A peptide with wrinkle-improving activity and its uses
By developing peptides composed of amino acid sequences of SEQ ID NO: 1, 2, 3 or 4, the proliferation and activity of fibroblasts are promoted, thus solving the problems of skin wrinkles and extrinsic aging, and achieving skin improvement and disease treatment effects.
Patent Information
- Application Number
- CN202311152562.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2017-08-31
- Filing Date
- 2018-07-03
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2038-07-03
AI Technical Summary
Existing technologies are insufficient to effectively improve skin wrinkles caused by aging, and extrinsic aging cannot be effectively prevented or treated by artificial means.
Develop peptides consisting of amino acid sequences of SEQ ID NO: 1, 2, 3 or 4 that can enhance skin barrier function and inhibit external stimuli by promoting fibroblast proliferation and activity, increasing the expression of extracellular matrix proteins.
It significantly improves skin wrinkles, promotes skin regeneration, enhances skin elasticity, inhibits aging, heals wounds, whitens skin, and prevents or treats skin diseases such as psoriasis, atopic dermatitis, and xerosis.
Smart Images

Figure CN117186180B_ABST
Abstract
Description
[0001] This application is a divisional application of the same invention patent application 201880056604.4, filed on July 3, 2018. [Technical Field]
[0002] This invention relates to a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3 or 4; a pharmaceutical composition comprising the peptide for the prevention or treatment of skin diseases; a cosmetic composition comprising the peptide for improving skin condition; a food composition comprising the peptide for improving skin condition; a method of using the peptide to prevent or treat skin diseases; and the use of the peptide for the prevention, treatment of skin diseases or improvement of skin condition. [Background Technology]
[0003] Human skin is constantly changing, most notably due to the decline in skin function and visual appeal caused by aging. Skin aging is mainly divided into endogenous aging caused by genetic factors and exogenous aging caused by external environmental factors such as sunlight.
[0004] Aging leads to the formation of wrinkles on the skin. Typical factors contributing to wrinkle formation include reactive oxygen species, ultraviolet radiation, and reduced collagen biosynthesis. While endogenous aging of the skin cannot be controlled, extrinsic aging can be prevented, treated, or delayed by scavenging reactive oxygen species, promoting fibroblast proliferation, and facilitating collagen biosynthesis. [Summary of the Invention]
[0005] [Technical Issues]
[0006] The present invention is the result of the inventors’ efforts to develop superior peptides with biologically effective activity, and it has been found that peptides including the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 can be effectively used to improve skin wrinkles.
[0007] Therefore, the object of the present invention is to provide a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
[0008] Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of skin diseases, comprising at least one peptide selected from the amino acid sequence of SEQ ID NO: 1 or 2.
[0009] Another object of the present invention is to provide a cosmetic composition for improving skin condition, comprising at least one peptide selected from the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
[0010] Another object of the present invention is to provide a food composition for improving skin condition, comprising at least one peptide selected from the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
[0011] Another object of the present invention is to provide a method for preventing or treating skin diseases using a peptide composed of an amino acid sequence of SEQ ID NO: 1 or 2.
[0012] Another object of the present invention is to provide the use of a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 in improving skin condition.
[0013] Another object of the present invention is to provide the use of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 or 2 in the prevention or treatment of skin diseases.
[0014] [Technical Solution]
[0015] This invention relates to a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3 or 4; a pharmaceutical composition comprising the peptide for the prevention or treatment of skin diseases; a cosmetic composition comprising the peptide for improving skin condition; a food composition comprising the peptide for improving skin condition; a method of using the peptide to prevent or treat skin diseases; and the use of the peptide for the prevention, treatment of skin diseases or improvement of skin condition.
[0016] A typical characteristic of skin wrinkles is the suppression of levels of collagen, elastin, and fibronectin, which are extracellular matrix proteins (ECM) that make up the dermis.
[0017] To demonstrate its effect in improving skin wrinkles, it should show an increase in ECM molecule expression by promoting the proliferation and activity of fibroblasts, the main cells constituting the dermis. To confirm the peptide's efficacy, MTT assays, MAPK and AKT phosphorylation level assays (as key signaling molecules related to cell proliferation, their active form is phosphorylated), and collagen, elastin, and fibronectin expression assays (mRNA levels confirmed by RT-PCR and protein levels confirmed by ELISA) were performed, confirming the positive effects of these peptides.
[0018] In addition, by observing the effects of promoting the proliferation of keratinocytes, which are components of the epidermis, and increasing the expression of HA, AQP3, and SIRT1, it was confirmed that this peptide also has the effect of inhibiting external stimuli by enhancing the barrier.
[0019] The invention will now be described in more detail.
[0020] One aspect of the present invention relates to a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
[0021] The peptide may be induced with N-terminal and / or C-terminal modifications to select certain sites in the amino acid sequence and increase its activity. These N-terminal and / or C-terminal modifications can significantly improve the stability of the peptide in this invention, for example, by increasing the half-life of the peptide when administered in vivo.
[0022] The N-terminal modification can be achieved by binding a protecting group selected from acetyl group, fluoreonylmethoxycarbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group, and polyethylene glycol (PEG) to the N-terminus of the peptide.
[0023] The C-terminal modification can be, but is not limited to, binding a hydroxyl group (-OH), an amino group (-NH2), an azide group (-NHNH2), etc., to the C-terminus of the peptide.
[0024] The protecting group is used to protect the peptides of the present invention from attack by protein-cleaving enzymes in vivo.
