-carboxylate (HA14-1), Oblimersen (G3139, ), Bak BH3 peptides, (-)-gossypol (AT-101, BL-193), Navitoclax (ABT-263), Mcl 1 inhibitors (e.g., AMG176, S63845, AZD5991, MIK665), and MDM2 / p53 inhibitors (e.g., NVP-HDM201, NVP-CGM-097, ALRN-6924, idasanutlin, AMG232, and DS-3032B).

[0397] In embodiments, the anti-CD20 antibody is selected from rituximab, obinutuzumab, ofatumumab, ocrelizumab, and ublituximab.

[0398] In embodiments, the anti-CD22 antibody is selected from inotuzumab, epratuzumab, bectumomab, and moxetumomab.

[0399] In an embodiment, the PI3K inhibitor is selected from duvelisib, umbralisib tosylate, INCB050465, apilimod mesylate (LAM-002), copanlisib hydrochloride Tenalisib, pictilisib (GDC0941), sonolisib (PX866), pilaralisib (SAR 245408 or XL 147), apellisib (BYL719), and leniolisib (CDZ173).

[0400] In embodiments, the tyrosine kinase inhibitor is selected from BTK inhibitors (e.g., ibrutinib, acalabrutinib, zanubrutinib (BGB-3111), tirabrutinib (ONO-4059), ARQ531, CC-292 (AVL-292), CT-1530, DTRMWXHS-12, GDC-0853, M7583, and vecabritinib (SNS-062)), SYK inhibitors (e.g., entospletinib (GS9973), fostamatinib ( fostamatinib and HMPL-523), SYK / JAK inhibitors cerdulatinib (PRT062070), SYK / FLT inhibitors such as TAK-659, FLT3 inhibitors such as FF-10101, FLT3 / BTK inhibitors (CG806), JAK inhibitors (such as itacitanib, INCB052793, BMS911543, fedratinib, WP-1066, NS-018, and ruxolitinib ), Erlotinib Hydrochloride Linifarnib (ABT869), sunitinib malate Bosutinib Dasatinib Pazopanib Sorafenib Zactima (ZD6474), imatinib or imatinib mesylate ( and ) and tozaserti (VX680 or MK-0457).

[0401] In an embodiment, the immune checkpoint agent is an anti-PD-1 agent, an anti-PD-L1 agent selected from pembrolizumab, nivolumab, tislelizumab, atezolizumab, ipilimumab, cemiplizumab, a TLR4 agonist, CCR4 mAb mogalizumab, and a CD47 mAb fusion protein (TTI-621).

[0402] In an embodiment, the CART therapy is selected from CD19, BCMA CART, CD20, CD79b, CD22, CD30.

[0403] In an embodiment, the immunomodulator is selected from lenalidomide Thalidomide avadomide (CC-122) and pomalidomide

[0404] In an embodiment, the bispecific antibody targeting CD20 and CD3 is selected from REGN-1979, XmAb-13676, BTCT-4465-A, CD20-TCB, and 8RG-6026.

[0405] In an embodiment, the ADC is selected from the group consisting of the CD79 ADC polatuzumab vedotin, the CD30 ADC brentuximab vedotin, the CD25 ADC camidanlumab tesirine, and the CD19 ADC loncastuximab tesirine.

[0406] In an embodiment, the proteasome inhibitor is selected from bortezomib Carfilzomib Marizomib (NPI-0052), ixazomib citrate (MLN-9708, ), delanzomib (CEP-18770), and obozomib (ONX-0912).

[0407] In an embodiment, epigenetic modifiers such as HDAC and DNA methylation inhibitors are selected from vorinostat Romidepsin Azacitidine Pyrroxamine, Spirulina A, Maproin (valproic acid), Enrostat, and Guacitabine.

[0408] In an embodiment, the anti-CD38 mAb is selected from Daratumumab and Isatuximab.

[0409] In embodiments, the anti-SLAMF7 agent is elotuzumab.

[0410] In an embodiment, the XPO1 inhibitor is selected from Selinexor and Eltanexor.

[0411] In one embodiment, other agents (eg, general chemotherapeutic agents) that can be combined with the compounds of the present invention are selected from anastrozole Bendamustine Bicalutamide Bleomycin sulfate Busulfan Busulfan Injection Capecitabine N4-pentyloxycarbonyl-5-deoxy-5-fluorocytidine, carboplatin Carmustine Chlorambucil Cisplatin Cladribine Cyclophosphamide ( or ), cytarabine, cytosine arabinoside Cytarabine liposome injection Dacarbazine Dactinomycin (Actinomycin D, Cosmegan), daunorubicin hydrochloride Daunorubicin citrate liposome injection Dexamethasone, docetaxel Doxorubicin hydrochloride Epirubicin Etoposide Fludarabine phosphate 5-Fluorouracil Flutamide Tezacitibine, gemcitabine (difluorodeoxycytidine), hydroxyurea Idabit Ifosfamide Irinotecan L-asparaginase Calcium folinate, melphalan 6-Mercaptopurine Methotrexate Mitoxantrone Gemtuzumab (mylotarg), paclitaxel Albumin-bound paclitaxel Phoenix (Yttrium90 / MX-DTPA), pentostatin, polifeprosan 20, and carmustine implants Tamoxifen citrate Teniposide 6-Thioguanine, thiotepa, tirapazamine Topotecan Hydrochloride for Injection Vinblastine vincristine and vinorelbine ROR mAb cirmtuzumab, dual PI3K / HDAC inhibitor (CUDC-907), Bet inhibitor (INCB357643), ALK inhibitor (crizotinib), EZH1 / 2 inhibitor (DS-3201b), MAPK inhibitor, Aplidin, Plitidepsin (eEF1A2 inhibitor), Wnt inhibitor, radiopharmaceuticals, idiotypic vaccines, pegfilgrastim citoplurikin(IRX-2).

[0412] In further embodiments, the additional therapeutic agent is selected from:

[0413] Venetoclax, oblimersen, navitoclax, MIK665, NVP-HDM201, rituximab, obinutuzumab, ofatumumab, ocrelizumab, ublituximab, otuzumab, epratuzumab, betumumab, mosetumab, duvilisib, erbrefelix tosylate, INCB050465, leniolisib (CDZ173), apilimod mesylate (LAM-002), cupanisib hydrochloride, tenalisib, pitilisib, apelisib, ibrutinib, acalabrutinib, zanubrutinib (BGB-3111), tilutinib Abujam (ONO-4059), ARQ531, CC-292 (AVL-292), CT-1530, DTRMWXHS-12, GDC-0853, M7583, vecabrevitinib (SNS-062), entospletinib (GS9973), fostamatinib, HMPL-523, serlatinib (PRT062070), (TAK-659), FF-10101, FLT3 / BTK inhibitor (CG806), itacitanib, INCB052793, BMS911543, fedratinib, WP-1066, NS-018, ruxolitinib Pembrolizumab, nivolumab, tislelizumab, atezolizumab, ipilimumab, cemiplizumab, TLR4 agonists, CCR4 mAb mogalizumab, CD47 mAb fusion protein (TTI-621), CD19, BCMA CART, CD20, CD79b, CD22, CD30, lenalidomide, thalidomide, avadomide, pomalidomide, XmAb-13676, CD79 ADC vetin-pelatuzumab, CD30 ADC vetin-brentuximab, CD25 ADC camidanlumab tesirine, CD19 ADC loncastuximab tesirine, carfilzomib, bortezomib, ixazomib, marizob, oxpoxetine, azacitidine, romidepsin, vorinostat, guacitabine, daratumumab, isatuximab, elotuzumab, celenasol, eltanexor, fludarabine, carmustine, cyclophosphamide, chlorambucil, bendamustine, melphalan, cladribine, dacarbazine, pentostatin, vincristine, etoposide, epirubicin, doxorubicin, anthracyclines, and antifolates.

[0414] In further embodiments, the additional therapeutic agent is selected from a Bcl2 inhibitor and a BTK inhibitor.

[0415] In further embodiments, the additional therapeutic agent is selected from venetoclax, ibrutinib, and acalabrutinib.

[0416] Specific individual combinations that may provide specific therapeutic benefit include compounds selected from the group consisting of:

[0417] (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0418] (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0419] (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0420] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0421] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0422] (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, and

[0423] (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0424] or a pharmaceutically acceptable salt thereof, in combination with venetoclax.

[0425] Other specific individual combinations that may provide specific therapeutic benefit include compounds selected from the group consisting of:

[0426] (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0427] (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0428] (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0429] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0430] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0431] (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, and

[0432] (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0433] or a pharmaceutically acceptable salt thereof, in combination with ibrutinib.

[0434] Still other specific individual combinations that may provide specific therapeutic benefit include compounds selected from the group consisting of:

[0435] (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0436] (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0437] (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0438] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0439] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0440] (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, and

[0441] (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide,

[0442] or a pharmaceutically acceptable salt thereof, in combination with acalabrutinib.

[0443] These combinations can be provided as a pharmaceutical composition comprising the above-mentioned compound of the present invention or a pharmaceutically acceptable salt thereof, and venetoclax, ibrutinib, or acalabrutinib.

[0444] Alternatively, these combinations may be provided as a combined preparation of the above-mentioned compounds of the present invention, or pharmaceutically acceptable salts thereof, for simultaneous, separate or sequential use with venetoclax, ibrutinib or acalabrutinib in therapy.

[0445] These combinations, particularly with ibrutinib, may be particularly effective in treating hematopoietic cancers, particularly CLL and DLBCL.

[0446] The activity of the compounds of the invention can be assessed by the following in vitro methods described herein.

[0447] The compounds of the present invention can be prepared as described in the following examples.

[0448] Examples

[0449] The following examples illustrate the present invention and should not be construed as limiting thereof. Temperatures are given in degrees Celsius. Abbreviations used are conventional in the art or are listed below.

[0450] All starting materials, structural units, reagents, acids, bases, dehydrating agents, solvents and catalysts for synthesizing the compounds of this invention are commercially available or can be prepared by organic synthesis methods known to those of ordinary skill in the art. In addition, the compounds of the present invention can be produced by organic synthesis methods known to those of ordinary skill in the art, as shown in the following examples.

[0451] abbreviation

[0452] ACN ACN

[0453] AcOH acetic acid

[0454] aq. water-based

[0455] BISPIN Bis(pinacol)diboron

[0456] Boc tert-butylcarboxyl

[0457] br broad peak

[0458] CHX Cyclohexane

[0459] d Doublet

[0460] DCM dichloromethane

[0461] dd double peak

[0462] DEA Diethylamine

[0463] DEAD Diethyl azodicarboxylate

[0464] DIAD Diisopropyl azodicarboxylate

[0465] DIPEA Diisopropylethylamine

[0466] DMA N,N-dimethylacetamide

[0467] DME 1,4-dimethoxyethane

[0468] DMEM Dulbecco's Modified Eagle's medium

[0469] DMF N,N-dimethylformamide

[0470] DMSO dimethyl sulfoxide

[0471] Et2O diethyl ether

[0472] EtOAc

[0473] EtOH

[0474] FCS fetal calf serum

[0475] h hour

[0476] HATU 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]

[0477] Pyridinium 3-oxide hexafluorophosphate

[0478] HBTU 2-(1H-Benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate

[0479] HPLC High-pressure liquid chromatography

[0480] HV High Vacuum

[0481] KOAc potassium acetate

[0482] LC-MS liquid chromatography and mass spectrometry

[0483] m multiplet

[0484] m / z mass-to-charge ratio

[0485] MeOH methanol

[0486] min

[0487] MS

[0488] MsCl methanesulfonyl chloride

[0489] Ms2O Methanesulfonic anhydride

[0490] NaOAc sodium acetate

[0491] NaPyr. Sodium pyruvate

[0492] NEAA non-essential amino acids

[0493] NMM N-Methylmorpholine

[0494] NMR Nuclear Magnetic Resonance

[0495] PBS Phosphate-buffered saline

[0496] PdCl2(dppf) [1,1′-bis(diphenylphosphino)ferrocene] dichloropalladium(II) PdCl2(dppf)-CH2Cl2[1,1′-bis(diphenylphosphino)ferrocene] dichloropalladium(II)-dichloromethane adduct

[0497] PdCl2(PPh3)2 Bis(triphenylphosphine)palladium(II) dichloride

[0498] PG protecting group

[0499] PPh3 triphenylphosphine

[0500] ppm parts per million

[0501] rac racemic

[0502] RM reaction mixture

[0503] Rt retention time

[0504] RT Room temperature

[0505] s singlet peak

[0506] sat. saturated

[0507] SFC Supercritical Fluid Chromatography

[0508] t Triplet

[0509] TBME tert-butyl methyl ether

[0510] TEA triethylamine

[0511] TFA trifluoroacetic acid

[0512] THF Tetrahydrofuran

[0513] Analytical methods

[0514] General conditions: NMR:

[0515] NMR spectra were recorded on a Bruker AVANCE 400 MHz, 500 MHz or 600 MHz NMR spectrometer using ICON-NMR under TopSpin program control. Unless otherwise indicated, spectra were measured at 298 K and referenced to known solvent resonances.

[0516] LC-MS:

[0517] Mass spectra were acquired using electrospray, chemical, and electron impact ionization methods on LC-MS, SFC-MS, or GC-MS systems on a range of instruments configured as follows: Waters Acquity UPLC / SQD System with a photodiode array detector and a single quadrupole mass detector, or an Agilent 1200 System with a G 6110 Series mass spectrometer. [M+H] + Refers to the protonated molecular ion of a chemical species.

[0518] Waters Acquity UPLC / SQD System:

[0519] Method A

[0520]

[0521] Method B

[0522]

[0523] Method C

[0524]

[0525] Method D

[0526]

[0527] Agilent 1200 System:

[0528] Method E

[0529]

[0530] Method F

[0531]

[0532] Method G

[0533]

[0534] Method H

[0535]

[0536]

[0537] Method I

[0538]

[0539] Method J

[0540]

[0541] Method K

[0542]

[0543] Chiral analytical HPLC:

[0544] Chiral analytical HPLC data were generated using a Shimadzu LC-20A analytical HPLC using a photodiode array detector.

[0545] Method L

[0546]

[0547]

[0548] Chiral analytical SFC:

[0549] Chiral analytical SFC data were generated using a Waters Acquity UPC2 system (using a photodiode array detector).

[0550] Method M Column Daicel Chiralpak AD-H, 5 μm, 250 x 4.6 mm

[0551]

[0552] Preparative chromatography:

[0553] Normal-phase and reversed-phase flash chromatography purifications have been performed on CombiFlash Rf200 or Rf+ systems. Alternatively, reversed-phase chromatography purifications have been performed on Interchim Puriflash 4250 systems or Biotage systems. Supercritical fluid chromatography (SFC) separations have been performed using a Waters Preparative SFC-100-MS System with a Waters 2998 Photodiode Array Detector or a Waters MS Single Quadrupole Detector using MeOH as a modifier. Typically, the back pressure was 120 bar, the flow rate was 100 g CO2 / min, and the column temperature was 40°C. Reversed-phase HPLC purifications have been performed on a Waters Preparative HPLC System with a Waters 2998 Photodiode Array Detector or a Waters MS Single Quadrupole Detector.

[0554] Chiral Preparative Chromatography:

[0555] Method 1

[0556]

[0557] Method 2

[0558]

[0559]

[0560] Solid Phase Extraction (SPE) Cartridges:

[0561] For acid removal: PL-HCO3 MP SPE cartridges were purchased from Agilent Stratos Phere-Reference: PL-HCO3 MP-resin, 1.8 mmol / g, 100A, 150-300 μm, 500 mg, 6 ml.

[0562] For capture and release: SCX cartridges were purchased from Agilent - Reference: HF Mega DE-SCX, 2 g, 12 ml.

[0563] Synthesis of intermediates

[0564] Intermediate 1a

[0565] 3-(2,4-Dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid

[0566]

[0567] Step 1: 3-((2-Carboxyethyl)amino)-4-methoxybenzoic acid

[0568] 3-Amino-4-methoxybenzoic acid (5.0 g, 29.3 mmol) was suspended in acrylic acid (8.05 ml, 117 mmol). The resulting beige suspension was stirred to 100° C. After 10 min, stirring was stopped and the RM was kept at 100° C. for 3 h. The crude RM was used directly in the next step without further treatment or purification.

[0569] LC-MS (Method A): Rt=0.56 min, [M+H] + =240.2.

[0570] Step 2: 3-(2,4-Dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid

[0571] AcOH (33 ml) is added to crude RM 3-((2-carboxyethyl) amino)-4-methoxybenzoic acid (7.01 g, 29.3 mmol). The suspension is heated to 100 ° C and stirred for 10 min. Then, urea (11.00 g, 183 mmol) is added, and the mixture obtained is stirred at 120 ° C overnight. The brown solution obtained is then quenched into a cold water solution (150 ml) and concentrated HCl (10 ml). After stirring, the beige suspension obtained is stored in a refrigerator at 5 ° C overnight and then filtered. The filter cake is washed with water and dried, to provide a brown solid. The brown solid is digested with 0.05 M aqueous HCl and filtered. The filter cake is washed with TBME (3 x 25 ml) and dried under reduced pressure at 40 ° C, to provide 6.29 g of the title compound as a beige solid.

[0572] LC-MS (Method A): Rt=0.48 min, [M+H] + =265.2.

[0573] Intermediate 1b

[0574] Pentafluorophenyl 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoate

[0575]

[0576] To a 250ml round-bottom flask was added (3-(2,4)-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (intermediate 1a) (28g, 106mmol), pentafluorophenyl 2,2,2-trifluoroacetate (36g, 127mmol) and DMF (50ml). Then, DIPEA (76ml, 424mmol) was added at 0°C, and the RM was stirred at RT for 2h and then diluted with water (300ml). The mixture was extracted with EtOAc (2x250ml), and the combined organic layers were washed with brine (2x10ml), dried over Na2SO4, filtered and concentrated. The crude mixture was purified by silica gel chromatography (eluting with 10%-30% EtOAc in petroleum ether) to provide 40g of the title compound as a white solid.

[0577] LC-MS (Method E): Rt=1.51 min, [M+H] + =432.

[0578] Intermediate 1c 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-ethoxybenzoic acid

[0579]

[0580] 3-Amino-4-ethoxybenzoic acid (2.7 g, 14.90 mmol) was suspended in acrylic acid (4.09 ml, 59.6 mmol) and the RM was stirred at 110 ° C for 1 h. Urea (5.37 g, 89 mmol) and AcOH (18 ml) were added and the RM was stirred at 130 ° C for 2 h. The RM was quenched with water, acidified with an aqueous concentrated solution of HCl (37%) and extracted with EtOAc. The organic phases were combined and evaporated. Water was added, the mixture was filtered and the solid was washed with water and EtOAc to produce the title compound (1.1 g) as a solid.

[0581] Method A: Rt = 0.56 min; [M+H] + =279.1.

[0582] Intermediate 2

[0583] 4-Chloro-6-iodo-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine

[0584]

[0585] Step 1: 4-Chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine

[0586] In a flame-dried flask placed under argon, sodium hydride (60%) in mineral oil (1.563g, 39.1mmol) is added to DMF (60ml), and the resulting mixture is cooled to 0 ° C. Over 10min, a solution of 6-chloro-7-deazapurine (deazapurine) (4g, 26.0mmol) in DMF (20ml) is slowly added. The reaction is stirred for 10min until hydrogen production stops. Then, benzenesulfonyl chloride (3.36ml, 26.0mmol) is added, and the reaction is stirred for 1h at RT. Then, water is added, and the resulting precipitate is filtered and dried under reduced pressure to provide 7.418g of the title compound as a light grey solid.

[0587] LC-MS (Method C): Rt=1.01 min, [M+H] + =294.1 / 296.0.

[0588] Step 2: 4-Chloro-6-iodo-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine

[0589] Over 15 min, to a stirred solution of 4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine in dry THF (80 ml) at -78 ° C under an argon atmosphere, lithium diisopropylamide mono-THF (1.5 M) in CHX (5.22 ml, 7.83 mmol) was added. After 1 h, a solution of iodine (1.987 g, 7.83 mmol) in THF (20 ml) was added dropwise over 15 min. The resulting solution was stirred for 3 h. Then, water (2 ml) was added, and the mixture was warmed to RT. The mixture was diluted with DCM, the orange organic layer was washed with brine (2x), dried over Na2SO4, and evaporated to dryness. The resulting orange-brown solid was ground together with ACN to provide 1.513 g of the title compound as a beige solid.

[0590] LC-MS (Method C): Rt=1.12 min, [M+H] + =419.9 / 421.9.

[0591] Intermediate 3a 4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde

[0592]

[0593] Step 1: (4-(4-Chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl)methanol

[0594] To a brown suspension of ethyl 4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzoate (which can be prepared according to the procedure described in published patent US 6140332, col. 45, example 30) (10.2 g, 33.8 mmol) in 100 ml of THF was slowly added a solution (1 M) of lithium aluminum hydride in THF (50.7 ml, 50.7 mmol) at 0-5°C under argon. During the addition, the RM was diluted with THF (5 ml). After the addition, the RM was stirred at 0°C for 10 min and allowed to warm to RT. After stirring at RT for 3 h, the RM was quenched with water (50 ml) and 15% aqueous NaOH (50 ml) at 0°C (exothermic, gas evolution). The RM was washed with 4% ethanol (50 ml) and 1% ethanol (50 ml). (filter material), filtered, washed with THF (250 ml), and the filtrate concentrated under reduced pressure to provide 9.32 g of the title compound.

[0595] LC-MS (Method A): Rt=0.78 min, [M+H] + =260.1 / 262.1.

[0596] Step 2:4-(4-Chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde

[0597] A black suspension of (4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl)methanol (step 1) (9.32 g, 32.7 mmol) and manganese dioxide (28.4 g, 327 mmol) in THF (250 ml) was stirred at RT overnight. A further batch of manganese dioxide (8.52 g, 98 mmol) was added to the RM and stirred at RT for another night. The RM was washed with water and lysed. The (filtered material) was filtered and washed with THF (400 ml). The resulting filtrate was concentrated, diluted with THF, and Filter again and concentrate under reduced pressure to provide 5.68 g of the title compound.

[0598] LC-MS (Method A): Rt=0.88 min, [M+H] + =258.1 / 260.1.

[0599] Intermediate 3b

[0600] 4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde

[0601]

[0602] To a 21 flask purged and maintained under an inert atmosphere was added 4-chloro-6-iodo-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine (Intermediate 2) (54 g, 129 mmol) and 4-formylphenylboronic acid (19 g, 129 mmol), Na2CO3 (40 g, 370 mmol) and PdCl2(dppf) (9 g, 12.9 mmol). ACN (1200 ml) and water (300 ml) were added and the RM was stirred at 100 ° C for 16 h under N2. The RM was filtered and concentrated under vacuum. The crude mixture was purified by silica gel chromatography (eluting with 3%-9% MeOH in DCM) to produce 39 g of 4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde as a yellow solid.

[0603] LC-MS (Method I): Rt=1.99 min, [M+H] + =398.

[0604] Intermediate 4

[0605] tert-Butyl 4-(2-oxoethoxy)piperidine-1-carboxylate

[0606]

[0607] Step 1: tert-Butyl 4-(allyloxy)piperidine-1-carboxylate

[0608] At RT, under argon, sodium hydride (60%) in mineral oil (964mg, 24.10mmol) is added dropwise to a solution of 1-Boc-4-hydroxypiperidine (1000mg, 4.82mmol) in anhydrous THF (45ml). Stirring is continued for 30min. Then allyl bromide (0.500ml, 5.78mmol) is added dropwise to the mixture, and RM is stirred for 40h at RT. Then RM is quenched with water. The mixture is extracted with EtOAc, dried over Na2SO4, filtered and concentrated to provide a crude compound. Purified by flash silica gel chromatography (eluting with 0-20% EtOAc in CHX), there is provided 1130mg of the title compound as a colorless liquid.

[0609] LC-MS (Method A): Rt=1.13 min, [M-tBu+H] + =186.1.

[0610] Step 2: tert-Butyl 4-(2-oxoethoxy)piperidine-1-carboxylate

[0611] A solution of tert-butyl 4-(allyloxy)piperidin-1-carboxylate (1120 mg, 4.64 mmol) in anhydrous DCM (40 ml) was cooled to -78 ° C in a two-necked flask. Ozone was bubbled in the RM for 70 min. The RM was then warmed to RT and PPh3 polymer bound (5 g, 16.00 mmol) was added to destroy the ozonide. The RM was stirred at RT for 30 min. It was then passed through Filtered and washed with DCM.The filtrate was evaporated to dryness to provide 1147 mg of the title compound as a colorless oil.

[0612] 1 H NMR (400MHz, DMSO-d6) δ9.58 (s, 1H), 4.21 (s, 2H), 3.70-3.40 (m, 10H), 3.01 (s, 6H), 1.87-1.66 (m, 6H), 1.38 (dd, J = 2.6, 1.2Hz, 34H).

[0613] Intermediate 5

[0614] tert-Butyl 4-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate

[0615]

[0616] A mixture of 4-chloro-6-iodo-7H-pyrrolo[2,3-d]pyrimidine (3.60 g, 12.88 mmol), CsCO (10.5 g, 32.2 mmol) and 4-(4-t-Boc-piperazine and methyl)phenylboronic acid (4.95 g, 15.46 mmol) in dioxane / water 1:1 (100 ml) was degassed with argon. PdCl(dppf)-CHCl adduct (1.052 g, 1.288 mmol) was then added and the RM was stirred at 100 °C for 4 h. The RM was cooled to RT and then distributed between EtOAc and water. The layers were separated and the precipitate contained in the organic layer was filtered to provide 2.18 g of the title compound as a brown powder. The resulting filtrate was washed with brine, dried over MgSO4 and concentrated to provide 4.65 g of crude product. The crude product was triturated in ACN / Et20, filtered and dried under reduced pressure to afford 1.938 g more of the title compound as a beige solid.

[0617] LC-MS (Method A): Rt=0.81 min, [M+H] + =428.2 / 430.2.

[0618] Intermediate 6

[0619] (trans-rac)-tert-Butyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate

[0620]

[0621] Under argon, at -30 ℃, to tert-butyl 6-oxa-3-azabicyclo [3,1,0] hexane-3-formate (10g, 52.9mmol) and copper bromide (I)-dimethyl sulfide complex (1.5g, 7.30mmol) in THF (200ml) solution, isobutyl magnesium chloride (100ml, 200mmol) (2M) in THF is added dropwise. The dark solution gained is stirred for 1h below -15 ℃. Then RM is quenched with 10% aqueous NH4Cl and becomes blue. EtOAc is added, and the mixture is stirred at RT for 30min. Then each layer is separated, and the aqueous layer is extracted with EtOAc (3x). The combined organic layer is washed with brine, dried over MgSO4, filtered and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography, eluting with 0-20% EtOAc in petroleum ether, to provide 11.82 g of the title compound as a light yellow oil.

[0622] 1H NMR (400 MHz, chloroform-d) δ 3.96 (q, J = 5.2 Hz, 1H), 3.59 (dd, J = 11.2, 6.3 Hz, 2H), 3.19 (dd, J = 11.5, 4.6 Hz, 1H), 3.00 (dd, J = 10.9, 6.0 Hz, 1H), 2.07 (dp, J = 12.3, 5.8 Hz, 1H), 1. 91(s,1H),1.60(dt,J=13.2,6.6Hz,1H),1.43(d,J=12.6Hz,13H),1.31(ddd,J=13. 5,8.3,5.3Hz,1H),1.13(ddd,J=13.7,9.4,5.9Hz,1H),0.90(dd,J=8.8,6.6Hz,6H).

[0623] Intermediate 7

[0624] (3R,4S)-N-(5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0625]

[0626] Step 1: (trans-rac)-Benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate

[0627] Under N2, over 20min, to a suspension of benzyl 6-oxa-3-azabicyclo [3.1.0] hexane-3-formate (8.9g, 40.6mmol) and copper (I) bromide-dimethyl sulfide complex (0.835g, 4.06mmol) in THF (200ml), isobutylmagnesium chloride (79ml, 158mmol) (2M) was added dropwise, and the temperature was maintained below-15°C. The dark solution gained was stirred for 1h below-15°C. The RM was quenched with 10% aqueous NH4Cl (exothermic) and turned blue. EtOAc and water were added, and the mixture was stirred at RT for 30min. The layers were separated, and the aqueous layer was extracted with EtOAc (2x). The combined organic layer was washed with water (2x) and brine (1x), dried over Na2SO4, filtered and concentrated under reduced pressure to provide 10.62g of crude product. The crude product was purified by flash silica gel chromatography (eluting with 0-50% EtOAc in hexanes) to provide 5.67 g of material. The material was purified by flash silica gel chromatography (eluting with 0-30% MeOH (+10% NH4OH) in DCM) to provide 3.911 g of the title compound.

[0628] LC-MS (Method A): Rt=1.05 min, [M+H] + =278.4.

[0629] Step 2: (3S,4R)-Benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate and (3R,4S)-Benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate

[0630] Chiral separation of (trans-rac)-benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate using SFC (Preparative Method 1) provided the individual enantiomers as colorless oils; the first eluting peak (Peak 1) gave 1.64 g of (3S,4R)-benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate and the second eluting peak (Peak 2) produced 1.65 g of (3R,4S)-benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate:

[0631] (3S,4R)-Benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate:

[0632] SFC (Method M): Rt = 2.51 min.

[0633] LC-MS (Method A): Rt=1.06 min, [M+H] + =278.2.

[0634] (3R,4S)-Benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate:

[0635] SFC (Method M): Rt = 3.75 min.

[0636] LC-MS (Method A): Rt=1.06 min, [M+H] + =278.2.

[0637] Step 3: (3R,4S)-4-Isobutylpyrrolidin-3-ol

[0638] A solution of (3R,4S)-benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate (2nd eluting peak from step 2) (1.65 g, 5.95 mmol) in MeOH (20 ml) was treated with 10% palladium on carbon (0.4 g, 3.76 mmol) and the RM was placed under 0.1 bar of hydrogen at 25-30°C. After 2 h, the RM was passed through The mixture was stirred for 2 hours at 4 ℃ for 10 minutes.(Filter material) Filter and wash with MeOH.The filtrate is concentrated and dried under vacuum to provide a yellow oil.The oil is dissolved in DCM and HCl (2.231ml, 8.92mmol) (4M) in dioxane is added to form a hydrochloride.Then, Et o is added, the precipitate formed is filtered and dried under reduced pressure to provide 840mg of the title compound as HCl salt.

[0639] 1 H NMR(600MHz,DMSO-d6)δppm 0.88(dd,J=16.69,6.60Hz,6H)1.13(ddd,J=13.66,8.99,6.33Hz,1H)1.25(ddd,J=13.75,7.70,6.42Hz,1H)1.54-1.63(m,1H)2.0 6-2.13(m,1H)2.81(dq,J=11.14,5.70Hz,1H)2.86-2.97(m,1H)3.19-3.27(m,1H)3.30-3.35(m,1H)3.97(q,J=3.85Hz,1H)5.46(br s, 1H) 9.12-9.58 (m, 2H).

[0640] Step 4: (3R,4S)-N-(5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0641] To a solution of 5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (commercially available; or can be prepared according to the procedure described in published patent application WO 2013 / 008095, page 37, intermediate 5) (1 g, 3.98 mmol) and DIPEA (2.78 ml, 15.93 mmol) in DCM (25 ml) was slowly added phosgene 20% in toluene (2.51 ml, 4.78 mmol) below 0°C. The resulting solution was stirred at 0°C for 30 min and then added to a stirred solution of (3R,4S)-4-isobutylpyrrolidin-3-ol (step 3) (0.787 g, 4.38 mmol) in DCM (25 ml) at 0°C. The resulting mixture was stirred at 0°C for 45 min. In the mixture of 4-nitro-2-nitro-1-oxo-2-nitro-2-oxo-4-oxo-2-nitro-3 ...

[0642] LC-MS (Method A): Rt=1.18 min, [M+H] + =421.4.

[0643] Intermediate 8

[0644] (3S,4R)-N-(5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0645]

[0646] Steps 1 and 2: See Intermediate 7

[0647] Step 3: (3S,4R)-N-(5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0648] To a solution of 5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (commercially available; or can be prepared according to the procedure described in published patent application WO 2013 / 008095, page 37, intermediate 5) (950 mg, 3.78 mmol) and DIPEA (2.64 ml, 15.13 mmol) in DCM (25 ml) was slowly added 20% phosgene in toluene (2.389 ml, 4.54 mmol) below 0°C. The resulting solution was stirred at 0°C for 15 min and then added to a stirred solution of (3S,4R)-4-isobutylpyrrolidin-3-ol (748 mg, 4.16 mmol) in DCM (25 ml) at 0°C. The resulting mixture was stirred at 0°C for 30 min. The RM is then concentrated, diluted with EtOAc / MeOH (9: 1), washed with water (3x) and salt solution (1x). The organic layer is then dried and concentrated with MgSO4 to give 1.764g of crude product. The crude product is purified by flash silica gel chromatography (eluting with 0-100% EtOAc (+5% EtOH) in hexane), providing 1.38g of the title compound as white foam.

[0649] LC-MS (Method A): Rt=1.18 min, [M+H] + =421.4.

[0650] Intermediate 9

[0651] (cis-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0652]

[0653] Step 1: cis-rac-tert-Butyl 3-isobutyl-4-((4-nitrobenzoyl)oxy)pyrrolidine-1-carboxylate

[0654] Under argon, at 0 DEG C, over 1h, to (trans-racemic)-tert-butyl 3-hydroxy-4-isobutyl pyrrolidine-1-formate (intermediate 6) (11.82g, 43.2mmol), 4-nitrobenzoic acid (11g, 65.2mmol) and PPh3(18g, 65.2mmol) in THF (250ml) solution was added dropwise DIAD (13ml, 65.5mmol). The resulting orange solution was slowly warmed to RT for another 3 hours. The RM was quenched with water, and the THF was partially evaporated. EtOAc was added, and the mixture was extracted with EtOAc (3x). The combined organic layer was washed with 0.2M HCl and brine, dried over MgSO4, filtered and evaporated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-15% EtOAc in CHX) to provide 16.43g of the title compound as light yellow foam.

[0655] LC-MS (Method A): Rt=1.41 min, [M-tBu+H] + =337.2.

[0656] Step 2: (cis-rac)-tert-Butyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate

[0657] To a solution of (cis-racemic)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl)oxy)pyrrolidine-1-carboxylate (step 1) (16.43 g, 41.9 mmol) in MeOH / HO 3:1 (160 ml) was added NaOH (3.35 g, 84 mmol). The RM was stirred for 1.5 h at RT. The pH of the RM was then adjusted to 6 using 1 M aqueous HCl. The MeOH portion was evaporated, EtOAc was then added, and the mixture was stirred for 30 min at RT. The mixture was extracted with EtOAc (3x), dried over MgSO4, filtered, and concentrated under reduced pressure. The white residue obtained was ground and filtered in DCM. The yellow filtrate obtained was purified by flash silica gel chromatography (eluting with 0-35% EtOAc in CHX) to provide material, which was then ground and filtered in DCM. The obtained filtrate was concentrated to give 10.602 g of the title compound as a yellow oil.

[0658] 1H NMR (400MHz, chloroform-d) δ4.26-4.15(m,1H),3.53(t,J=9.1Hz,1H),3.44(d,J=1.7Hz,2H),3.03(t,J=10.7Hz,1H),2.86-2.21( m, 1H), 2.13 (dqd, J = 11.4, 7.9, 3.8Hz, 1H), 1.59 (dp, J = 13.3, 6.7Hz, 1H), 1.43 (d, J = 13.2Hz, 24H), 0.91 (d, J = 6.6Hz, 7H).

[0659] Step 3: (cis-rac)-4-isobutylpyrrolidin-3-ol

[0660] A solution of (cis-rac)-tert-butyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate (step 2) (1.040 g, 4.06 mmol) and HCl (4 M) in dioxane (10 ml) was stirred overnight at RT. The RM was concentrated, then co-evaporated with DCM and dried under reduced pressure to afford 770 mg of the title compound as an off-white solid as the HCl salt.

[0661] 1 H NMR (400MHz, DMSO-d6) δ9.27(s,2H),5.46-5.17(m,1H),4.25-3.97(m,1H),3.26-3.11(m,3H),3.04(d,J=12.1Hz,1H),2.72(t,J=11.3Hz,1H) ,2.05(dt,J=7.3,3.8Hz,1H),1.55(dq,J=13.2,6.6Hz,1H),1.38(dt,J=13.9,7.1Hz,1H),1.18(dt,J=13.9,7.2Hz,1H),0.86(d,J=6.3Hz,6H).

[0662] Step 4: (cis-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0663] At 0 ° C, phosgene 15% in toluene (1.3 ml, 1.821 mmol) was added dropwise to a solution of 5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (CAS 1227210-37-8) (commercially available; or can be prepared according to the procedure described in published patent application WO 2013 / 008095, page 37, intermediate 5) (438 mg, 1.708 mmol) and DIPEA (0.5 ml, 2.86 mmol) in dry DCM (10 ml). The RM was stirred at 0 ° C for 30 min. Then, a solution of (cis-rac)-4-isobutylpyrrolidin-3-ol (step 3) (323 mg, 1.705 mmol) and DIPEA (0.5 ml, 2.86 mmol) in dry DCM (1 ml) was added dropwise at 0 ° C. The light orange solution of gained is stirred at 0 ℃ for 2h.The mixture is distributed between DCM and saturated aqueous NaHCO solution.The organic layer is washed with saturated aqueous NH4Cl and brine, dried over Na2SO4 and evaporated.The crude compound is purified by flash silica gel chromatography (eluting with 0-15% MeOH in DCM) to provide 793mg of the title compound.

[0664] LC-MS (Method A): Rt=1.22 min, [M+H] + =421.4.

[0665] Intermediate 10

[0666] (cis-rac)-N-(5-fluoro-3-(6-(4-formylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0667]

[0668] A mixture of 4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde (Intermediate 3a) (375 mg, 1.323 mmol), KCO (402 mg, 2.88 mmol) and (cis-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 9) (701 mg, 1.151 mmol) in dioxane / water 1:1 (10 ml) was degassed with argon. PdCl(dppf)-CHCl adduct (94 mg, 0.115 mmol) was then added and the RM was stirred at 100° C. for 1 h. The RM was partitioned between EtOAc and water. The organic layer was washed with brine, dried over MgSO4 and concentrated under reduced pressure. The crude product was diluted in MeOH / diisopropyl ether, cooled at 4 ° C, and the suspension was filtered to provide 190 mg of the title compound as a yellow solid. The filtrate was purified by flash silica gel chromatography (eluting with 0-12.5% MeOH in DCM) to provide an additional amount (311 mg) of the title compound.

[0669] LC-MS (Method A): Rt=0.98 min, [M+H] + =516.3.

[0670] Intermediate 11

[0671] (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-(piperazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0672]

[0673] Step 1: tert-Butyl 4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate

[0674] A mixture of tert-butyl 4-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate (Intermediate 5) (500 mg, 1.110 mmol), KCO (384 mg, 2.78 mmol) and (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 7) (500 mg, 1.13 mmol) in dioxane / water 1:1 (10 ml) was degassed with argon. PdCl(dppf)-CHCl adduct (91 mg, 0.111 mmol) was then added and the RM was stirred at 100° C. for 2 h. The RM was cooled to RT and then partitioned between EtOAc and water. The layers were separated. The organic layer was washed with brine, dried over MgSO 4 and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-40% DCM / MeOH / NH 3 (80:20:1) in DCM) to provide 514 mg of the title compound as an orange solid.

[0675] LC-MS (Method A): Rt=0.88 min, [M+H] + =686.5.

[0676] Step 2: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-(piperazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0677] A brown solution of tert-butyl 4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate (step 1) (507 mg, 0.724 mmol) and HCl in dioxane (2 ml, 8.00 mmol) (4 M) in MeOH (2 ml) was stirred at RT for 2 h. The RM was concentrated and dried under reduced pressure to afford 509 mg of the title compound as an HCl salt.

[0678] LC-MS (Method A): Rt=0.71 min, [M+H] + =586.5.

[0679] Intermediate 12

[0680] (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-(piperidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0681]

[0682] Step 1: tert-Butyl 4-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)piperidine-1-carboxylate

[0683] Under argon, at 0 ℃, to 4-hydroxyphenylboronic acid pinacol ester (1.030g, 4.68mmol), 1-Boc-4-hydroxypiperidine (1.057g, 5.15mmol) and PPh (1.35g, 5.15mmol) in THF (20ml) solution, DIAD (1ml, 5.14mmol) was added dropwise. The resulting solution was stirred 3 days at RT. RM was distributed between EtOAc and saturated aqueous NaHCO solution. The organic layer was separated, washed with salt water, dried over MgSO and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-20% EtOAc in CHX) to provide 1.249g of the title compound.

[0684] LC-MS (Method A): Rt=1.48 min, [M+H] + =404.2.

[0685] Step 2: tert-Butyl 4-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carboxylate

[0686] A mixture of 4-chloro-6-iodo-7H-pyrrolo[2,3-d]pyrimidine (Synnovator, Inc., CAS [876343-10-1]) (855 mg, 3.06 mmol), CsCO (2492 mg, 7.65 mmol) and tert-butyl 4-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)piperidine-1-carboxylate (step 1) (1234 mg, 3.06 mmol) in dioxane / water 1:1 (30 ml) was degassed with argon. PdCl(dppf)-CHCl adduct (250 mg, 0.306 mmol) was added and the RM was stirred at 100° C. for 3 h. The RM was cooled to RT and then partitioned between EtOAc and saturated aqueous NaHCO. The layers were separated, and the organic layer was then washed with brine, dried over MgSO4, and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-100% EtOAc in CHX) to provide a brown residue. The residue was then triturated with MeOH, and the resulting suspension was filtered, washed with Et2O, and dried under reduced pressure to provide 1.039 g of the title compound as a beige powder.

[0687] LC-MS (Method A): Rt=1.24 min, [M+H] + =429.3 / 431.2.

[0688] Step 3: tert-Butyl 4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carboxylate

[0689] A mixture of tert-butyl 4-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carboxylate (step 2) (295 mg, 0.420 mmol), KCO (145 mg, 1.049 mmol) and (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 7) (200 mg, 0.476 mmol) in dioxane / water 1:1 (4 ml) was degassed with argon. PdCl(dppf)-CHCl adduct (34 mg, 0.042 mmol) was added and the RM was stirred at 100° C. for 1 h. The RM was cooled to RT and then partitioned between EtOAc and water. The layers were separated, and the organic layer was then washed with brine, dried over MgSO4 and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-38% MeOH in DCM) to provide 303 mg of the title compound.

[0690] LC-MS (Method A): Rt=1.22 min, [M+H] + =687.3.

[0691] Step 4: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-(piperidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0692] A brown solution of tert-butyl 4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carboxylate (step 3) (303 mg, 0.393 mmol) and HCl in dioxane (2 ml, 8.00 mmol) (4 M) in MeOH (2 ml) was stirred at RT for 1 h. The RM was then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 317 mg of the title compound as an orange powder as a TFA salt.

[0693] LC-MS (Method A): Rt=0.76 min, [M+H] + =587.3.

[0694] Intermediate 13

[0695] tert-Butyl 9-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0696]

[0697] Step 1: 2-(4-(4,4,5,5-Tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)ethan-1-ol

[0698] A mixture of 2-(4-bromophenyl)ethane-1-ol (CAS 4654-39-1) (60 g, 300 mmol), BISPIN (84 g, 330 mmol), KOAc (90 g, 900 mmol) and PdCl2(dppf) (6.6 g, 9 mmol) in dioxane (600 ml) was stirred at 85 ° C under N2 for 16 h. The RM was then cooled to RT and filtered. The resulting solution was concentrated under reduced pressure. The crude residue was purified by silica gel chromatography (eluting with 0-30% EtOAc in petroleum ether) to provide 100 g of the title compound as a colorless oil.

[0699] LC-MS (Method I): Rt=1.87 min, [M+NH4] + =266.

[0700] Step 2: A mixture of 2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)ethan-1-ol (step 1) (100 g, 300 mmol) and TEA (240 g, 2400 mmol) in DCM (1300 ml) was stirred at 0 ° C for 20 min. Then, MsCl (136 g, 1200 mmol) in DCM (200 ml) was added dropwise. After addition, RM was stirred at RT for 16 h. The mixture was then washed with water (3 x 300 ml), dried over Na2SO4 and concentrated under reduced pressure. The crude residue was purified by silica gel chromatography (eluting with 0-50% EtOAc in DCM) to provide 87 g of the title compound as a colorless oil.

[0701] LC-MS (Method H): Rt=1.92 min, [M+H] + =327.

[0702] Step 3:tert-Butyl 9-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0703] By tert-butyl 3,9-diazaspiro [5.5] undecane-3-formate (CAS173405-78-2) (34g, 133mmol), 4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolane-2-yl) phenethyl methanesulfonate (step 2) (86g, 172mmol), KCO(47g, 345mmol) and KI (2.3g, 13.8mmol) in ACN (1000ml) mixture is stirred at 60 DEG C for 16h.Then RM is filtered, and the solution is concentrated under reduced pressure. The crude residue is purified by silica gel chromatography (eluting with 0-10% MeOH in DCM) to provide 49g of title compounds as white solids.

[0704] LC-MS (Method F): Rt=1.47 min, [M+H] + =485.

[0705] Step 4: tert-Butyl 9-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0706] A mixture of tert-butyl 9-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (step 3) (38 g, 79 mmol), intermediate 2 (37 g, 88 mmol), KCO (22 g, 160 mmol) and PdCl(dppf) (5.8 g, 8 mmol) in 5:1 dioxane / water (480 ml) was stirred at 80 ° C under N for 16 h. The RM was then poured into EtOAc (1500 ml) and the organic layer was washed with water (100 ml), dried over NaSO, filtered and concentrated under reduced pressure. The crude residue was purified by silica gel chromatography (eluting with 0-10% MeOH in DCM) to provide 34 g of the title compound as a yellow solid.

[0707] LC-MS (Method F): Rt=1.99 min, [M+H] + =650.

[0708] Intermediate 14

[0709] 1-(2-methoxy-5-(3,9-diazaspiro[5.5]undecane-3-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0710]

[0711] Step 1: tert-Butyl 9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0712] At RT, under argon, to a stirred solution of 3,9-diaza-spiro [5.5] undecane-3-formic acid tert-butyl ester (432mg, 1.698mmol) and NMM (0.392ml, 3.57mmol) in DMF (4ml) was added intermediate 1a (471mg, 1.783mmol) and then HATU (743mg, 1.953mmol) was added. The clarified RM was stirred for 2.5h at RT, then quenched with saturated aqueous NaHCO and diluted with EtOAc. The layers were separated and the aqueous layer was extracted with EtOAc (1x). The combined organic layers were washed with salt water / water (1:1, 2x) and salt water (1x), dried over MgSO, filtered and concentrated under reduced pressure to obtain 900mg of the title compound.

[0713] LC-MS (Method A): Rt=0.91 min, [M+H] + =501.4.

[0714] Step 2: 1-(2-methoxy-5-(3,9-diazaspiro[5.5]undecane-3-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione

[0715] A solution of tert-butyl 9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (step 1) (100 mg, 0.200 mmol) and HCl in dioxane (1 ml, 4 mmol) (4 M) in MeOH (1 ml) was stirred at RT for 1.5 h. The RM was concentrated and dried under reduced pressure to afford 99 mg of the title compound as the hydrochloride salt.

[0716] LC-MS (Method D): Rt=0.76 min; [M+H] + =401.4.

[0717] Intermediate 15

[0718] tert-Butyl 4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidine-1-carboxylate

[0719]

[0720] To an orange suspension of 4-chloro-6-iodo-7H-pyrrolo[2,3-d]pyrimidine (848 mg, 3.03 mmol) and (4-(((1-(tert-butoxycarbonyl)piperidin-4-yl)oxy)methyl)phenyl)boronic acid (1.068 g, 3.19 mmol) in 1-propanol (20 ml) under argon was added PdCl(PPh) (106 mg, 0.152 mmol) followed by NaCO (3.03 ml, 6.07 mmol) (2 M) in water. The RM was stirred at 100 °C overnight. It was then diluted with EtOAc, washed with water and brine. The organic layer was dried over MgSO, filtered and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-100% EtOAc in CHX) to provide 844 mg of the title compound.

[0721] LC-MS (Method A): Rt=1.29 min, [M+H] + =443.3

[0722] Intermediate 16

[0723] tert-Butyl 4-(2-(4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate

[0724]

[0725] Step 1: 4-Chloro-6-(4-((piperidin-4-yloxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidine

[0726] A yellow solution of tert-butyl 4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidine-1-carboxylate (Intermediate 15) (515 mg, 1.163 mmol) and TFA (2.69 ml, 34.9 mmol) in DCM (3 ml) was stirred at RT under argon for 2 h. The solution was then concentrated and then dried under reduced pressure to provide 664 mg of the title compound as a TFA salt.

[0727] LC-MS (Method A): Rt=0.66 min; [M+H] + =343.2 / 345.2.

[0728] Step 2: tert-Butyl 4-(2-(4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate

[0729] To a brown solution of 4-chloro-6-(4-((piperidin-4-yloxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidine (step 1) (664 mg, 1.163 mmol), tert-butyl 4-(2-oxoethyl)piperidine-1-carboxylate (291 mg, 1.279 mmol) and TEA (0.486 ml, 3.49 mmol) in MeOH (4 ml) was added ZnCl (2.56 ml, 1.279 mmol) (0.5 M) in THF. The RM was stirred at RT for 3 h, then NaBHCN (80 mg, 1.279 mmol) was added and the RM was stirred at RT under argon overnight. The solution was diluted with DCM and washed with water and brine. The organic layer was dried over MgSO, filtered, concentrated and dried under reduced pressure to provide 730 mg of the title compound.

[0730] LC-MS (Method A): Rt=0.95 min, [M+H] + =554.4 / 556.3.

[0731] Intermediate 17

[0732] 2-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl)ethanol

[0733]

[0734] By 4- chloro-6- iodo-7H- pyrrolo [2,3-d] pyrimidine (1.2g, 4.29mmol), 4- (2- hydroxyethyl) phenylboronic acid (750mg, 4.29mmol), Na in water CO (4.72ml, 9.45mmol) (2M) and PdCl in 1- propanol (36ml) (PPh) (154mg, 0.215mmol) yellow milky mixture was flushed with N at RT and then stirred in a preheated oil bath at 105 ° C. After stirring at 105 ° C overnight, the brown mixture was concentrated to dryness and dried under an HV pump to produce a dark solid. The crude product was purified by flash silica gel chromatography (eluting with 40%-100% EtOAc in CHX) to provide 762mg of the title compound as a yellow solid.

[0735] LC-MS (Method A): Rt=0.82 min, [M+H] + =274.0.

[0736] Intermediate 18

[0737] tert-Butyl 4-(piperidin-4-yloxy)piperidine-1-carboxylate

[0738]

[0739] Step 1 : tert-Butyl 4-(pyridin-4-yloxy)piperidine-1-carboxylate

[0740] Pyridine-4-ol (5g, 52.6mmol), dry THF (200ml), tert-butyl 4-hydroxypiperidine-1-carboxylate (13.3g, 65.8mmol) and PPh3 (18g, 68.4mmol) are mixed in a 500ml round-bottom flask. DEAD (12g, 68.4mmol) is then added dropwise at RT. RM is stirred for 3h at RT, and then RM is concentrated. Purified by silica gel chromatography (eluting with 3% MeOH in DCM) to provide 10g of title compound as a white solid.

[0741] LC-MS (Method H): Rt=1.35 min, [M+H] + =279.3.

[0742] Step 2 : tert-Butyl 4-(piperidin-4-yloxy)piperidine-1-carboxylate

[0743] Into a 500 ml round bottom flask purged and maintained under inert atmosphere was mixed tert-butyl 4-(pyridin-4-yloxy)piperidine-1-carboxylate (2 g, 7.2 mmol), EtOH (100 ml), AcOH (5 ml) and palladium on carbon (0.4 g). The RM was stirred at 80 ° C under H2 atmosphere (4 MPa) for 16 h. The mixture was passed through Filtered, and the filtrate was concentrated under reduced pressure.The crude mixture was purified by silica gel chromatography (eluting with 10% MeOH in DCM) to provide 0.5 g of the title compound as a colorless oil.

[0744] LC-MS (Method H): Rt=1.32 min, [M+H] + =285.3.

[0745] Synthesis of final compounds

[0746] Compound 1

[0747] (3S,4R)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0748]

[0749] Step 1: (3S,4R)-N-(5-Fluoro-3-(6-(4-formylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0750] To a 100 ml round-bottom flask was added 4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde (410 mg, 1.03 mmol) (Intermediate 3b), (3S,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (420 mg, 1.0 mmol) (Intermediate 8), PdCl2(dppf) (110 mg, 0.15 mmol), Na2CO3 (280 mg, 2.64 mmol), ACN (16 ml) and H2O (4 ml). The mixture was degassed, purged with N2 (2x) and stirred at 100°C for 1.5 h. The RM was concentrated under vacuum and cold water (30 ml) was added.The mixture was extracted with EtOAc (3 x 50 ml) and the combined organic layers were evaporated to give 800 mg of the title compound.

[0751] LC-MS (Method J): Rt=1.74 min, [M+H] + =656.

[0752] Step 2: tert-Butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0753] To a round-bottom flask (100 ml) was added (3S,4R)-N-(5-fluoro-3-(6-(4-formylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (720 mg, 0.9 mmol) (Step 1), tert-butyl 3,9-diazaspiro[5.5]undecane-3-carboxylate (360 mg, 1.41 mmol) and MeOH (32 ml). TEA (53 mg, 0.52 mmol) and ZnCl 1 M in THF (1.0 ml, 1.0 mmol) were added to the mixture. The mixture was stirred at 30° C. for 1.5 h, and then NaBH CN (160 mg, 2.57 mmol) was added to the mixture at 5° C. The mixture was stirred at 30° C. for 1 h. The RM was evaporated and cold water (50 ml) was added.The mixture was extracted with EtOAc (3 x 50 ml) and the combined organic layers were evaporated to afford 1.2 g of the title compound.

[0754] LC-MS (Method K): Rt=2.67 min, [M+H] + =895.

[0755] Step 3: tert-Butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0756] At 0 ° C, in a round-bottom flask (50 ml) containing a solution of tert-butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (610 mg, 0.45 mmol) (step 2) in DMSO (6 ml), NaOH (140 mg, 3.5 mmol) in H O (1.2 ml) was added. The mixture was stirred at 0 ° C for 3 h. To this mixture was added a mixture of ice water and cold water (40 ml), the precipitated solid was collected and purified by silica gel chromatography (eluting with 0-18% MeOH in DCM) to give 230 mg of the title compound as a yellow solid.

[0757] LC-MS (Method E): Rt=2.44 min, [M+H] + =754.

[0758] Step 4 :(3S,4R)-N-(3-(6-(4-(3,9-diazaspiro[5.5]undec-3-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0759] To a round-bottom flask (100 ml) containing a solution of tert-butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (230 mg, 0.305 mmol) in DCM (1.8 ml) and EtOH (5.0 ml) was added dropwise a solution of HCl in dioxane (2.0 ml, 8.0 mmol) (4 M) at 5 °C. The mixture was stirred at 30 °C for 4 h. An additional amount of HCl in dioxane (2.0 ml, 8.0 mmol) (4 M) was added dropwise and the RM was further stirred for 40 min. The RM was evaporated to afford the crude product. The crude product was triturated with petroleum ether / TBME 1:1 (3 x 30 ml), TBME (30 ml) and DCM / TBME 2:1 (30 ml) and the solid was dried in vacuo to yield 172 mg of the title compound as a tan solid as the hydrochloride salt.

[0760] LC-MS (Method F): Rt=1.05 min, [M+H] + =654.

[0761] Step 5: (3S,4R)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0762] In a 50 ml round-bottom flask containing a solution of (3S,4R)-N-(3-(6-(4-(3,9-diazaspiro[5.5]undec-3-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (172 mg, 0.237 mmol) (step 4) and 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (63 mg, 0.237 mmol) (intermediate 1a) in DMF (2.5 ml) at 5° C., DIPEA (183 mg, 1.42 mmol) was added. HATU (90 mg, 0.237 mmol) was then added at 5° C., and the mixture was stirred at 5° C. for 1 h. The RM was filtered and purified by preparative HPLC (XBridge C18, 21.2 x 250 mm, 10 μm; eluting with 0.01 M NH 4 HCO 3 buffer in water / ACN) to yield 63 mg of the title compound as a white solid.

[0763] LC-MS (Method E): Rt=1.85 min, [M / 2+H] + =450.7.

[0764] 1H NMR(500MHz,DMSO-d6)δ12.70(s,1H),10.33(s,1H),8.82(s,1H),7.92(d,J= 8.2Hz,2H),7.68(s,1H),7.49(dd,J=10.8,2.7Hz,1H),7.40-7.34(m,3H),7.3 2(d,J=2.1Hz,1H),7.14(d,J=8.7Hz,1H),7.05(dd,J=8.9,2.8Hz,1H),6.75( s,1H),5.12(s,1H),3.90-3.86(m,1H),3.84(s,3H),3.65(dd,J=16.3,9.2Hz, 2H),3.59(t,J=6.6Hz,2H),3.53-3.35(m,4H),3.49(s,2H),3.19(dd,J=10.1 ,4.7Hz,1H),3.11-3.05(m,1H),2.68(t,J=6.3Hz,2H),2.38-2.32(m,4H),2.0 9(s,3H),2.06-2.00(m,1H),1.66-1.58(m,1H),1.52-1.47(m,4H),1.45-1.3 8(m,4H),1.38-1.29(m,1H),1.16-1.09(m,1H),0.90(dd,J=10.8,6.6Hz,6H).

[0765] Compound 2

[0766] (3R,4S)-N-(3-(6-(4-((4-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0767]

[0768] Step 1: 2-((1-(tert-Butyloxycarbonyl)piperidin-4-yl)oxy)-1-hydroxyethanesulfonic acid

[0769] The solution of tert-butyl 4- (2- oxoethoxy) piperidine -1- formate (intermediate 4) (1.0g, 3.70mmol) in EtOH (6ml) is purged with argon. Then a solution of sodium metabisulfite (500mg, 2.63mmol) in water (1ml) is added, and RM is stirred at 80 DEG C for 1h. The heterogeneous mixture is then cooled to RT. After stirring at RT for 2 days, the suspension is filtered, washed with EtOH and dried under reduced pressure to provide 833mg of the title compound as a white solid.

[0770] 1 H NMR (400MHz, DMSO-d6) δ5.32(d,J=5.7Hz,1H),3.96(t,J=7.2Hz,1H),3.80(d,J=10.3Hz,1H),3.61(d,J=1 3.4Hz,2H),3.46(s,1H),3.35(s,2H),2.99(s,2H),1.73(s,2H),1.39(s,9H),1.30(q,J=9.1,5.9Hz,2H).

[0771] Step 2: tert-Butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazin-1-yl)ethoxy)piperidine-1-carboxylate

[0772] To a solution of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 11) (200 mg, 0.321 mmol) in MeOH (3 ml) was added NaOAc (67 mg, 0.973 mmol) and the resulting orange solution was stirred at RT for 5 min. 2-((1-(tert-Butyloxycarbonyl)piperidin-4-yl)oxy)-1-hydroxyethanesulfonic acid (Step 1) (130 mg, 0.380 mmol) and 2-methylpyridine borane complex (21 mg, 0.167 mmol) were then added and the RM was stirred at RT for 3 days before being concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 5%-100% ACN in (water + 0.1% TFA) to provide 364 mg of the title compound as a TFA salt.

[0773] LC-MS (Method A): Rt=0.94 min, [M+H] +=813.6.

[0774] Step 3: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-((4-(2-(piperidin-4-yloxy)ethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0775] A solution of tert-butyl 4-(2-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazin-1-yl)ethoxy)piperidine-1-carboxylate (step 2) (364 mg, 0.224 mmol) and HCl in dioxane (2 ml, 8.00 mmol) (4 M) in MeOH (2 ml) was stirred at RT for 2 h. The RM was then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 155 mg of the title compound as a TFA salt.

[0776] LC-MS (Method A): Rt=0.70 min, [M+H] + =713.6.

[0777] Step 4: (3R,4S)-N-(3-(6-(4-((4-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0778] To a solution of 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (41 mg, 0.155 mmol) (Intermediate 1a) in DMF (1 ml) was added NMM (0.050 ml, 0.455 mmol) followed by HATU (59 mg, 0.155 mmol) at RT. After stirring at RT for 30 min, a solution of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-((4-(2-(piperidin-4-yloxy)ethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 3) (155 mg, 0.143 mmol) and NMM (0.050 ml, 0.455 mmol) in DMF (0.5 ml) was added dropwise to the mixture and the yellow RM was stirred at RT overnight. The RM was then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (Interchim) (at The crude product was purified on a C18 column (eluted with 2%-100% ACN in (water + 0.1% NH4HCO3) to provide 114 mg of material. The material was purified by SFC (column: Princeton 4-EP, 60A, 250 x 30 mm, 5 uM; eluted with 40%-60% CO2 in MeOH) to provide 80 mg of the title compound as a solid.

[0779] LC-MS (Method B): Rt=3.52 min, [M+H] + =959.7.

[0780] 1H NMR (400MHz, DMSO-d6) δppm 12.72 (br s, 1H), 10.32 (s, 1H), 8.83 (s, 1H) 7.92 (br d, J = 7.92Hz, 2H), 7.67 (s, 1H), 7.50 (br d,J=10.71Hz,1H),7.30-7.40(m,4H),7.14(br d,J=8.51Hz,1H),7.06(br d,J=8.80Hz,1H),6.76(s,1H),5.11(br d,J=4.11Hz,1H),3.81-3.89(m,4H),3.42-3.77(m,11H),3.19-3.25(m,2H),3.05-3.16(m,2H ),2.67(brt,J=5.94Hz,2H),2.52-2.55(m,1H),2.23-2.48(m,9H),2.01-2.12(m,4H),1.81(br s,2H),1.62(m,1H),1.30-1.48(m,3H),1.07-1.17(m,1H),0.90(br t,J=7.48Hz,6H).

[0781] Compound 3

[0782] (3R,4S)-N-(3-(6-(4-((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0783]

[0784] Step 1: tert-Butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate

[0785] To a stirred solution of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 12) (200 mg, 0.248 mmol), TEA (0.100 ml, 0.717 mmol) and N-boc-4-piperidineacetaldehyde (68 mg, 0.299 mmol) in MeOH (2 ml) was added ZnCl (0.600 ml, 0.300 mmol) (0.5 M) in THF at RT, and the RM was stirred at RT under argon for 6 h. Then, NaBHCN (18 mg, 0.286 mmol) was added. The RM was stirred at RT overnight and then concentrated under reduced pressure to afford 198 mg of the title compound.

[0786] LC-MS (Method A): Rt=0.96 min, [M+H] + =798.6.

[0787] Step 2: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-((1-(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0788] A solution of tert-butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate (step 1) (198 mg, 0.248 mmol) and HCl in dioxane (1.5 ml, 6.00 mmol) (4 M) in MeOH (1.5 ml) was stirred at RT for 3 h. The RM was then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 235 mg of the title compound as a yellow solid as a TFA salt.

[0789] LC-MS (Method A): Rt=0.70 min, [M+H] + =698.6.

[0790] Step 3:(3R,4S)-N-(3-(6-(4-((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0791] To a stirred solution of 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (76 mg, 0.289 mmol) in DMF (1 ml) was added NMM (0.050 ml, 0.455 mmol) followed by HATU (110 mg, 0.289 mmol). The resulting RM was stirred at RT for 30 min. Then, a solution of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-((1-(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 2) (235 mg, 0.241 mmol) and NMM (0.050 ml, 0.455 mmol) in DMF (0.5 ml) was added dropwise to the mixture and the yellow RM was stirred at RT for 3 h. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% NH4HCO3) to provide 125 mg of the title compound.

[0792] LC-MS (Method B): Rt=3.77 min, [M / 2+H] + =473.2.

[0793] 1H NMR(400MHz,DMSO-d6)δppm 12.62(br s,1H),10.33(br s,1H),8.80(br s,1H),7.78-8.00(m,2H),7.59-7.74(m,1H),7.44-7.54(m,1H),7.25-7.41(m,2H),6.94-7.20(m,4H),6.65(br s,1H),4.98-5.28(m,1H),4.38-4.53(m,1H),3.77-3.92(m,4H),3.56-3.71(m,4H),3.08-3.20(m,2 H),2.61-2.90(m,6H),1.84-2.36(m,12H),1.35-1.70(m,8H),1.01-1.28(m,4H)0.79-0.98(m,6H).

[0794] Compound 4

[0795] (cis-rac)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0796]

[0797] Step 1:

[0798] (cis-rac)-tert-Butyl 4-((4-(4-(5-fluoro-3-(3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidine-1-carboxylate

[0799] To a mixture of tert-butyl 4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidine-1-carboxylate (Intermediate 15) (150 mg, 0.339 mmol), (cis-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 9) (157 mg, 0.373 mmol) and NaCO (0.339 ml, 0.677 mmol) (2M) in water in 1-propanol (20 ml) was added PdCl(PPh) (11.88 mg, 0.017 mmol). The resulting RM was irradiated in a microwave at 140° C. for 15 min. It was then concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-100% EtOAc in CHX) to provide 94 mg of the title compound.

[0800] LC-MS (Method A): Rt=1.25 min, [M+H] + =701.5.

[0801] Step 2: (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-((piperidin-4-yloxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0802] A yellow solution of (cis-rac)-tert-butyl 4-((4-(4-(5-fluoro-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidine-1-carboxylate (step 1) (94 mg, 0.134 mmol) and TFA (0.310 ml, 4.02 mmol) in DCM (3 ml) was stirred at RT under argon for 1 h. It was then concentrated under reduced pressure to provide 143 mg of the title compound as a TFA salt.

[0803] LC-MS (Method A): Rt=0.78 min, [M+H] + =601.6.

[0804] Step 3:

[0805] (cis-rac)-tert-Butyl 4-(2-(4-((4-(4-(5-fluoro-3-(3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate

[0806] To a brown solution of (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-((piperidin-4-yloxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 2) (143 mg, 0.173 mmol), tert-butyl 4-(2-oxoethyl)piperidine-1-carboxylate (43.1 mg, 0.190 mmol) and TEA (0.072 ml, 0.518 mmol) in MeOH (4 ml) was added ZnCl (0.380 ml, 0.190 mmol) (0.5 M) in THF. The resulting RM was stirred at RT for 3 h. NaBHCN (11.93 mg, 0.190 mmol) was then added and the RM was stirred at RT under argon overnight. The resulting solution was diluted with DCM and washed with water and brine. The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The crude compound was purified by flash silica gel chromatography (eluting with 0-20% MeOH in DCM) to provide 83 mg of the title compound.

[0807] LC-MS (Method A): Rt=0.99 min, [M+H] + =812.8.

[0808] Step 4: (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(((1-(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0809] A yellow solution of (cis-rac)-tert-butyl 4-(2-(4-((4-(4-(5-fluoro-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate (step 3) (83 mg, 0.102 mmol) and TFA (0.236 ml, 3.07 mmol) in DCM (3 ml) was stirred at RT under argon for 1 h. It was then concentrated under reduced pressure to provide 142 mg of the title compound as a TFA salt.

[0810] LC-MS (Method A): Rt=0.71 min, [M+H] + =712.4.

[0811] Step 5: (cis-rac)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0812] To a brown solution of (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(((1-(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 4) (142 mg, 0.103 mmol), 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (29.9 mg, 0.113 mmol) and HBTU (46.8 mg, 0.123 mmol) in DMF (3 ml) was added DIPEA (0.108 ml, 0.616 mmol). The resulting RM was stirred at RT under argon for 2 h. Then poured into water. The white suspension gained is filtered, washed with water and dried under reduced pressure, to provide 100mg of crude material.By reversed-phase HPLC (column: XBridge C18, 250x 50mm, 5um; flow rate: 100ml / min; eluting with 38%-58% ACN in (water+0.1%NH4OH)) purification material, 28.5mg of title compound is provided.

[0813] LC-MS (Method B): Rt=3.85 min, [M+H] + =959.5.

[0814] 1H NMR (400MHz, DMSO-d6) δppm 12.77(br s,1H),10.35(s,1H),8.85(s,1H),7.96(br d,J=7.80Hz,2H),7.66(s,1H),7.51(m,1H),7.43(br d,J=7.90Hz,2H),7.37(br d,J=8.40Hz,1H),7.33(s,1H),7.16(d,J=8.31Hz,1H),7.07(br d,J=8.60Hz,1H),6.80(s,1H),4.84-4.99(m,1H),4.55(s,2H),4.07-4.16(m,1H),3.85(s,3H),3.61(m,3H),3.4 3-3.52(m,3H),3.05-3.14(m,1H),2.55-2.92(m,6H),2.21-2.40(m,3H),2.13-2.21(m,1H),2.11(s,3H),2.03(br t,J=9.11Hz,2H),1.88(m,2H),1.04-1.75(m,13H),0.92(br d,J=6.48Hz,6H).

[0815] Compound 5

[0816] trans-rac-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0817]

[0818] Step 1: trans-rac-benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate

[0819] In a 31 round-bottom flask, benzyl 6-oxa-3-azabicyclo [3.1.0] hexane-3-formate (CAS 31865-25-5) (43.5g, 148.1mmol) and cuprous bromide dimethylsulfane complex (14g, 68.4mmol) are suspended in THF (1000ml). Under N2, the solution is cooled to -30°C, then isobutylmagnesium bromide (913ml, 1820mmol) (2M) in THF is added dropwise over 90min. After addition, the reaction is slowly warmed to -15°C over 45min, and the mixture is stirred at -15°C for 2h. Then, the reaction is quenched by HCl 2M (1000ml) at 0°C, and the mixture is stirred at RT for 30min. The layers are then separated, and the aqueous layer is extracted with EtOAc (3x 200ml), dried over Na2SO4, filtered and concentrated. The crude mixture was purified by silica gel chromatography (eluting with 0-20% EtOAc in petroleum ether) to provide 108 g of the title compound as a yellow oil.

[0820] LC-MS (Method F): Rt=1.51 min, [M+H] + =278.

[0821] Step 2: trans-rac-4-isobutylpyrrolidin-3-ol

[0822] In a 250 ml round-bottom flask, a mixture of trans-rac-benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate (step 1) (1 g, 3.6 mmol) and 10% palladium on carbon (100 mg) in MeOH (40 ml) was stirred under H at RT for 16 h. The mixture was filtered and the filtrate was concentrated to provide 510 mg of the title compound as a yellow oil.

[0823] LC-MS (Method E): Rt=1.05 min, [M+H] + =144.

[0824] Step 3: trans-rac-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0825] A mixture of 5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (commercially available; or can be prepared according to published patent application WO 2013 / 008095, page 37, intermediate 5) (853 mg, 3.4 mmol) and DIPEA (2.2 g, 17 mmol) in THF (40 ml) was stirred at 0 ° C for 15 min. Then, triphosgene (480 mg, 1.63 mmol) was added, and the mixture was stirred at 0 ° C for 2 h. Then, trans-rac-4-isobutylpyrrolidin-3-ol (step 2) (486 mg, 3.4 mmol) was added. After the addition, the mixture was stirred at RT for 16 h. To the resulting mixture, MeOH (10 ml) was added. After concentration, the crude mixture was purified by silica gel chromatography (eluting with 0-5% MeOH in DCM) to provide 1.0 g of the title compound.

[0826] LC-MS (Method J): Rt=1.46 min, [M+H] + =421.

[0827] Step 4: trans-rac-N-(5-fluoro-3-(6-(4-formylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0828] In a 50 ml round-bottom flask, trans-rac-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 3) (420 mg, 1 mmol), 4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde (410 mg, 1.05 mmol) (Intermediate 3b), Na2CO3 (280 mg, 2.6 mmol) and PdCl2(dppf) (110 mg, 0.15 mmol) were suspended in ACN (12 ml) and water (3 ml). The mixture was stirred at 100° C. under N2 for 16 h and then concentrated under reduced pressure. The crude mixture was purified by reverse phase flash chromatography on an Agela C18 column, eluting with 5% to 90% ACN in water (10 mM NH4HCO3) to provide 400 mg of the title compound.

[0829] LC-MS (Method E): Rt=2.07 min, [M+H] + =656.

[0830] Step 5: trans-rac-tert-Butyl 9-(4-(4-(5-fluoro-3-(3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0831] In a 50 ml flask, trans-rac-N-(5-fluoro-3-(6-(4-formylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (400 mg, 0.61 mmol), tert-butyl 3,9-diazaspiro[5.5]undecane-3-carboxylate (CAS 173405-78-2) (186 mg, 0.73 mmol) and KCO (166 mg, 1.2 mmol) were suspended in DMSO (3 ml). After stirring at RT for 15 min, a solution of ZnCl 1 M in THF (0.78 ml, 0.78 mmol) was added and the mixture was stirred at RT for 3 h. Then, add NaBH3CN (300mg, 5mmol) and MeOH (3ml), and the mixture is stirred 16h under RT, then filtered.By reversed-phase flash chromatography (on Agela C18 post, eluting with 5%-80% ACN in water (10mM NH4HCO3)) filtrate purification, provide 200mg of title compound.

[0832] LC-MS (Method F): Rt=1.61 min, [M+H] + =894

[0833] Step 6: trans-rac-tert-Butyl 9-(4-(4-(5-fluoro-3-(3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0834] In a 25 ml round-bottom flask, tert-butyl trans-rac-9-(4-(4-(5-fluoro-3-(3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (step 5) (200 mg, 0.22 mmol) was suspended in DMSO (3 ml) and water (1 ml). The mixture was stirred at RT for 15 min, and then the mixture was cooled to 0° C. A solution of NaOH (35 mg, 0.88 mmol) in water (1 ml) was added, and the mixture was stirred at 0° C. for 30 min. The mixture was warmed to RT and stirred at RT for 16 h. The crude mixture was purified by reverse phase flash chromatography on an Agela C18 column, eluting with 5%-90% ACN in water (10 mM NH4HCO3) to provide 100 mg of the title compound as a yellow solid.

[0835] LC-MS (Method F): Rt=1.48 min, [M+H] + =754

[0836] Step 7: trans-rac-N-(3-(6-(4-(3,9-diazaspiro[5.5]undec-3-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0837] In a 50 ml round-bottom flask, trans-rac-tert-butyl 9-(4-(4-(5-fluoro-3-(-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (110 mg, 0.15 mmol) was suspended in DCM (5 ml). A 4M solution of HCl in dioxane (4 ml, 16 mmol) was added and the RM was stirred at RT for 3 h. The resulting mixture was concentrated and dried to provide 120 mg of the title compound as a grey solid hydrochloride salt.

[0838] LC-MS (Method E): Rt=1.74 min, [M+H] + =654

[0839] Step 8:trans-rac-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0840] In a 25 ml round-bottom flask, trans-rac-N-(3-(6-(4-(3,9-diazaspiro[5.5]undec-3-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (120 mg, 0.146 mmol), 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (47 mg, 0.18 mmol) and DIPEA (78 mg, 0.6 mmol) were suspended in DMF (3 ml). HATU (68 mg, 0.18 mmol) was then added and the mixture was stirred at RT for 16 h. The RM was purified by reverse phase HPLC on an XBridge C18 column (21.2 x 250 mm, 10 μm) eluting with ACN and water (containing 0.01 M NH 4 HCO 3 buffer) to provide 65 mg of the title compound as a white solid.

[0841] LC-MS (Method E): Rt=1.73 min, [M / 2+H] + =450.7.

[0842] 1H NMR (500MHz, DMSO-d6) δ12.73(s,1H),10.34(s,1H),8.83(s,1H),7.92(d,J=8.2Hz,2H),7.68(s,1H),7.49(dd,J=10.8,2.7Hz,1H),7. 37(td,J=11.0,4.9Hz,3H),7.32(d,J=2.1Hz,1H),7.15(d,J=8.7Hz,1H),7.06(dd,J=8.8,2.8Hz,1H),6.76(d,J=2.8Hz,1H),5.12(d,J =4.5Hz,1H),3.88-3.84(m,4H),3.68-3.64(m,2H),3.60-3.30(m,7H),3.20-3.17(m,1H),3.09-3.06(m,1H),2.67(t,J=6.4Hz,2H),2. 36(s,4H),2.15-2.00(m,4H),1.67-1.60(m,1H),1.50-1.34(m,10H),1.16-1.07(m,1H),0.91(d,J=6.6Hz,3H),0.89(d,J=6.6Hz,3H).

[0843] Compound 6

[0844] (3R,4S)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0845]

[0846] Step 1 :(3R,4S)-N-(5-fluoro-3-(6-(4-formylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0847] To a 50 ml round-bottom flask purged with N2 and maintained under an inert atmosphere was added (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 7) (420 mg, 1 mmol), 4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde (Intermediate 3b) (410 mg, 1.05 mmol), Na2CO3 (280 mg, 2.6 mmol) and PdCl2(dppf) (110 mg, 0.15 mmol). Then, ACN (12 ml) and water (3 ml) were added, and the RM was stirred at 100°C under N2 for 2 h. The crude mixture was purified by silica gel chromatography (eluting with 3%-6% MeOH in DCM) to provide 500 mg of the title compound as a yellow solid.

[0848] LC-MS (Method E): Rt=1.99 min, [M+H] + =656;

[0849] Step 2 : tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0850] To a 50 ml round-bottom flask was added (3R,4S)-N-(5-fluoro-3-(6-(4-formylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (500 mg, 0.76 mmol), tert-butyl 3,9-diazaspiro[5.5]undecane-3-carboxylate (CAS 173405-78-2], 1 Click Chemistry, Inc.) (234 mg, 0.92 mmol), KCO (207 mg, 1.5 mmol) and DMSO (3 ml). The RM was stirred at RT for 15 min before the addition of ZnCl (0.99 ml, 0.99 mmol) (1 M) in THF. Then, RM was stirred at RT for 3h, and NaBH was added CN (378mg, 6.0mmol) in MeOH (3ml). After addition, RM was stirred at RT for 16h, then filtered. The filtrate was purified by reverse phase flash chromatography (on Agela C18 posts, with ACN water (0.01M NH4HCO3 buffer) gradient elution), providing 400mg of the title compound as a yellow solid.

[0851] LC-MS (Method F): Rt=1.50 min, [M+H] + =894.

[0852] Step 3 : tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0853] To a 50 ml round-bottom flask was added tert-butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (400 mg, 0.45 mmol) (step 2) and DMSO (2 ml). Then, a solution of NaOH (72 mg, 1.79 mmol) in water (1 ml) was added and the RM was stirred at RT for 3 h. The RM was then poured into water (10 ml) and extracted with EtOAc (4 x 10 ml). The combined organic layers were then dried to obtain a crude mixture. The crude mixture was purified by silica gel chromatography (eluting with 3%-6% MeOH in DCM) to provide 160 mg of the title compound as a yellow solid.

[0854] LC-MS (Method F): Rt=1.34 min, [M+H] + =754

[0855] Step 4 :(3R,4S)-N-(3-(6-(4-((3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0856] To a 50 ml round-bottom flask was added tert-butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (160 mg, 0.21 mmol) and DCM (6 ml). The RM was stirred at RT and a solution of 4M HCl in dioxane (5 ml, 20 mmol) was added. The RM was stirred at RT for 2 h then concentrated to afford 92 mg of the title compound as a yellow solid as the hydrochloride salt.

[0857] LC-MS (Method F): Rt=1.02 min, [M+H] + =654.

[0858] Step 5 :(3R,4S)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0859] To a 50 ml round-bottom flask was added (3R,4S)-N-(3-(6-(4-((3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (92 mg, 0.14 mmol), 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (45 mg, 0.17 mmol), DIPEA (91 mg, 0.71 mmol) and DMF (3 ml). HATU (65 mg, 0.17 mmol) was then added at RT and the RM was stirred at RT for 16 h. The RM was purified by reverse phase HPLC on an XBridge C18 column (21.2 x 250 mm, 10 μm) eluting with an ACN / water (containing 0.01 M NH 4 HCO 3 buffer) gradient to provide 40 mg of the title compound as a white solid.

[0860] LC-MS (Method F): Rt=1.19 min, [M+H] + =900.

[0861] 1 H NMR (500MHz, DMSO-d6) δ12.69(s,1H),10.33(s,1H),8.80(s,1H),7.92(d,J=8.2Hz,2H),7.67(s,1H),7.49(dd,J=10.7,2.6Hz,1H),7.37 -7.35(m,3H),7.31(d,J=2.1Hz,1H),7.14(d,J=8.7Hz,1H),7.05(dd,J=8.9,2.8Hz,1H) ,6.73(s,1H),5.12(s,1H),3.89-3.84(m,4H),3.71-3.41(m,9H),3.20-3.17(m,1H),3. 09-3.06(m,1H),2.67(t,J=6.0Hz,2H),2.36(s,4H),2.09-2.04(m,4H),1.65-1.60(m,1 H), 1.50-1.32 (m, 10H), 1.16-1.08 (m, 1H), 0.91 (d, J = 6.6Hz, 3H), 0.89 (d, J = 6.6Hz, 3H).

[0862] Compound 7

[0863] (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0864]

[0865] Step 1: (3S,4S)-tert-Butyl 3-isobutyl-4-((4-nitrobenzoyl)oxy)pyrrolidine-1-carboxylate and (3R,4R)-tert-Butyl 3-isobutyl-4-((4-nitrobenzoyl)oxy)pyrrolidine-1-carboxylate

[0866] Under N , at RT, over 30min, to (trans-racemic)-tert-butyl 3-hydroxy-4-isobutyl pyrrolidine-1-formate (intermediate 6) (9.65g, 39.7mmol), 4-nitrobenzoic acid (11g, 65.2mmol) and PPh (18g, 65.2mmol) in THF (250ml) solution, DIAD (13ml, 65.5mmol) is added dropwise. The yellow solution of gained is slowly warmed to RT for another 3 hours. The RM is quenched with water, and the THF is partially evaporated. EtOAc is added and each layer is separated. The water layer is extracted with EtOAc (3x), the organic layer merged is washed with 0.2M HCl and salt water, through Na sO , dried, filtered and concentrated under reduced pressure to provide 50.2g of crude product. One-quarter of the crude product was purified by flash silica gel chromatography (eluting with 0-40% EtOAc in hexanes) to provide 4.28 g of product 1. The remaining 3 / 4 of the crude product was purified by flash silica gel chromatography (eluting with 0-13% EtOAc in hexanes) to provide 3.98 g of product 2 and 6.57 g of product 3. Product 2 was purified by flash silica gel chromatography (eluting with 0-25% EtOAc in hexanes) to provide 2.56 g of product 4. Product 3 was purified by flash silica gel chromatography (eluting with 0-15% EtOAc in hexanes) to provide 5.97 g of product 5. Products 1, 4, and 5 were combined to provide 12.44 g of the racemate.

[0867] Chiral separation of the racemates using SFC (Preparative Method 2) provided the individual enantiomers. Following separation, each single enantiomer was analyzed by chiral HPLC (Method L) to confirm chiral purity.

[0868] (3S,4S)-tert-Butyl 3-isobutyl-4-((4-nitrobenzoyl)oxy)pyrrolidine-1-carboxylate: 6.01 g

[0869] First elution peak (peak 1)

[0870] HPLC Rt (Method L) = 5.99 min.

[0871] 1 H NMR(600MHz,DMSO-d6)δppm 0.79-0.92(m,6H)1.29-1.35(m,1H)1.40(d,J=19.44Hz,10H)1.46-1.60(m,1H)2.52-2.59(m,1H)3.04-3.16(m ,1H)3.42-3.51(m,1H)3.58-3.70(m,2H)5.47(t,J=3.85Hz,1H)8.22(dd,J=8.80,3.30Hz,2H)8.31-8.42(m,2H)

[0872] (3R,4R)-tert-Butyl 3-isobutyl-4-((4-nitrobenzoyl)oxy)pyrrolidine-1-carboxylate: 6.09 g of the second eluting peak (Peak 2)

[0873] HPLC Rt (Method L) = 9.06 min.

[0874] 1 H NMR(600MHz,DMSO-d6)δppm 0.79-0.95(m,6H)1.28-1.36(m,1H)1.40(d,J=19.44Hz,10H)1.48-1.57(m,1H)2.52-2.59(m,1H)3.06-3.15(m ,1H)3.44-3.49(m,1H)3.60-3.70(m,2H)5.47(t,J=3.94Hz,1H)8.22(dd,J=8.80,3.30Hz,2H)8.30-8.46(m,2H)

[0875] Step 2: (3S,4S)-tert-Butyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate and (3R,4R)-tert-Butyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate

[0876] To a solution of (3S,4S)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl)oxy)pyrrolidine-1-carboxylate (first eluting peak from step 1) (5.8 g, 14.78 mmol) in MeOH (20 ml) was added NaOH (14.78 ml, 29.6 mmol). The RM was stirred at RT for 30 min and then poured into a mixture of EtOAc and water. The layers were separated and the organic layer was washed with water (2x) and brine (1x), dried over Na2SO4, filtered and concentrated under reduced pressure to provide 3.331 g of the title compound (3S,4S)-tert-butyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate.

[0877] 1 H NMR(600MHz,DMSO-d6)δppm 0.83-0.91(m,6H)1.17-1.23(m,1H)1.39(m,10H)1.49-1.58(m,1H)2.00-2.11(m,1H)2.79-2. 92(m,1H)3.19-3.24(m,1H)3.26-3.32(m,1H)3.33(m,J=5.00Hz,1H)3.98-4.02(m,1H)4.81(br s,1H).

[0878] To a solution of (3R,4R)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl)oxy)pyrrolidine-1-carboxylate (the second eluting peak from step 1) (5.8 g, 14.78 mmol) and MeOH (20 ml) was added NaOH (14.78 ml, 29.6 mmol). The RM was stirred at RT for 1 h and then poured into a mixture of EtOAc and water. The layers were separated and the organic layer was washed with water (2x), 10% aqueous citric acid (1x), and brine (1x), dried over Na2SO4, filtered, and concentrated under reduced pressure to provide 2.995 g of the title compound (3R,4R)-tert-butyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate.

[0879] 1 H NMR(600MHz,DMSO-d6)δppm 0.85-0.90(m,6H)1.18-1.23(m,1H)1.39(m,10H)1.49-1.57(m,1H)2.00-2.10(m,1H)2.81-2.91 (m,1H)3.19-3.24(m,1H)3.25-3.31(m,1H)3.31-3.34(m,1H)4.01(m,1H)4.81(t,J=3.30Hz,1H).

[0880] Step 3:(3R,4R)-4-Isobutylpyrrolidin-3-ol

[0881] To a solution of (3R, 4R)-tert-butyl 3-hydroxy-4-isobutyl pyrrolidine-1-formate (2.99 g, 12.29 mmol) in DCM (7 ml) is added HCl (20 ml, 80 mmol) (4 M) in dioxane. The resulting solution is stirred for 1 h at RT. The RM is then concentrated to an orange slurry, then diluted with Et o, stirred and cooled for 15 min. The precipitate formed is filtered, washed with Et o and dried under reduced pressure to provide 1.909 g of the title compound, which is white crystals as the HCl salt.

[0882] 1 H NMR(600MHz,DMSO-d6)δppm 0.88(dd,J=6.60,2.57Hz,6H)1.14-1.28(m,1H)1.34-1.45(m,1H)1.51-1.66(m,1H)2.07(dqd,J=11.55,7.61,7.61,7.61,3.76 Hz,1H)2.74(t,J=11.37Hz,1H)3.06(d,J=12.10Hz,1H)3.16-3.28(m,2H)4.16(q,J=3.48Hz,1H)5.35(d,J=3.85Hz,1H)9.33(br s,2H).

[0883] Step 4: (3R,4R)-N-(5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0884] To a stirred solution of 5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (commercial; or prepared according to the procedure described in published patent application WO 2013 / 008095, page 37, intermediate 5) (1.2 g, 4.78 mmol) and DIPEA (3.34 ml, 19.12 mmol) in DCM (25 ml) was slowly added phosgene 20% in toluene (3.02 ml, 5.73 mmol) under argon below 0°C. The resulting solution was stirred at 0°C for 10 min and then added dropwise to a stirred solution of (3R,4R)-4-isobutylpyrrolidin-3-ol (step 3) (0.945 g, 5.26 mmol) in DCM (25 ml) at 0°C. The resulting mixture was stirred at 0°C for 1 h. The RM was concentrated and then poured into EtOAc / MeOH (9:1), washed with water (3x) and brine (1x). The organic layer was then dried over MgSO4 and concentrated under reduced pressure to provide 2.1 g of crude product. The crude product was purified by flash silica gel chromatography (eluting with 0-100% EtOAC (+5% EtOH) in hexanes) to provide 1.46 g of the title compound as a white foam.

[0885] LC-MS (Method A): Rt=1.21 min, [M+H] + =421.4.

[0886] Step 5: (3R,4R)-N-(5-Fluoro-3-(6-(4-(2-hydroxyethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0887] To a mixture of 2-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl)ethanol (Intermediate 17) (200 mg, 0.731 mmol), (3R,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Step 4) (307 mg, 0.731 mmol), and KCO (252 mg, 1.827 mmol) in water (3 ml) was added PdCl(dppf) (53.5 mg, 0.073 mmol) followed by dioxane (3 ml). The resulting RM was stirred at 100° C. for 30 min and cooled to RT. Purification by flash silica gel chromatography, eluting with 0-20% MeOH in DCM, provided 294 mg of the title compound.

[0888] LC-MS (Method A): Rt=0.90 min, [M+H] + =532.2.

[0889] Step 6: 4-(4-(5-Fluoro-3-((3R,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl methanesulfonate

[0890] To a mixture of (3R,4R)-N-(5-fluoro-3-(6-(4-(2-hydroxyethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 5) (294 mg, 0.553 mmol) and TEA (0.385 ml, 2.77 mmol) in THF (3 ml) (cooled at 0 ° C) was added Ms O (193 mg, 1.106 mmol). The RM was stirred at 0 ° C for 30 min, and the solution was then quenched with water at 0 ° C. The layers were separated, and the aqueous layer was extracted with DCM (2x). The combined organic layers were dried over MgSO , filtered and evaporated at RT to provide 343 mg of the title compound as a yellow solid.

[0891] LC-MS (Method A): Rt=0.97 min, [M+H] + =610.3.

[0892] Step 7: Tert-butyl 9-(4-(4-(5-fluoro-3-((3R,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[0893] To a solution of 4-(4-(5-fluoro-3-((3R,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl methanesulfonate (step 6) (150 mg, 0.246 mmol), tert-butyl 3,9-diazaspiro[5.5]undecane-3-carboxylate (188 mg, 0.738 mmol) and KCO (204 mg, 1.476 mmol) in DMF (1.5 ml) was added ACN (6 ml) at RT. The resulting RM was stirred at 60 °C overnight and then cooled to RT. The yellow suspension was filtered and the filtrate was then diluted with DCM / MeOH and filtered through a pad of silica. The filtrate was concentrated under reduced pressure to afford 257 mg of the title compound.

[0894] LC-MS (Method A): Rt=0.98 min, [M+H] + =768.5.

[0895] Step 8: (3R,4R)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0896] An orange solution of tert-butyl 9-(4-(4-(5-fluoro-3-((3R,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (Step 7) (189 mg, 0.246 mmol) and TFA (0.569 ml, 7.38 mmol) in DCM (5 ml) was stirred at RT for 2 h and then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 10%-100% ACN in (water + 0.1% TFA) to provide 87.3 mg of the title compound as a TFA salt.

[0897] LC-MS (Method A): Rt=0.68 min, [M+H] + =668.5.

[0898] Step 9: (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0899] To a mixture of (3R,4R)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 8) (87.3 mg, 0.086 mmol) and intermediate 1a (25.1 mg, 0.095 mmol) in DMF (3 ml) was added DIPEA (0.091 ml, 0.519 mmol) and HBTU (49.2 mg, 0.130 mmol). The resulting RM was stirred at RT under argon for 2 h, then poured into water, and the resulting precipitate was filtered and dried under reduced pressure to give the crude product. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column (eluted with 10%-100% ACN in water + 0.1% TFA) to provide the title compound as a TFA salt. The title compound as a TFA salt was then dissolved in MeOH, filtered on an SCX column, and released from the SCX column with ammonia 7N in MeOH. The filtrate was then concentrated under reduced pressure to provide 47.3 mg of the title compound.

[0900] LC-MS (Method B): Rt=3.68 min, [M+H] + =914.8.

[0901] 1H NMR(400MHz,DMSO-d6)δppm 12.69(s,1H),10.33(s,1H),8.82(s,1H),7.88(brd,J=7.92Hz,2H),7.63(s,1H),7.49(dd,J=10.78,2.57Hz,1H),7.37( dd,J=8.51,1.91Hz,1H),7.27-7.34(m,3H),7.15(d,J=8.66Hz,1H),7.05(dd,J=8.80,2.64Hz,1H),6.74(s,1H),4.88(br d,J=3.37Hz,1H),4.06-4.15(m,1H),3.84(s,3H),3.35-3.65(m,9H),3.08(br t,J=8.88Hz,1H),2.71-2.82(m,2H),2.68(m,2H),2.52-2.61(m,2H),2.34-2.47(m,4H),2.12-2.21( m,1H),2.09(s,3H),1.56-1.63(m,1H),1.34-1.56(m,9H),1.21-1.30(m,1H),0.90(d,J=6.02Hz,6H).

[0902] Compound 8

[0903] (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0904]

[0905] The title compound was prepared by a method analogous to compound 6 using compound 6, step 1 and intermediates 18 and 1b.

[0906] LC-MS (Method I): Rt=1.72 min, [M+H] + =930.

[0907] Compound 9

[0908] (cis-rac)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0909]

[0910] Step 1:

[0911] (cis-rac)-tert-Butyl 4-(4-(4-(5-fluoro-3-(3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate

[0912] To a mixture of 1-Boc-piperazine (77 mg, 0.413 mmol) (CAS 57260-71-6), TEA (0.100 ml, 0.717 mmol) and (cis-rac)-N-(5-fluoro-3-(6-(4-formylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (214 mg, 0.345 mmol) (Intermediate 10) in MeOH (3 ml) was added ZnCl (0.500 ml, 0.350 mmol) (0.7 M) in THF at RT. The resulting cloudy green solution was stirred overnight at RT, then NaBHCN (22 mg, 0.350 mmol) was added, and the RM was further stirred for 5 h at RT. The RM was then concentrated under reduced pressure. By reverse phase flash chromatography ( The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 99 mg of the title compound as a TFA salt.

[0913] LC-MS (Method A): Rt=0.91 min, [M+H] + =686.5

[0914] Step 2: (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(piperazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0915] A solution of (cis-rac) tert-butyl 4-(4-(4-(5-fluoro-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate (step 1) (99 mg, 0.072 mmol) and HCl in dioxane (0.5 ml, 2.00 mmol) (4 M) in MeOH (2 ml) was stirred at RT for 3 h. The RM was then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 61.5 mg of the title compound as a TFA salt.

[0916] LC-MS (Method A): Rt=0.73 min, [M+H] + =586.6.

[0917] Step 3:

[0918] (cis-rac)-tert-Butyl 4-((4-(4-(4-(5-fluoro-3-(3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazin-1-yl)methyl)piperidine-1-carboxylate

[0919] To a mixture of (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(piperazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 2) (59 mg, 0.069 mmol), TEA (0.050 ml, 0.359 mmol) and 1-Boc-piperidine-pyrrolecarboxaldehyde (17 mg, 0.080 mmol) in MeOH (1 ml) was added ZnCl (0.120 ml, 0.084 mmol) (0.7 M) in THF at RT. The RM was stirred at RT under argon for 6 h. Then, NaBHCN (6 mg, 0.095 mmol) was added and the RM was stirred at RT overnight. The RM was concentrated under reduced pressure to afford 53.9 mg of the title compound.

[0920] LC-MS (Method A): Rt=0.92 min, [M+H] + =783.7.

[0921] Step 4:(cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-((4-(piperidin-4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0922] A yellow solution of (cis-rac)-tert-butyl 4-((4-(4-(4-(5-fluoro-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazin-1-yl)methyl)piperidine-1-carboxylate (step 3) (0.069 mmol) and HCl in dioxane (0.5 ml, 2.00 mmol) (4 M) in MeOH (1 ml) was stirred at RT for 2 h. The RM was concentrated under reduced pressure to afford the title compound as an HCl salt.

[0923] LC-MS (Method A): Rt=0.66 min, [M+H]+=683.7.

[0924] Step 5: (cis-rac)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0925] To a solution of intermediate 1a (27 mg, 0.104 mmol) in DMF (0.5 ml) was added NMM (0.025 ml, 0.227 mmol) followed by HATU (39 mg, 0.104 mmol). The RM was stirred at RT for 30 min. A solution of (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-((4-(piperidin-4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 4) (52 mg, 0.069 mmol) and NMM (0.025 ml, 0.227 mmol) in DMF (0.5 ml) was then added dropwise to the RM and the resulting yellow mixture was stirred at RT for 2 days. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2% to 100% ACN in (water + 0.1% NH4HCO3) to provide 38 mg of the title compound as a white powder.

[0926] LC-MS (Method B): Rt=3.68 min, [M / 2+H] + =465.4.

[0927] 1 H NMR(400MHz,DMSO-d6)δppm 12.72(s,1H);10.32(s,1H),8.83(s,1H),7.92(d,J=7.95Hz,2H),7.64(s,1H),7.46-7.52(m,1H),7.28-7.41(m,4H),7.14 (d,J=8.44Hz,1H),7.05(dd,J=8.93,2.32Hz,1H),6.76(s,1H),4.95-4.85(m,1H),4.15-4.05(m,1H),3.84(s,3H),3.65-3. 55(m,3H),3.38-3.54(m,4H)3.15-3.05(m,1H),2.70-2.60(m,2H),2.35-2.48(m,12H),2.20-2.11(m,3H),2.06-2.11(m,3H),1.64-1.81(m,2H),1.56-1.63(m,1H),1.48-1.40(m,1H),1.22-1.30(m,1H),1.00-1.15(m,3H),0.95-0.85(m,6H)Compound 10

[0928] (3S,4R)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0929]

[0930] Step 1: tert-Butyl 4-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate

[0931] To a mixture of tert-butyl 4-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate (Intermediate 5) (500 mg, 1.110 mmol), KCO (384 mg, 2.78 mmol) and (3S,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 8) (500 mg, 1.13 mmol) in dioxane / water 1:1 (10 ml) (degassed with argon) was added PdCl(dppf)-DCM adduct (91 mg, 0.111 mmol). The RM was stirred at 100° C. for 2 h, then cooled to RT and partitioned between EtOAc and water. The two layers were separated and the organic layer was washed with brine, dried over MgSO 4 and concentrated under reduced pressure.The crude product was purified by flash silica gel chromatography (eluting with 0-17% MeOH in DCM) to provide 692 mg of the title compound as a brown residue.

[0932] LC-MS (Method A): Rt=0.86 min, [M+H] + =686.5.

[0933] Step 2: (3S,4R)-N-(5-Fluoro-2-methyl-3-(6-(4-(piperazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0934] A brown solution of tert-butyl 4-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate (step 1) (692 mg, 0.807 mmol) and HCl in dioxane (2 ml, 8.00 mmol) (4 M) in MeOH (2 ml) was stirred at RT for 2 h, then the RM was concentrated under reduced pressure. The residue was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 570 mg of the title compound as a TFA salt.

[0935] LC-MS (Method A): Rt=0.72 min, [M+H] + =586.5.

[0936] Step 3:tert-Butyl 4-((4-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazin-1-yl)methyl)piperidine-1-carboxylate

[0937] To a solution of (3S,4R)-N-(5-fluoro-2-methyl-3-(6-(4-(piperazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 2) (188 mg, 0.269 mmol), TEA (0.100 ml, 0.717 mmol) and 1-Boc-piperidine-pyrrolecarboxaldehyde (60 mg, 0.281 mmol) in MeOH (2 ml) was added ZnCl2 (0.550 ml, 0.275 mmol) (0.5 M) in THF at RT and the RM was stirred at RT under argon for 3 days. Then, NaBH3CN (16 mg, 0.255 mmol) was added. The RM was stirred at RT overnight and concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 223 mg of the title compound as a TFA salt.

[0938] LC-MS (Method A): Rt=0.90 min, [M+H] + =783.5.

[0939] Step 4: (3S,4R)-N-(5-Fluoro-2-methyl-3-(6-(4-((4-(piperidin-4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0940] A yellow solution of tert-butyl 4-((4-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazin-1-yl)methyl)piperidine-1-carboxylate (step 3) (0.246 mmol) and HCl in dioxane (1.5 ml, 6.00 mmol) (4 M) in MeOH (2 ml) was stirred at RT for 2 h. The RM was concentrated under reduced pressure to afford 100 mg of the title compound as the HCl salt.

[0941] LC-MS (Method A): Rt=0.63 min, [M+H]+ =683.6.

[0942] Step 5: (3S,4R)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0943] To a solution of 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (40 mg, 0.151 mmol) in DMF (1 ml) was added NMM (0.050 ml, 0.455 mmol) followed by HATU (59 mg, 0.155 mmol). The resulting RM was stirred at RT for 30 min, then a solution of (3S,4R)-N-(5-fluoro-2-methyl-3-(6-(4-((4-(piperidin-4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 4) (100 mg, 0.131 mmol) and NMM (0.050 ml, 0.455 mmol) in DMF (0.5 ml) was added dropwise to the mixture, and the yellow RM was stirred at RT for 2 h, then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% NH4HCO3) to provide, after evaporation of the ACN, a yellow suspension which was then filtered and dried under reduced pressure to yield 70 mg of the title compound as a solid.

[0944] LC-MS (Method B): Rt=3.55 min, [M / 2+H] + =465.6.

[0945] 1H NMR (400MHz, DMSO-d6) δ13.95(s,1H),10.32(s,1H),9.12(s,1H),8.20(d,J=7.8Hz,2 H),7.95-7.78(m,2H),7.66(d,J=10.8Hz,1H),7.55(s,1H),7.38-7.31(m,2H),7.25- 7.12(m,3H),3.95-3.65(m,10H),3.58-2.89(m,13H),2.67(m,2H),2.18-2.01(m,6H) ,1,99-1,82(m,2H),1.60(m,1H),1.40-1.27(m,1H,)1.26-1.11(m,6H),0.88(m,6H).

[0946] Compound 11

[0947] (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0948]

[0949] Step 1: tert-Butyl 4-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)piperidine-1-carboxylate

[0950] In a 500ml round-bottom flask, tert-butyl 4-hydroxypiperidine-1-carboxylate (5g, 24.88mmol) (CAS109384-19-2), 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolane-2-yl)phenol (CAS 269409-70-3) (6g, 27.36mmol) and PPh3 (9.78g, 37.31mmol) in dry THF (200ml) were stirred at 0°C for 5min. Then, DIAD (10g, 49.75mmol) was added dropwise at 0°C and stirred for 3h. The RM was then concentrated. The residue was purified by flash silica gel chromatography (eluting with 20% EtOAc in petroleum ether) to provide 3g of the title compound as a white solid.

[0951] LC-MS (Method J): Rt=1.73 min, [M+NH4] + =404.

[0952] Step 2: tert-Butyl 4-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carboxylate

[0953] To a 100 ml round-bottom flask purged and maintained under an inert atmosphere were added 4-chloro-6-iodo-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine (Intermediate 2) (400 mg, 0.954 mmol), tert-butyl 4-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)piperidine-1-carboxylate (CAS 889865-34-3) (385 mg, 0.954 mmol), KCO (289 mg, 2.1 mmol) and PdCl(PPh) (70 mg, 0.0954 mmol). ACN (12 ml) and H0 (3 ml) were then added and the mixture was stirred at 100° C. for 2 h. The mixture was filtered and the filtrate was concentrated. The residue was extracted with EtOAc (30 ml), the organic layer was washed with water and brine, dried over Na 2 SO 4 and concentrated under reduced pressure to provide 542 mg of the title compound.

[0954] LC-MS (Method I): Rt=2.28 min, [M+H] + =570.

[0955] Step 3: tert-Butyl 4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carboxylate

[0956] To a 100 ml round-bottom flask purged and maintained under an inert atmosphere was added tert-butyl 4-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carboxylate (542 mg, 0.954 mmol), (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (400 mg, 0.954 mmol), KCO (289 mg, 2.1 mmol), and PdCl(PPh) (70 mg, 0.0954 mmol). ACN (12 ml) and H0 (3 ml) were then added, and the mixture was stirred at 100° C. for 16 h. The mixture is filtered, and the filtrate is concentrated. Residue is extracted with EtOAc (3x 300ml) and water, salt water washing, through Na SO Drying and under reduced pressure concentrate. Purification of residue by silica gel chromatography (being eluted with the 10%MeOH in EtOAc) provides the title compound of 300mg.

[0957] LC-MS (Method I): Rt=2.02 min, [M+H] + =687.

[0958] Step 4: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-(piperidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0959] To a 100 ml round-bottom flask was added tert-butyl 4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carboxylate (300 mg, 0.437 mmol) and DCM (10 ml). A 4 M solution of HCl in dioxane (1 ml, 1 mmol) was added at 0° C., and the mixture was stirred at 0° C. for 1 h. The solvent was removed, and the residue was dried under vacuum to provide 300 mg of the title compound as a white solid as the HCl salt.

[0960] LC-MS (Method J): Rt = 1.3 min; MS m / z [M+H] + 587.

[0961] Step 5 : tert-Butyl 4-formylpiperidine-1-carboxylate

[0962] At -78 ℃, to the mixture of oxalyl chloride (5.86g, 46.51mmol) in dry DCM (40ml), add the mixture of DMSO (7.25g, 93.02mmol) in dry DCM (20ml).After stirring at -78 ℃ for 30min, add the mixture of N-Boc-4-piperidinemethanol (CAS123855-51-6) (4g, 18.6mmol) in dry DCM (40ml), and the mixture is stirred at -78 ℃ for 30min.Then, at -78 ℃, add TEA (18.77g, 186.05mmol), and RM is warmed to RT through 30min.Then, RM is extracted with DCM (2x 100ml), the organic layer merged is washed with brine (100ml), through Na2SO4 drying, filter and concentrate under reduced pressure. The crude product was purified by silica gel chromatography (eluting with 25% EtOAc in petroleum ether) to provide 3.04 g of the title compound.

[0963] LC-MS (Method J): Rt=1.21 min, [M+tBu+H] + =158.

[0964] Step 6 : tert-Butyl 4-((4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidin-1-yl)methyl)piperidine-1-carboxylate

[0965] In a 100 ml round-bottom flask, a solution of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide hydrochloride (280 mg, 0.449 mmol) in DMF (4 ml) and TEA (49 mg, 0.493 mmol) was added. After stirring at RT for 10 min, tert-butyl 4-formylpiperidine-1-carboxylate (CAS 137076-22-3) (287 mg, 1.34 mmol) and a 1 M ZnCl solution in THF (0.67 ml, 0.67 mmol) were added. The mixture is stirred to 2h at RT, then NaBH is added CN (170mg, 2.68mmol), and the mixture is stirred overnight at RT. RM is filtered, and solid DMF (10ml) is washed. By reversed-phase flash chromatography (Biotage (Biotage)) (on Agela C18 posts, eluted with 0-60% ACN in water (10mM NH4HCO3 buffer)) purifying filtrate, 210mg of the title compound in solid are provided.

[0966] LC-MS (Method G): Rt=1.39 min, [M+H] + =784.

[0967] Step 7: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-((1-(piperidin-4-ylmethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide hydrochloride

[0968] To a 100 ml round-bottom flask was added tert-butyl 4-((4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidin-1-yl)methyl)piperidine-1-carboxylate (137 mg, 0.175 mmol)) and DCM (10 ml). A 4M solution of HCl in dioxane (1 ml, 4 mmol) was added and the mixture was stirred at RT for 1 h. The mixture was concentrated under reduced pressure to provide 100 mg of the title compound as a yellow solid as the HCl salt.

[0969] LC-MS (Method I): Rt=1.67 min, [M+H] + =684.

[0970] Step 8:(3R,4S)-N-(3-(6-(4-(1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0971] In a 100 ml round-bottom flask were added (3R,4S)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide hydrochloride (100 mg, 0.137 mmol), TEA (0.54 ml, 0.27 mmol) and DMF (5 ml). Then, intermediate 1b (60 mg, 0.27 mmol) was added at 0° C. and the mixture was stirred at RT for 1 h. The mixture was purified by reverse phase HPLC on an XBridge C18 column (21.2 x 250 mm, 10 μm) eluting with a gradient of ACN and water (0.01 M NH 4 HCO 3 buffer) to provide 27 mg of the title compound as a white solid.

[0972] LC-MS (Method I): Rt=1.75 min, [M+H] + =931.

[0973] 1 H NMR (500MHz, DMSO-d6) δ12.63(m,1H),10.34(s,1H),8.8(s,1H),7.89(d,J=8.0Hz,2H),7.67(s,1H),7.4 9(dd,J1=3.0Hz,J2=8.0Hz,1H),7.37-7.31(m,2H),7.16(d,J=9.0Hz,1H),7.06-7.02(m,3H),6.65(s,1H ),5.13(m,1H),4.46(m,2H),3.88-3.84(m,4H),3.67-3.58(m,5H),3.2(m,1H),3.07(m,2H),2.69(m,5H) ,2.17(m,4H),2.08(m,4H),1.94(m,2H),1.79-1.59(m,6H),1.35(m,1H),1.15-1.05(m,3H),0.9(m,6H).

[0974] Compound 12

[0975] (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0976]

[0977] Step 1: tert-Butyl 4-((4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazin-1-yl)methyl)piperidine-1-carboxylate

[0978] To a solution of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 11) (128 mg, 0.195 mmol), TEA (0.100 ml, 0.717 mmol) and 1-Boc-piperidine-pyrrolecarboxaldehyde (50 mg, 0.234 mmol) in MeOH (2 ml) was added ZnCl2 (0.300 ml, 0.210 mmol) (0.7 M) in THF at RT and the resulting RM was stirred at RT under argon for 7 h. Then, NaBH3CN (14 mg, 0.223 mmol) was added and the RM was stirred at RT for 4 days and concentrated under reduced pressure to afford 153 mg of the title compound.

[0979] LC-MS (Method A): Rt=0.91 min, [M+H] + =783.7.

[0980] Step 2: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-((4-(piperidin-4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0981] A yellow solution of tert-butyl 4-((4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazin-1-yl)methyl)piperidine-1-carboxylate (step 1) (0.195 mmol) and HCl in dioxane (1 ml, 4.00 mmol) (4 M) in MeOH (2 ml) was stirred at RT for 2 h, then the RM was concentrated under reduced pressure. The residue was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 160 mg of the title compound as a TFA salt.

[0982] LC-MS (Method A): Rt=0.65 min, [M+H] + =683.7.

[0983] Step 3: (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0984] To a solution of 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (46 mg, 0.174 mmol) in DMF (1 ml) was added NMM (0.050 ml, 0.455 mmol) followed by HATU (67 mg, 0.176 mmol). The resulting RM was stirred at RT for 30 min, then a solution of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-((4-(piperidin-4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 2) (160 mg, 0.158 mmol) and NMM (0.050 ml, 0.455 mmol) in DMF (0.5 ml) was added dropwise to the mixture, and the yellow RM was stirred at RT for 3 h, then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2% to 100% ACN in (water + 0.1% NH4HCO3) to provide 127 mg of the title compound as a white powder.

[0985] LC-MS (Method B): Rt=3.63 min, [M / 2+H] + =465.5.

[0986] 1 H NMR (400MHz, DMSO-d6) δ12.72(s,1H),10.32(s,1H),8.83(s,1H),7.92(d,J=7.8Hz,2H),7.67(s,1H),7.49(dd,J=10.8,2.7Hz ,1H),7.45-7.27(m,4H),7.14(d,J=8.5Hz,1H),7.05(dd,J=9.1,2.7Hz,1H),6.76(s,1H),5.12(d,J=4.6Hz,1H),4.35(s,1H), 3.85(s,4H),3.62(dt,J=26.9,7.8Hz,5H),3.48(s,2H),3.19(dt,J=8.6,4.7Hz,1H),3.14-3.04(m,1H),2.73-2.60(m,2H),2. 37(s,7H),2.09(d,J=11.7Hz,7H),1.85-1.53(m,4H),1.35(dt,J=13.9,6.7Hz,1H),1.21-0.96(m,3H),0.89(t,J=7.6Hz,6H).

[0987] Compound 13

[0988] (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[0989]

[0990] Step 1 : tert-Butyl 4-((1-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenethyl)piperidin-4-yl)oxy)piperidine-1-carboxylate

[0991] To a 100ml round-bottom flask is added 4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolane-2-yl) phenethyl methanesulfonate (1g, 3.0mmol), tert-butyl 4- (piperidin-4-yloxy) piperidine-1-carboxylate (intermediate 18) (1.7g, 6.0mmol), K2CO3 (828mg, 6.0mmol), KI (50mg, 0.3mmol) and ACN (20ml). RM is stirred at 50 DEG C for 16h and then filtered. The filter cake is washed with DCM (2x 30ml), merged with the filtrate, and concentrated. The crude mixture is purified by silica gel chromatography (eluting with 0-10% MeOH in DCM) to produce 1.3g of title compounds as white solids.

[0992] LC-MS (Method I): Rt=2.54 min, [M+H] + =515.

[0993] Step 2: tert-Butyl 4-((1-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)piperidin-4-yl)oxy)piperidine-1-carboxylate

[0994] To a 100 ml round-bottom flask purged and maintained under an inert atmosphere was added 4-chloro-6-iodo-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine (Intermediate 2) (163 mg, 0.39 mmol), tert-butyl 4-((1-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenethyl)piperidin-4-yl)oxy)piperidine-1-carboxylate (Step 1) (200 mg, 0.39 mmol), Na2CO3 (83 mg, 0.78 mmol) and PdCl2(dppf)-CH2Cl2 (43 mg, 0.06 mmol). Then, ACN (8 ml) and water (2 ml) were added, and the RM was stirred at 100 ° C. under N2 for 16 h. The RM was diluted with water (10 ml) and extracted with DCM (4 x 20 ml). The combined organic layers were dried over NaSO and concentrated under reduced pressure. The crude mixture was purified by silica gel chromatography (eluting with 0-8% MeOH in DCM) to yield 130 mg of the title compound tert-butyl 4-((1-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)piperidin-4-yl)oxy)piperidine-1-carboxylate (P1) as a yellow solid and 50 mg of tert-butyl 4-((1-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)piperidin-4-yl)oxy)piperidine-1-carboxylate (P2) as a yellow solid.

[0995] P1: LC-MS (Method I): Rt = 2.42 min, [M+H] + =680.

[0996] P2: LC-MS (Method I): Rt = 2.16 min, [M+H] + =540.

[0997] Step 3: tert-Butyl 4-((1-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)piperidin-4-yl)oxy)piperidine-1-carboxylate

[0998] To a 100 ml round-bottom flask purged and maintained under an inert atmosphere was added P1 (130 mg, 0.19 mmol) of step 2, P2 (50 mg, 0.09 mmol) of step 2, intermediate 7 (114 mg, 0.28 mmol), NaCO (74 mg, 0.7 mmol) and PdCl(dppf)-CHCl (30 mg, 0.04 mmol). ACN (8 ml) and water (2 ml) were added and the RM was stirred at 100 ° C under N for 16 h. The RM was diluted with water (10 ml) and extracted with DCM (4 x 20 ml). The combined organic layers were dried over NaSO and concentrated under reduced pressure. The crude mixture was purified by silica gel chromatography (eluting with 0-10% MeOH in DCM) to produce 85 mg of the title compound as a dark yellow solid.

[0999] LC-MS (Method I): Rt=2.03 min, [M+H] + =798.

[1000] Step 4: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-(2-(4-(piperidin-4-yloxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1001] To a 50 ml round-bottom flask was added tert-butyl 4-((1-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)piperidin-4-yl)oxy)piperidine-1-carboxylate (step 3) (85 mg, 0.1 mmol) and DCM (3 ml), and the RM was stirred at RT. A solution of 4M HCl in dioxane (3 ml, 12 mmol) was slowly added. After the addition, the RM was stirred at RT for 1 h, then concentrated under reduced pressure to afford 120 mg of the title compound as a yellow solid as the HCl salt.

[1002] LC-MS (Method F): Rt=1.40 min, [M+H] + =698.

[1003] Step 5: (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1004] To a 25 ml round bottom flask was added (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(2-(4-(piperidin-4-yloxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 4) (120 mg, 0.1 mmol), pentafluorophenyl 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoate (43 mg, 0.1 mmol) (Intermediate 1b), DIPEA (64 mg, 0.5 mmol) and DMF (2 ml). The RM was stirred at RT for 2 h. The RM was purified by preparative HPLC (XBridge C18, 21.2 x 250 mm, 10 μm; eluting with 0.01 M NH 4 HCO 3 buffer in water / ACN) to yield 40 mg of the title compound as a white solid.

[1005] LC-MS (Method I): Rt=1.71 min, [M+H] + =944.

[1006] 1H NMR (500MHz, DMSO-d6) δ8.82(s,1H),7.87(d,J=8.1Hz,2H),7.67(s,1H),7.49(dd,J=10.7,2.7Hz,1H),7.38(dd,J=8.4 ,2.1Hz,1H),7.35-7.30(m,3H),7.15(d,J=8.6Hz,1H),7.06(dd,J=8.9,2.7Hz,1H),6.74(s,1H),5.12(s,1H),3.95-3. 79(m,5H),3.72-3.55(m,6H),3.43(s,1H),3.27-3.13(m,4H),3.11-3.04(m,1H),2.83-2.71(m,4H),2.68(t,J=6.6Hz, 2H),2.20-1.95(m,6H),1.87-1.75(m,4H),1.66-1.58(m,1H),1.45-1.31(m,5H),1.17-1.08(m,1H),0.91-0.88(m,6H).

[1007] Compound 14

[1008] (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)methoxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1009]

[1010] Step 1: tert-Butyl 4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)methyl)piperidine-1-carboxylate

[1011] At 0 ℃, under argon, to 4-hydroxyphenylboronic acid pinacol ester (4.5g, 20.44mmol), tert-butyl 4-(hydroxymethyl) piperidine-1-carboxylate (4g, 18.58mmol) and PPh (7.3g, 27.9mmol) in THF (70ml) solution, DIAD (5.4ml, 27.8mmol) was added dropwise. The resulting solution was stirred at RT for 3 days. Then distributed between EtOAc and saturated NaHCO. The layers were separated, and the organic layer was washed with salt water, dried over MgSO and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-15% EtOAc in CHX) to provide 1.636g of the title compound.

[1012] LC-MS (Method A): Rt=1.51 min, [M+H] + =418.2.

[1013] Step 2: 4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)methyl)piperidine

[1014] A solution of tert-butyl 4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)methyl)piperidine-1-carboxylate (step 1) (1.626 g, 3.70 mmol) and HCl in dioxane (10 ml, 40.00 mmol) (4 M) in DCM / MeOH 1:1 (10 ml) was stirred at RT for 5 h then concentrated under reduced pressure to afford 1.347 g of the title compound as a white solid as the HCl salt.

[1015] LC-MS (Method A): Rt=0.83 min, [M+H] + =318.1.

[1016] Step 3: tert-Butyl 4-((4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)methyl)piperidin-1-yl)methyl)piperidine-1-carboxylate

[1017] To a solution of 4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)methyl)piperidine (step 2) (348 mg, 0.886 mmol), TEA (0.300 ml, 2.152 mmol) and 1-Boc-piperidine-4-pyrrolecarbaldehyde (200 mg, 0.919 mmol) in MeOH (8 ml) was added ZnCl (2 ml, 1.000 mmol) (0.5 M) in THF at RT, and the RM was stirred under argon for 1 h at RT. NaBHCN (60 mg, 0.955 mmol) was then added. The RM was stirred for 1.5 h at RT and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography eluting with 0-15% DCM / MeOH / NH (95:4:1) in DCM to provide 372 mg of the title compound as a colorless residue.

[1018] LC-MS (Method A): Rt=1.05 min, [M+H] + =515.3.

[1019] Step 4: tert-Butyl 4-((4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)methyl)piperidin-1-yl)methyl)piperidine-1-carboxylate

[1020] To a mixture of 4-chloro-6-iodo-7H-pyrrolo[2,3-d]pyrimidine (177 mg, 0.633 mmol), CsCO (516 mg, 1.583 mmol) and tert-butyl 4-((4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)methyl)piperidin-1-yl)methyl)piperidine-1-carboxylate (step 3) (362 mg, 0.633 mmol) in dioxane / water 1:1 (6 ml) (degassed with argon) was added PdCl(dppf)-CHCl (51 mg, 0.062 mmol). The resulting RM was stirred at 100° C. for 5 h, then cooled to RT and partitioned between EtOAc and water. The two layers were separated. The organic layer was then washed with brine, dried over MgSO and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography, eluting with 0-60% DCM / MeOH / NH 3 (95:4:1) in DCM, to provide 268 mg of the title compound as a beige solid.

[1021] LC-MS (Method A): Rt=0.93 min, [M+H] + =540.3 / 542.2.

[1022] Step 5:tert-Butyl 4-((4-((4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)methyl)piperidin-1-yl)methyl)piperidine-1-carboxylate

[1023] To tert-butyl 4-((4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)methyl)piperidin-1-yl)methyl)piperidine-1-carboxylate (step 4) (134 mg, 0.223 mmol), K2CO3 (77 mg, 0.558 mmol) and (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3 To a mixture of 1-(2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (intermediate 7) (113 mg, 0.268 mmol) in dioxane / water 1:1 (3 ml) (degassed with argon) was added PdCl2(dppf)-CH2Cl2 adduct (18 mg, 0.022 mmol) and the resulting RM was stirred at 100°C for 2 h. The RM was then cooled to RT and stirred over (filter material) and the resulting filtrate was concentrated under reduced pressure. The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 201 mg of the title compound as a yellow solid as a TFA salt.

[1024] LC-MS (Method A): Rt=0.96 min, [M+H] + =798.5.

[1025] Step 6: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-((1-(piperidin-4-ylmethyl)piperidin-4-yl)methoxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1026] A solution of tert-butyl 4-((4-((4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)methyl)piperidin-1-yl)methyl)piperidine-1-carboxylate (step 5) (201 mg, 0.198 mmol) and HCl in dioxane (1 ml, 8.00 mmol) (4 M) in MeOH (1 ml) was stirred at RT for 2 h then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column eluting with 2%-100% ACN in (water + 0.1% TFA) to provide 133 mg of the title compound as a yellow powder as a TFA salt.

[1027] LC-MS (Method A): Rt=0.70 min, [M+H] + =698.7.

[1028] Step 7: (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)methyl)piperidin-4-yl)methoxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1029] To a solution of 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (43 mg, 0.163 mmol) in DMF (1 ml) was added NMM (0.050 ml, 0.455 mmol) followed by HATU (62 mg, 0.163 mmol). The resulting RM was stirred at RT for 30 min, then a solution of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-((1-(piperidin-4-ylmethyl)piperidin-4-yl)methoxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 6) (133 mg, 0.136 mmol) and NMM (0.050 ml, 0.455 mmol) in DMF (0.5 ml) was added dropwise to the mixture, and the yellow RM was stirred at RT for 1.5 h, then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column (eluted from 2% to 100% ACN in water + 0.1% NH4HCO3) to provide 97 mg of material. The material was diluted in MeOH / DCM 4:1 (1 ml). The formed precipitate was filtered and dried under reduced pressure to provide 75 mg of the title compound as a white solid.

[1030] LC-MS (Method B): Rt=3.82 min; [M+H] + =944.7.

[1031] 1 H NMR(400MHz,DMSO-d6)δ12.60(s,1H),10.31(s,1H),8.77(s,1H),7.86(d,J=8.8Hz,2H), 7.73(s,1H),7.43(dd,J=10.7,2.8Hz,1H),7.35(dd,J=8.5,2.2Hz,1H),7.29(d,J=2.1Hz, 1H),7.14(d,J=8.6Hz,1H),7.07-6.94(m,3H),6.63(s,1H),5.23(m,1H),3.84(m,6H),3. 24-2.79(m,13H),2.75-2.60(m,4H),2.22-1.54(m,12H),1.50-0.94(m,6H),0.88(m,6H).

[1032] Compound 15

[1033] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1034]

[1035] Step 1: tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[1036] To a 50 ml round-bottom flask was added (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 7) (168 mg, 0.40 mmol), tert-butyl 9-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (Intermediate 13) (250 mg, 0.38 mmol), Na2CO3 (101 mg, 0.95 mmol) and PdCl2(dppf) (41 mg, 0.06 mmol). Then, ACN (8 ml) and water (2 ml) were added and the RM was stirred at 100° C. under N 2 for 2 h. The RM was concentrated under reduced pressure. The crude residue was purified by silica gel chromatography (eluting with 6% MeOH in DCM) to provide 250 mg of the title compound as a yellow solid.

[1037] LC-MS (Method F): Rt=1.51 min, [M+H] + =908.

[1038] Step 2 : tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[1039] To a 25 ml round-bottom flask was added tert-butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (250 mg, 0.27 mmol), DMSO (2 ml) and water (1 ml). The RM was stirred at 0 °C for 15 min, then a solution of NaOH (86 mg, 2.16 mmol) in water (2 ml) was added. The RM was warmed to RT and then stirred at RT for 16 h. After dilution with water (20 ml), it was extracted with EtOAc (3 x 20 ml). The combined organic layers were dried over Na2SO4, filtered and concentrated. The crude residue was purified by silica gel chromatography (eluting with MeOH in DCM) to provide 130 mg of the title compound as a yellow solid.

[1040] LC-MS (Method F): Rt=1.35 min, [M+H] +=768.

[1041] Step 3: (3R,4S)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1042] To a 50 ml flask was added tert-butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (130 mg, 0.17 mmol) and DCM (10 ml), then the RM was cooled to 0° C. A 4 M solution of HCl in dioxane (2 ml, 8 mmol) was slowly added, then the RM was warmed to RT, stirred at RT for 3 h and concentrated to afford 130 mg of the title compound as a grey solid as the HCl salt.

[1043] LC-MS (Method F): Rt=1.06 min, [M+H] + =668.

[1044] Step 4: (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1045] To a 25 ml flask was added (3R,4S)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide hydrochloride (120 mg, 0.17 mmol), intermediate 1a (50 mg, 0.19 mmol), DIPEA (88 mg, 0.68 mmol) and DMF (3 ml). Then, HATU (76 mg, 0.20 mmol) was added and the RM was stirred at RT for 16 h. The crude mixture was purified by reverse phase HPLC on an XBridge C18 column (21.2 x 250 mm, 10 μm), eluting with ACN in water (0.01 M NH 4 HCO 3 buffer) to provide 72 mg of the title compound as a white solid.

[1046] LC-MS (Method J): Rt=1.41 min, [M / 2+H] + =457.6.

[1047] 1 H NMR (400MHz, DMSO-d6) δ0.90 (dd, J=8.44, 6.68Hz, 6H) 1.08-1.16 (m, 1H) 1.31-1.36 (m, 1H) 1.37-1.45 (m, 4H) 1.49 (br s,4H)1.62(dt,J=13.86,6.71Hz,1H)2.01-2.07(m,1H)2.09(s,3H)2.41(br s,4H)2.55(br s,2H)2.66-2.70(m,2H)2.72-2.79(m,2H)3.08(brdd,J=9.39,6.46Hz,1H)3.19(br dd,J=10.34,4.92Hz,1H)3.35-3.6(m,4H)3.59(br t,J=6.68Hz,2H)3.62-3.69(m,2H)3.84(s,3H)3.85-3.92(m,1H)5.11(d,J= 4.55Hz,1H)6.74(s,1H)7.05(dd,J=8.88,2.57Hz,1H)7.15(d,J=8.66Hz,1H) 7.28-7.33(m,3H)7.37(dd,J=8.51,1.91Hz,1H)7.49(dd,J=10.71,2.64Hz,1 H)7.66(s,1H)7.87(d,J=8.22Hz,2H)8.82(s,1H)10.32(s,1H)12.69(s,1H).

[1048] Compound 16

[1049] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-ethoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1050]

[1051] This compound was prepared by analogous methods to the preceding analogs. (3R,4S)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Compound 15, Step 3) and Intermediate 1c were coupled under standard amide formation conditions to give the title compound as a yellow solid.

[1052] LC-MS (Method K): Rt=2.03 min, [M+H] + =928.

[1053] Compound 17

[1054] (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1055]

[1056] This compound was prepared by analogous methods to the preceding analogs. (3R,4S)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide was coupled with intermediate 1b to give the title compound as a white solid.

[1057] LC-MS (Method K): Rt=1.93 min, [M+H] + =915.2.

[1058] Compound 18

[1059] (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1060]

[1061] Step 1: tert-Butyl 9-(4-(4-(5-fluoro-3-((cis-rac)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[1062] To a 50 ml round-bottom flask purged and maintained under an inert atmosphere was added tert-butyl-9-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (Intermediate 13) (200 mg, 0.31 mmol), (cis-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 9) (155 mg, 0.37 mmol), Na2CO3 (85 mg, 0.8 mmol) and PdCl2(dppf) (34 mg, 0.05 mmol). ACN (12 ml) and water (3 ml) were added and the RM was stirred at 100° C. for 2 h then concentrated under reduced pressure. The crude mixture was purified by silica gel chromatography (eluting with 3%-6% MeOH in DCM) to provide 380 mg of the title compound as a yellow solid.

[1063] LC-MS (Method F): Rt=1.54 min, [M+H] + =909.

[1064] Step 2 : tert-Butyl 9-(4-(4-(5-fluoro-3-((cis-rac)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[1065] To a 50 ml round-bottom flask was added tert-butyl 9-(4-(4-(5-fluoro-3-((cis-rac)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (380 mg, 0.31 mmol) and DMSO (2 ml). A solution of NaOH (50 mg, 1.24 mmol) in water (1 ml) was slowly added at RT and the RM was stirred at RT for 16 h. The RM was poured into water (10 ml) and extracted with EtOAc (4 x 10 ml). The combined organic layers were then dried to provide a crude mixture. The crude mixture was purified by silica gel chromatography (eluting with 3%-6% MeOH in DCM) to provide 130 mg of the title compound as a yellow solid.

[1066] LC-MS (Method F): Rt=1.37 min, [M+H] + =769.

[1067] Step 3 :(cis-rac)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1068] To a 50 ml round-bottom flask was added tert-butyl 9-(4-(4-(5-fluoro-3-((cis-rac)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (100 mg, 0.13 mmol) (step 2) and DCM (6 ml). The RM was stirred at RT and a solution of 4M HCl in dioxane (3.5 ml, 14 mmol) was added. After the addition, the mixture was stirred at RT for 3 h. The RM was concentrated to afford 120 mg of the title compound as a yellow solid as the HCl salt.

[1069] LC-MS (Method F): Rt=1.09 min, [M+H] + =668.

[1070] Step 4: (cis-racemic)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1071] To a 50 ml round bottom flask was added (cis-rac)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide hydrochloride (120 mg, 0.17 mmol) (Step 3), 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (53 mg, 0.20 mmol), DIPEA (110 mg, 0.85 mmol) and DMF (3 ml). The RM was stirred at RT, then HATU (76 mg, 0.20 mmol) was added and stirred at RT for another 2 h. The RM was purified by reverse phase HPLC, eluting with an ACN / water (containing 0.01 M NH 4 HCO 3 buffer) gradient, to provide 70 mg of the title compound as a white solid.

[1072] LC-MS (Method E): Rt=1.75 min, [M+H] + =914.

[1073] 1H NMR (500MHz, DMSO) δ12.71(s,1H),10.35(s,1H),8.82(s,1H),7.88(d,J=8.2Hz,2H),7.65(s,1H),7.49(dd,J=10.9,2.7 Hz,1H),7.38(dd,J=8.4,2.1Hz,1H),7.33-7.31(m,3H),7.16(d,J=8.6Hz,1H),7.06(dd,J=8.8,2.7Hz,1H),6.75(s,1H), 4.91(s,1H),4.11(s,1H),3.85(s,3H)3.68-3.40(m,9H),3.08(s,1H),2.76(t,J=6.4Hz,2H),2.66(m,2H),2.54(m,2H)2 .42-2.37(m,4H),2.17(s,1H),2.10(s,3H),1.64-1.56(m,1H),1.49-1.42(m,9H),1.29-1.25(m,1H),0.92-0.90(m,6H).

[1074] Compound 19

[1075] (3S,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1076]

[1077] Step 1 : tert-Butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[1078] To a 50 ml round-bottom flask purged and maintained under an inert atmosphere was added (3S,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 8) (154 mg, 0.37 mmol), tert-butyl 9-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (Intermediate 13) (250 mg, 0.38 mmol), Na2CO3 (101 mg, 0.95 mmol) and PdCl2(dppf) (41 mg, 0.06 mmol). ACN (8 ml) and water (2 ml) were added and the RM was stirred at 100° C. under N 2 for 2 h, then concentrated under reduced pressure. The crude mixture was purified by silica gel chromatography (eluting with 3%-6% MeOH in DCM) to provide 200 mg of the title compound as a yellow solid.

[1079] LC-MS (Method F): Rt=1.34 min, [M+H] + =768.

[1080] Step 2 :(3S,4R)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1081] To a 50 ml round-bottom flask was added tert-butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (120 mg, 0.16 mmol) and DCM (6 ml). The RM was stirred at RT before the addition of 4M HCl in dioxane (4 ml, 16 mmol). After the addition, the RM was stirred at RT for 3 h and concentrated to afford 115 mg of the title compound as a yellow solid as the HCl salt.

[1082] LC-MS (Method F): Rt=1.08 min, [M+H] + =668.

[1083] Step 3:(3S,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1084] To a 50 ml flask was added (3S,4R)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undec-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 2) (106 mg, 0.16 mmol), 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (50 mg, 0.19 mmol), DIPEA (103 mg, 0.8 mmol) and DMF (3 ml). HATU (72 mg, 0.19 mmol) was added at RT and the RM was stirred at RT for 16 h. The RM was purified by reverse phase HPLC on an XBridge C18 column eluting with an ACN / water (containing 0.01 M NH 4 HCO 3 buffer) gradient to provide 41 mg of the title compound as a white solid.

[1085] LC-MS (Method F): Rt=1.20 min, [M+H] + =914.

[1086] 1H NMR (500MHz, DMSO-d6) δ12.67(s,1H),10.34(s,1H),8.79(s,1H),7.87(d,J=8.2Hz,2H),7.66(s,1H),7.48(dd,J=10.7,2. 6Hz,1H),7.38-7.29(m,4H),7.15(d,J=8.6Hz,1H),7.05(dd,J=8.8,2.8Hz,1H),6.71(s,1H),5.13(s,1H),3.87-3.84(m,4 H),3.73-3.38(m,8H),3.20-3.17(m,1H),3.09-3.06(m,1H),2.80-2.72(m,2H),2.68(t,J=6.5Hz,2H),2.41-2.36(m,6H), 2.09-2.04(m,4H),1.66-1.58(m,1H),1.56-1.27(m,9H),1.16-1.10(m,1H),0.91(d,J=6.6Hz,3H),0.89(d,J=6.6Hz,3H).

[1087] Compound 20

[1088] (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1089]

[1090] Step 1:

[1091] 2-((1-(tert-Butyloxycarbonyl)piperidin-4-yl)oxy)-1-hydroxyethanesulfonic acid

[1092] By tert-butyl 4- (2- oxoethoxy) piperidine -1- carboxylate (intermediate 4) (1000mg, 3.70mmol) in EtOH (6ml) solution with argon purging, then add sodium metabisulfite (500mg, 2.63mmol) in water (1ml) solution, and then RM is stirred at 80 DEG C for 1h.Heterogeneous RM is cooled to RT, stirred for 2 days, then filtered.The solid cake is washed with EtOH and dried under reduced pressure to provide 833mg of the title compound as a white solid.

[1093] 1H NMR (400MHz, DMSO-d6) δ5.32(d,J=5.7Hz,1H),3.96(t,J=7.2Hz,1H),3.80(d,J=10.3Hz,1H),3.61(d,J=1 3.4Hz,2H),3.46(s,1H),3.35(s,2H),2.99(s,2H),1.73(s,2H),1.39(s,9H),1.30(q,J=9.1,5.9Hz,2H).

[1094] Step 2:

[1095] tert-Butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidin-1-yl)ethoxy)piperidine-1-carboxylate

[1096] (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-(piperidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 12) (130 mg, 0.161 mmol) was dissolved in MeOH (1.5 ml) at RT. NaOAc (33 mg, 0.402 mmol) was then added, and the orange solution was stirred at RT for 5 min. 2-((1-(tert-Butyloxycarbonyl)piperidin-4-yl)oxy)-1-hydroxyethanesulfonic acid (90 mg, 0.277 mmol) and 2-methylpyridine borane complex (CAS 3999-38-0) (8 mg, 0.064 mmol) were then added, and the RM was stirred at RT overnight. Then additional batches of 2-((1-(tert-Butyloxycarbonyl)piperidin-4-yl)oxy)-1-hydroxyethanesulfonic acid (15 mg, 0.046 mmol) and 2-picoline borane complex (4 mg, 0.032 mmol) were added and the RM was stirred for 2 days before being concentrated to dryness. The crude product was purified on a C18 column (eluting with 2% to 90% ACN in water + 0.1% TFA) to provide 128 mg of the title compound.

[1097] LC-MS (Method A): Rt=0.96 min, [M+H] + =814.7

[1098] Step 3:(3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-((1-(2-(piperidin-4-yloxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1099] A solution of tert-butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidin-1-yl)ethoxy)piperidine-1-carboxylate (step 2) (128 mg, 0.127 mmol) and HCl in dioxane (1 ml, 4.00 mmol) (4 M) in MeOH (1.5 ml) was stirred at RT for 1 h, then the RM was concentrated to dryness. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column (eluting with 2%-100% ACN in water + 0.1% TFA) to provide 94 mg of the title compound as a yellow powder as a TFA salt.

[1100] LC-MS (Method A): Rt=0.64 min, [M+H] + =714.5

[1101] Step 4: (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1102] 3-(2,4-Dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (31 mg, 0.117 mmol) was dissolved in DMF (1 ml) and then NMM (0.050 ml, 0.455 mmol) was added followed by HATU (45 mg, 0.118 mmol). After 30 min, a solution of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-((1-(2-(piperidin-4-yloxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (94 mg, 0.098 mmol) (Step 3) and NMM (0.050 ml, 0.455 mmol) in DMF (0.5 ml) was added dropwise to the mixture and the yellow RM was stirred at RT for 3 h. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column (eluting with 2% to 100% ACN in water + 0.1% NH4HCO3) to provide 43 mg of the title compound.

[1103] LC-MS (Method B): Rt=3.69 min, [M+H] + =960.5

[1104] 1 H NMR (400MHz, DMSO-d6) δ12.62(s,1H),10.32(s,1H),8.80(s,1H),7.88(d,J=8.4Hz,2H),7.67(s,1H),7.48(d d,J=10.8,2.8Hz,1H),7.44-7.29(m,2H),7.15(d,J=8.5Hz,1H),7.04(m,2.9Hz,3H),6.65(s,1H),5.12(d,J=4 .6Hz,1H),4.45(s,1H),3.85(m,4H),3.74-3.44(m,7H),3.27-3.01(m,4H),2.83-2.61(m,4H),2.50(m,2H),2 .32(m,4H),2.08(m,4H),1.93(m,2H),1.83(m,2H),1.62(m,3H),1.55-1.29(m,3H),1.13(m,1H),0.89(m,6H).

[1105] Compound 21

[1106] (3S,4R)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1107]

[1108] Step 1: tert-Butyl 4-(2-(4-((4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate

[1109] To a mixture of tert-butyl 4-(2-(4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate (Intermediate 16) (130 mg, 0.195 mmol), (3S,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 8) (90 mg, 0.214 mmol), and Na2CO3 in water (0.195 ml, 0.389 mmol) (2 M) in 1-propanol (15 ml) was added PdCl2(PPh3)2 (6.83 mg, 9.74 μmol). The resulting RM was irradiated in a microwave at 140° C. for 15 min. It was then concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-16% MeOH in DCM) to provide 25 mg of the title compound.

[1110] LC-MS (Method A): Rt=0.96 min, [M+H] + =812.7.

[1111] Step 2: (3S,4R)-N-(5-Fluoro-2-methyl-3-(6-(4-(((1-(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1112] A green solution of tert-butyl 4-(2-(4-((4-(4-(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate (step 1) (25 mg, 0.031 mmol) and TFA (0.071 ml, 0.924 mmol) in DCM (3 ml) was stirred at RT for 24 h. The solution was then concentrated under pressure and dried to afford 47 mg of the title compound as a TFA salt.

[1113] LC-MS (Method A): Rt=0.70 min; [M+H] + =712.5.

[1114] Step 3: (3S,4R)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1115] To a mixture of (3S,4R)-N-(5-fluoro-2-methyl-3-(6-(4-(((1-(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 2) (28.9 mg, 0.031 mmol) and 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (8.94 mg, 0.034 mmol) in DMF (3 ml) was added DIPEA (0.032 ml, 0.184 mmol) followed by HBTU (17.49 mg, 0.046 mmol). The resulting RM was stirred at RT for 2 h then poured into H2O and filtered. The resulting filtrate was filtered again. The combined solids were dissolved in MeOH and concentrated under reduced pressure. The resulting crude product was adsorbed on (adsorbent material) and by reverse phase flash chromatography (in Purification on a C18 column, eluting with 10%-100% ACN in (water + 0.1% TFA) to provide 7.5 mg of the title compound as a TFA salt.

[1116] LC-MS (Method B): Rt=3.82 min, [M / 2+H] +=480.1

[1117] 1 H NMR (400MHz, DMSO-d6) δ12.83(s,1H),10.35(s,1H),9.05(s,1H),8.87(s,1H),7.99(d,J=8.1Hz,2H) ,7.72(s,1H),7.63-7.28(m,5H),7.13(dd,J=33.8,7.4Hz,2H),4.59(d,J=9.7Hz,2H),3.98-3.78(m, 5H),3.75-3.54(m,6H),3.14(d,J=33.2Hz,9H),2.77-2.64(m,3H),2.40-2.17(m,3H),2.09(d,J=16. 7Hz, 5H), 1.86 (s, 1H), 1.63 (d, J = 6.6Hz, 7H), 1.37 (s, 1H), 1.15 (d, J = 8.7Hz, 3H), 1.00-0.83 (m, 6H).

[1118] Compound 22

[1119] (3R,4S)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1120]

[1121] Step 1: tert-Butyl 4-(2-(4-((4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate

[1122] To a mixture of tert-butyl 4-(2-(4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate (Intermediate 16) (358 mg, 0.646 mmol), (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 7) (272 mg, 0.646 mmol), and KCO (223 mg, 1.615 mmol) in water (10 ml) was added PdCl(dppf) (47.3 mg, 0.065 mmol) followed by dioxane (10 ml). The resulting RM was then stirred at 100°C for 1 h, then diluted with EtOAc and water. The two layers were separated, and the aqueous layer was extracted with EtOAc (3x). The combined organic layers were washed with salt water, dried over MgSO4, filtered and concentrated under reduced pressure. The crude product was purified by flash silica gel chromatography (eluting with 0-20% MeOH in DCM) to provide 300mg of the title compound.

[1123] LC-MS (Method A): Rt=0.95 min, [M+H] + =812.6.

[1124] Step 2: (3R,4S)-N-(5-Fluoro-2-methyl-3-(6-(4-(((1-(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1125] A green solution of tert-butyl 4-(2-(4-((4-(4-(5-fluoro-3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine-1-carboxylate (step 1) (300 mg, 0.314 mmol) and TFA (0.726 ml, 9.42 mmol) in DCM (3 ml) was stirred at RT for 2 h, then the RM was concentrated under reduced pressure to afford 300 mg of the title compound as a TFA salt.

[1126] LC-MS (Method A): Rt=0.68 min, [M+H] + =712.6.

[1127] Step 3:(3R,4S)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1128] To a mixture of (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(((1-(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 2) (295 mg, 0.314 mmol) and 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (91 mg, 0.345 mmol) in DMF (3 ml) was added DIPEA (0.329 ml, 1.883 mmol) and HBTU (179 mg, 0.471 mmol). The RM was stirred at RT under argon for 2 h, then poured into water and DCM. The two layers were separated and the organic layer (containing some sticky solids) was diluted with MeOH to dissolve the solids. The resulting clear organic layer was then concentrated under reduced pressure and adsorbed onto (adsorbent material). By reverse phase flash chromatography (on The crude product was purified on a C18 column (eluted with 10%-100% ACN in water + 0.1% TFA) to provide the title compound as a TFA salt. The title compound as a TFA salt was then dissolved in MeOH, filtered on an SCX column, and released from the SCX column with ammonia 7N in MeOH. The filtrate was concentrated under reduced pressure to provide 142 mg of the title compound as a solid.

[1129] LC-MS (Method B): Rt=3.88 min, [M+H] + =959.

[1130] 1H NMR(400MHz,DMSO-d6)δ12.75(s,1H),10.33(s,1H),8.84(s,1H),7.95(d,J =8.2Hz,2H),7.67(s,1H),7.49(dd,J=10.8,2.6Hz,1H),7.41(d,J=8.1Hz,2H ),7.35(dd,J=8.5,1.9Hz,1H),7.31(d,J=1.9Hz,1H),7.15(d,J=8.6Hz,1H), 7.06(dd,J=8.8,2.6Hz,1H),6.82-6.75(m,1H),5.12(d,J=4.4Hz,1H),4.53( s,2H),4.47-4.20(m,1H),3.92-3.85(m,1H),3.84(s,3H),3.71-3.61(m,2H) ,3.59(t,J=6.6Hz,2H),3.45-3.34(m,1H),3.24-3.14(m,1H),3.14-3.03(m, 1H),2.91-2.52(m,6H),2.32-2.20(m,2H),2.09(s,3H),2.06-1.94(m,3H),1 .93-1.82(m,2H),1.80-1.21(m,10H),1.18-1.02(m,3H),0.94-0.84(m,6H).

[1131] Compound 23

[1132] (cis-rac)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1133]

[1134] Step 1: tert-Butyl 9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate

[1135] At RT, under argon, to a stirred solution of 3,9-diaza-spiro [5.5] undecane-3-formic acid tert-butyl ester (432 mg, 1.698 mmol) and NMM (0.392 ml, 3.57 mmol) in DMF (4 ml) was added 3- (2,4-dioxotetrahydropyrimidine-1 (2H) -yl) -4-methoxybenzoic acid (intermediate 1a) (471 mg, 1.783 mmol) followed by HATU (743 mg, 1.953 mmol). The clarified RM was stirred at RT for 2.5 h, then quenched with saturated aqueous NaHCO and diluted with EtOAc. The two layers were separated and the aqueous layer was extracted with EtOAc (1x). The combined organic layers were washed with brine / water (1: 1, 2x) and brine (1x), dried over MgSO, filtered and evaporated to provide 900 mg of the title compound.

[1136] LC-MS (Method A): Rt=0.91 min, [M+H]+=501.4.

[1137] Step 2: 1-(2-methoxy-5-(3,9-diazaspiro[5.5]undecane-3-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione

[1138] A solution of tert-butyl 9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate (step 1) (100 mg, 0.200 mmol) and HCl in dioxane (1 ml, 4 mmol) (4 M) in MeOH (1 ml) was stirred at RT for 1.5 h. The RM was concentrated and dried under reduced pressure to afford 99 mg of the title compound as an HCl salt.

[1139] LC-MS (Method D): Rt=0.76 min; [M+H]+=401.4.

[1140] Step 3: (cis-rac)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undec-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide

[1141] To a stirred mixture of (cis-rac)-N-(5-fluoro-3-(6-(4-formylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 10) (100 mg, 0.193 mmol), TEA (0.100 ml, 0.717 mmol) and 1-(2-methoxy-5-(3,9-diazaspiro[5.5]undecane-3-carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione (step 2) (96 mg, 0.193 mmol) in MeOH (2 ml) was added ZnCl2 (0.450 ml, 0.225 mmol) (0.5 M) in THF at RT; and the RM was stirred at RT overnight. Then, NaBH3CN (15 mg, 0.239 mmol) was added and the RM was stirred at RT for 3 days. It was then concentrated under reduced pressure. The product was purified by reverse phase flash chromatography (at The crude product was purified on a C18 column (eluted with 2%-100% ACN in (water + 0.1% TFA) to provide a solution that was filtered through a PL-HCO3 MP SPE cartridge and lyophilized to provide 210 mg of material. The material was purified by SFC (column: Princeton PPU, 250x30 mm, 100A, 5 um; eluted with 30%-50% CO2 in MeOH) to provide 130 mg of the title compound as a white powder.

[1142] LC-MS (Method B): Rt=3.61 min, [M+H] + =900.7.

[1143] 1 H NMR (400MHz, DMSO-d6) δ12.78(s,1H),10.31(s,1H),8.84(s,1H),8.02(d,J=33.4Hz,2H),7.6 4(s,1H),7.60-7.41(m,3H),7.35(d,J=8.5Hz,1H),7.30(s,1H),7.14(d,J=8.5Hz,1H),7.09-6 .99(m,1H),6.85(s,1H),4.88(s,1H),4.09(m,1H),3.83(s,3H),3.57(m,3H),3.52-3.37(m,7H ),3.06(m,1H),2.66-2.61(m,6H),2.14(m,1H),2.08(s,3H),1.68-1.18(m,12H),0.89(m,6H).

[1144] Measurement instructions

[1145] The compounds of the present invention were tested in the following cell assays. The data obtained are shown in Table 1. The terms in Table 1 are defined as follows: DC 50 refers to the concentration at which 50% of maximum degradation is observed; deg Amax is the extent of degradation, which is the percentage of protein remaining at the concentration at which maximum degradation is seen; Prol GI 50 refers to proliferation data and defines the concentration at which 50% growth inhibition is observed compared to vehicle-treated controls at the end of the incubation time. TMD8 cells are BTK-dependent, whereas OCI-LY3 cells are BTK-independent.

[1146] Flow cytometric determination of BTK-GFP and IKZF3-GFP protein abundance in HEK293A cells:

[1147] Degradation of BTK or IKZF3 was measured in HEK293A cells expressing BTK-GFP and RFP or IKZF3-GFP and RFP from stably integrated bicistronic BTK-GFP-iresRFP or IKZF3-GFP-iresRFP constructs, respectively (Invitrogen R70507). The reduction of GFP signal measured by flow cytometry served as a readout of BTK or IKZF3 degradation after treatment with the degrading agent.

[1148] i) Cloning of pLenti6-BTK-GFP-Ires-RFP and IKZF3-GFP-Ires-RFP sensor vectors

[1149] The bicistronic BTK-GFP-iresRFP construct is based on the pLenti6-DEST vector backbone, in which GFP is introduced into a unique Xho1 site downstream of the destination cassette (DEST) and RFP is cloned behind the internal ribosome entry site (Ires).

[1150] In detail, the sensor constructs were engineered by replacing nanoluciferase (NLuc) with GFP and firefly luciferase (FF) with RFP from pLenti6-DEST-NLuc-Ires-FF.

[1151] The pLenti6-DEST-NLuc-Ires-FF sensor construct was cloned by replacing the eGFP from pLenti6-DEST-Ires-eGFP with a synthetic stuffer element encoding Ires-FF flanked by two Nhe1 restriction sites by using blunt-end cloning. To enable C-terminal tagging with nanoluciferase (NLuc), NLuc was amplified from pNL1.1 (Promega #N1001) using an adapter primer with an Xho1 site and ligated into the linearized pLenti6-DEST-Ires-FF using an Xho1 digest, resulting in the construct pLenti6-DEST-NLuc-Ires-FF.

[1152] pLenti6-DEST-NLuc-Ires-FF was used as the base vector for cloning pLenti6-DEST-GFP-Ires-RFP using Gibson assembly, replacing FF with RFP and NLuc with GFP. In the first round, RFP was amplified from the template using the following Gibson assembly adapter primers (Gibson-Nhe1 RFPfw, CGATGAATTCGCCACCgctagcATGGTGAGCAAGGGCGAGGAGC (SEQ ID NO: 1); Gibson-Nhe1 RFP-Stoprev, CTCATTACTAACCGGctagcTTACTTGTACAGCTCGTCCATGC (SEQ ID NO: 2)), replacing FF with RFP, and cloned into pLenti6-DEST-NLuc-Ires-FF that had been digested with Nhe1 and gel purified to remove the FF fragment. The resulting pLenti6-DEST-NLuc-Ires-RFP vector was used as a template to replace NLuc with GFP by amplifying GFP from the template using the following Gibson assembly adapter primers (Gibson-Xho1 GFPfw, CCAGCACAGTGGCGGCCGCTCGAGcATGGTGAGCAAGGGCGAGGAGCTG TTCACC (SEQ ID NO: 3); Gibson-Xho1 GFP-Stoprev, CCGCGGGCCCTCTAGACTCGAGTTACTTGTACAGCTCGTCCATGCCGAG AGT (SEQ ID NO: 4)) for cloning into pLenti6-DEST-NLuc-Ires-RFP that had been digested with Xho1 and gel purified to remove the NLuc fragment. All Gibson Assembly reactions were performed using Gibson Assembly Master Mix (New England Biolabs NEB E2611L) according to the manufacturer's manual to generate the destination vector pLenti6-DEST-GFP-Ires-RFP for Gateway cloning.

[1153] To achieve gateway cloning and C-terminal GFP tagging of BTK, the BTK open reading frame (ORF) was first inserted from the pcDNA-DEST40-BTK vector (Invitrogen library ID INV_20090504v1) into the pDONR221 (Invitrogen 12536-017) vector using the gateway BP reaction according to the manufacturer's manual (Invitrogen 11789-013) to generate a new construct pENTR221-BTK. For C-terminal tagging, the STOP codon was mutated to leucine using the QuikChange Lightning Mutagenesis Kit (Agilent Technologies #210518) according to the manufacturer's manual with the following primers (pENTR221-BTKQuikchange STOP-Leu fw, gtcatggatgaagaatccTTGaacccagctttcttgtac; pENTR221-BTKQuikchange STOP-Leu REVC, gtacaagaaagctgggttCAAggattcttcatccatgac) to generate pENTR221-BTK(STOP-Leu).

[1154] To obtain the final pLenti6-BTK-GFP-Ires-RFP sensor construct, a Gateway LR reaction was performed between pLenti6-DEST-GFP-Ires-RFP and pENTR221-BTK (STOP-Leu) using the LR Clonase Kit (Invitrogen 11791-019) according to the manufacturer's instructions. All vectors described were sequenced for verification.

[1155] The bicistronic pLenti6-IKZF3-GFP-iresRFP construct was engineered by analogy by cloning the IKZF3 construct from pENTR221-IKZF3(STOP-Leu) into the previously described pLenti6-DEST-GFP-Ires-RFP vector using the LR Clonase Kit (Invitrogen 11791-019) according to the manufacturer's manual. All vectors described were sequence verified.

[1156] To achieve gateway cloning and C-terminal GFP tagging of IKZF3, a mutagenesis reaction was performed using the QuikChange Lightning Mutagenesis Kit (Agilent Technologies #210518) according to the manufacturer's manual with the following primers (pENTR221-IKZF3 Quikchange STOP-Leu fw, AGAGCCCTGCTGAAGttgaaccCAGCTTTcttgtac (SEQ ID NO: 5); pENTR221-IKZF3 Quikchange STOP-Leu REVC, gtacaagAAAGCTGggttcaaCTTCAGCAGGGCTCT (SEQ ID NO: 6)) to mutate the STOP codon from pENTR221-IKZF3 (Invitrogen #INVE089_A8) to leucine, generating pENTR221-IKZF3 (STOP-Leu).

[1157] ii) Engineering 293A BTK-GFP-Ires-RFP and IKZF3-GFP-Ires-RFP sensor cells stably expressing cell

[1158] 293A BTK-GFP-Ires-RFP and IKZF3-GFP-Ires-RFP sensor cells were generated by lentiviral transduction using the previously described pLenti6-BTK-GFP-Ires-RFP or pLenti6-IKZF3-GFP-Ires-RFP sensor constructs. Lentiviral particles were produced in HEK293FT cells (Invitrogen R70007) by co-transfection of 500 ng of pLenti6-BTK-GFP-Ires-RFP or pLenti6-IKZF3-GFP-Ires-RFP, 500 ng of delta8.71, and 200 ng of pVSVG diluted in 100 μl of OptiMEM serum-free medium (Invitrogen #11058-021) (pre-incubated with 3 μl of Lipofectamine 2000 (Invitrogen #11668-019) in 97 μl of OptiMEM serum-free medium for 5 min and then mixed). The mixture was incubated at RT for another 20 min and then added to 1 ml of freshly prepared HEK293FT cell suspension in 6-well plates (concentration 1.2 x 10 6 cells / ml). One day after transfection, the culture medium was replaced with 1.5 ml of complete growth medium (DMEM high glucose + 10% FCS + 1% L-glutamine + 1% NEAA + 1% NaPyr.). 48 h after transfection, the supernatant containing the viral transduction particles was collected and frozen at -80°C.

[1159] Two days before transduction with viral particles, 1x10 5 HEK293A cells (Invitrogen R70507) were seeded into 2 ml of growth medium in a 6-well plate. Infection was performed with 90 μl of collected supernatant containing virally transduced particles in 1 ml of medium containing 8 μg / ml polybrene. Twenty-four hours after infection, stably transfected cells were selected with blasticidin at a concentration of 8 μg / ml.

[1160] iii) Quantitative BTK-GFP and IKZF3-GFP abundance measurements

[1161] Stable HEK293A-BTK-GFP-iresRFP cells were maintained in complete growth medium (DMEM high glucose + 10% FCS + 1% L-glutamine + 1% NEAA + 1% NaPyr.) and passaged twice a week. On day 0, HEK293A-BTK-GFP-iresRFP or HEK293A-IKZF3-GFP-iresRFP and HEK293A-iresRFP cells were seeded at 10,000 cells / well in 96-well microtiter plates in 260 μl complete medium. On day 1, cells were treated in duplicate with a 10-point 1:3 dilution series of compounds using an HP D300 digital dispenser (Tecan). DMSO concentrations were normalized to 0.1% across the plate. On the second day, after incubation at 37 ° C for 24h, the treatment medium was discarded, the cells were rinsed with 100ul / well PBS, and then 40ul trypsin / well was used to separate for 5min. Trypsin was neutralized with 100ul / well PBS+20%FCS. Flow cytometry was performed on the samples using BDFACS CANTO II (Becton Dickinson). Cell identification was then performed using forward (FSC) to side (SSC) scatter dot analysis. Single cell differentiation was performed using SSC width (SSC-W) to SSC height (SSC-H) scatter dot analysis. The GFP median of 5,000 single cells was used to determine BTK levels. The GFP median from HEK293A-iresRFP was used as background signal and was therefore defined as 0% BTK signal. The median GFP value from DMSO-treated HEK293A-BTK-GFP-iresRFP or HEK293A-IKZF3-GFP-iresRFP was used to define 100% BTK signal for subsequent DC 50 Curve (concentration at which 50% BTK is degraded). GFP and RFP were read in channels designated FITC and PE, respectively.

[1162] Concentration response curves of the relative reduction of GFP signal (measured by flow cytometry) versus 10 compound concentrations (starting at 10 μM, 3-fold dilution steps) can be generated for DCs. 50 value.

[1163] For IKZF3 abundance determination, literature molecules pomalidomide and lenalidomide were tested as positive control compounds. The data are shown in Table 2, where DC 50 is the concentration at which 50% maximal degradation is observed; deg Amax is the extent of degradation, and this value is the % of protein remaining at the concentration at which maximal degradation is seen.

[1164] Flow cytometry of BTK(C481S)-GFP protein abundance in TMD8 cells

[1165] In TMD8 cells expressing BTK(C481S)-GFP and mCherry, BTK(C481S) degradation was measured from a stably integrated second-generation bicistronic BTK(C481S)-GFP-CHYSEL-mCherry construct. The reduction in GFP signal measured by flow cytometry served as a readout for BTK(C481S) degradation following treatment with a degrader.

[1166] Cloning of the pLenti6-BTK(C481S)-GFP-CHYSEL-mCherry sensor vector

[1167] The BTK(C481S) protein abundance sensor is based on a second generation bicistronic construct in which the two reading frames BTK(C481S) and the mCherry control are separated by a cis-acting hydrolase element (see: Lo et al., 2015 Cell Reports 13, 2634), replacing the Ires from the first generation vector described previously.

[1168] The bicistronic BTK(C481S)-GFP-CHYSEL-mCherry construct was based on the pLenti6-DEST vector backbone, in which a GFP-CHYSEL-mCherry cassette was synthesized and inserted downstream of the DEST cassette by Gibson assembly, generating a new gateway-compatible vector pLenti6-DEST-GFP-CHYSEL-mCherry to allow gateway cloning using pENTR221-BTK(C481S)(STOP-Leu) to obtain the final sensor construct pLenti6-BTK(C481S)-GFP-CHYSEL-mCherry. pENTR221-BTK(C481S)(STOP-Leu) was generated by mutating wild-type BTK to BTK(C481S) by performing a mutagenesis reaction on pENTR221-BTK(STOP-Leu) using the QuikChange Lightning Mutagenesis Kit (Agilent Technologies #210518) according to the manufacturer's manual with the following primers (BTK C481S Quikchange fw, gagtacatggccaatggctCcctcctgaactacctgagg (SEQ ID NO:7); BTK C481S Quikchange REVC, cctcaggtagttcaggaggGagccattggccatgtactc (SEQ ID NO:8)).

[1169] Sequence of the synthetic construct (Xho1 site is shown in bold, mCherry-ORF is shown in lowercase):

[1170]

[1171] Engineering of cells stably expressing TMD8BTK(C481S)-GFP-CHYSEL-mCherry sensor

[1172] TMD8 BTK (C481S) -GFP -CHYSEL -mCherry sensor cells were generated by lentiviral transduction using the previously described pLenti6-BTK (C481S) -GFP -CHYSEL -mCherry sensor construct. Lentiviral particles were produced in HEK293FT cells (Invitrogen R70007) by co-transfection of 500 ng pLenti6-BTK-GFP -Ires-RFP or pLenti6-IKZF3-GFP -Ires-RFP diluted in 100 μl OptiMEM serum-free medium (Invitrogen #11058-021) (pre-incubated with 3 μl Lipofectamine 2000 (Invitrogen #11668-019) in 97 μl OptiMEM serum-free medium for 5 min and then mixed). The mixture was incubated for another 20 min at RT and then added to 1 ml of freshly prepared HEK293FT cell suspension (concentration 1.2 x 10 6 cells / ml). One day after transfection, the culture medium was replaced with 1.5 ml of complete growth medium (DMEM high glucose + 10% FCS + 1% L-glutamine + 1% NEAA + 1% NaPyr.). 48 h after transfection, the supernatant containing the viral transduction particles was collected and frozen at -80°C.

[1173] Two days before transduction with viral particles, 1x10 5 HEK293A cells (Invitrogen R70507) were seeded into 2 ml of growth medium in a 6-well plate. Infection was performed with 90 μl of collected supernatant containing virally transduced particles in 1 ml of medium containing 8 μg / ml polybrene. Twenty-four hours after infection, stably transfected cells were selected with blasticidin at a concentration of 8 μg / ml.

[1174] Cell viability assay in DLBCL (diffuse large B-cell lymphoma) cells:

[1175] The effect of BTK compounds on cell proliferation was measured by a cell viability assay based on resazurin (Sigma, #R7017). TMD8 (sensitive to BTK compounds) and OCI-LY3 (insensitive to BTK compounds) cells were incubated with the corresponding compounds at 37 ° C and 5% CO2 for 72 h. Resazurin is a non-toxic, cell-permeable substrate that is actually non-fluorescent. After entering living cells, resazurin (Sigma, #R7017) is reduced to highly fluorescent resorufin. Metabolic activity was assessed by measuring the fluorescence signal (excitation spectrum 530 nm; emission spectrum 600 nm).

[1176] TMD8 and OCI-Ly3 cells were seeded in triplicate in 96-well plates (Costar #3904) on day 0 at a cell density of 1×10 cells per 150 μl / well. 4 cells. To assess the basal metabolic activity of the two cell lines at the beginning of the experiment, additional plates were prepared. For these reference plates, resazurin (Sigma, #R7017) was added to a final concentration of 13 μg / ml 3 h after inoculation and incubated at 37 ° C and 5% CO2 for 2 h. After incubation, the fluorescence signal intensity of the 96-well plate was measured at 530 / 600 nm on a Mithras LB940 multimode plate reader (Berthold Technologies, Germany).

[1177] In parallel, 3h after inoculation, the test plate was treated with various concentrations of compound or vehicle (DMSO) alone for 3 days. The compound was added to the plate using an HP D300 digital dispenser (TECAN, Switzerland). The compound was tested in triplicate with 8-point serial dilutions (1:4), with the starting concentrations of OCI-LY3 and TMD8 cells being 10 μM and 1 μM, respectively. In order to assess the relative proliferation of the cells, resazurin was added directly to each well of the culture medium to a final concentration of 13 μg / ml. The plate was incubated at 37°C and 5% CO2 for 2h to produce a 72h endpoint. After incubation, the fluorescence signal intensity of the 96-well plate was measured at 530 / 600nm (Berthold Technologies, Germany) on a MithrasLB940 multimode plate reader. The formation of resorufin dye is directly related to the number of metabolically active cells. For each triplicate treatment, the mean and standard deviation were calculated and analyzed by curve fitting software to determine the respective compound concentrations that gave 50% growth inhibition (GI 50 ) value. For each compound, GI 50 Values were typically determined from at least 2 completely independent experiments.

[1178] OCI-LY3 cells were obtained through a license agreement with University Health Network, Toronto, Canada. Cells were cultured in RPMI1640 medium (Gibco, #61870-010, batch 1894759) supplemented with 10% FCS (HyClone, GE#SH30066.03, batch AB217603), 2 mM L-glutamine (BioConcept, #5-10K50-H, batch LA03467P), 1 mM sodium pyruvate (BioConcept, #5-60F00-H, batch LB10510P), 10 mM HEPES (Gibco, #15630-056, batch 1854074), 1% Pen / Strep (BioConcept, #4-01F00-H, batch LB04235P).

[1179] TMD8 cells were obtained through a license agreement with Tokyo Medical and Dental University, Japan. Cells were cultured in MEM Alpha medium (Bioconcepts, #1-23F01-I, batch LB04262P) supplemented with 10% FCS (HyClone, GE#SH30066.03, batch AB217603), 2 mM L-glutamine (Bioconcepts, #5-10K50-H, batch LA03467P), and 1% Pen / Strep (Bioconcepts, #4-01F00-H, batch LB04235P).

[1180]

[1181] nd = not determined

[1182]

Claims

1. A compound of formula (XXIa) or a salt thereof, in: R 6 is selected from H and F; and R 7 Selected from H, F, Cl, -CH3, -OCH3 and -OCH2CH3.

2. The compound or salt thereof according to claim 1, wherein R 6 It's F.

3. The compound or salt thereof according to claim 1, wherein R 7 Selected from F, Cl, -CH3, -OCH3 and -OCH2CH3.

4. The compound according to claim 1 or a salt thereof, which is or a salt thereof.

Images