[0025] Another aspect of the present invention relates to a pharmaceutical composition for the prevention or treatment of skin diseases, comprising at least one peptide selected from the amino acid sequence of SEQ ID NO: 1 or 2.
[0026] The skin diseases mentioned can include, but are not limited to, psoriasis, atopic dermatitis, non-allergic dermatitis, and xerosis.
[0027] The pharmaceutical composition may include a pharmaceutically effective amount of at least one peptide selected from the amino acid sequence of SEQ ID NO: 1 or 2.
[0028] In addition, the pharmaceutical composition may further include a pharmaceutically acceptable carrier.
[0029] Pharmaceutically acceptable carriers are commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th edition, 1995).
[0030] In addition to the ingredients described above, the pharmaceutical compositions of the present invention may further include, but are not limited to, lubricants, humectants, sweeteners, flavorings, emulsifiers, suspending agents, preservatives, etc.
[0031] The pharmaceutical composition can be administered orally or non-orally, preferably non-oral. For non-oral administration, it can be carried out by, but is not limited to, intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, local administration, transdermal administration, etc.
[0032] The daily dose of the pharmaceutical composition may be, but is not limited to, 0.0001 μg to 1000 μg, 0.001 μg to 1000 μg, 0.01 to 1000 μg, 0.1 to 1000 μg, or 1.0 μg to 1000 μg, and may be prescribed in various ways according to factors such as formulation method, route of administration, patient's age, weight, sex, pathological condition, food, administration time, route of administration, excretion rate, and response sensitivity.
[0033] The pharmaceutical composition can be prepared by means of a pharmaceutically acceptable carrier and / or excipient and in unit dose form or in a multi-dose container, according to methods readily available to those skilled in the art.
[0034] The dosage form may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extractant, powder, granules, tablet or capsule, and may further include a dispersant and / or a stabilizer.
[0035] Another aspect of the present invention relates to a food composition for improving skin condition, comprising at least one peptide selected from the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 as an active ingredient.
[0036] The improvement of skin condition refers to, but is not limited to, improving wrinkles, regenerating skin, improving skin elasticity, inhibiting skin aging, healing wounds, improving acne, or whitening skin.
[0037] The food mentioned can be various foods, beverages, food additives, etc.
[0038] As an active ingredient contained in the food composition, the content of peptides is appropriately selected according to the form of the food, intended use, etc., and is not particularly limited. For example, it can be added at a ratio of 0.01% to 15% by weight of the total weight of the food. In health beverage compositions, it can be added at a ratio of 0.02g to 10g per 100ml, preferably at a ratio of 0.3g to 1g.
[0039] When the food is a beverage, there are no special restrictions on the liquid components, except that peptides are included as a necessary ingredient in a specified proportion, and various flavorings or natural carbohydrates can be included as additional ingredients, just like ordinary beverages.
[0040] The natural carbohydrates are monosaccharides, such as glucose and fructose; disaccharides, such as maltose and sucrose; and polysaccharides, such as dextrin and cyclodextrin; as well as sugar alcohols, such as xylitol, sorbitol, and erythritol.
[0041] As flavoring agents other than the flavoring agents mentioned above, natural flavoring agents (kiwifruit protein), stevia extracts (such as rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used effectively. The proportion of the natural carbohydrates is usually about 1g to 20g per 100ml of the composition of the present invention, preferably about 5g to 12g.
[0042] In addition to the above, the food composition of the present invention may include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and flavor enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.
[0043] Additionally, the food compositions of the present invention may include fruit pulp used in the preparation of natural fruit juices and fruit juice beverages and vegetable beverages. The components may be used alone or in combination. The proportions of these additives are not particularly important, but are generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the compositions of the present invention.
[0044] Another aspect of the present invention relates to a cosmetic composition for improving skin condition, comprising at least one peptide selected from the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
[0045] The improvement of skin condition refers to, but is not limited to, improving wrinkles, regenerating skin, improving skin elasticity, inhibiting skin aging, healing wounds, improving acne, or whitening skin.
[0046] The cosmetic composition may include, but is not limited to, (a) a cosmetically effective amount of the peptides of the present invention described above; and / or (b) a cosmetically acceptable carrier.
[0047] As used in this specification, the term "cosmetic effective amount" refers to an amount sufficient to achieve the above-described effects of improving the skin condition of the compositions of the present invention.
[0048] The cosmetic composition can also be prepared into any dosage form commonly prepared in the art, such as solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansers, oils, powder foundations, emulsion foundations, wax foundations, and sprays, but is not limited thereto. More specifically, it can be prepared into dosage forms such as softening lotions, nourishing lotions, nourishing creams, massage creams, serums, eye creams, cleansing creams, facial cleansers, makeup removers, masks, sprays, or powders.
[0049] When the cosmetic dosage form of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, amine gum, cellulose derivatives, polyethylene glycol, silicon, bentonite, silica, talc or zinc oxide, etc., can be used as carrier components.
[0050] When the cosmetic dosage form of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder can be used as carrier components. In particular, when it is a spray, it may also include propellants such as chlorofluorocarbons, propane / butane or dimethyl ether.
[0051] When the cosmetic dosage form of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylethylene glycol oil, glycerol fatty acid ester, polyethylene glycol or fatty acid ester of sorbitol.
[0052] When the cosmetic dosage form of the present invention is a suspension, liquid diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitan ester and polyoxyethylene sorbitan anhydride ester, microcrystalline cellulose, methyl aluminum hydroxide, bentonite, agar or amine yellow gum, etc. can be used.
[0053] When the cosmetic formulation of the present invention is a surfactant-containing cleanser, fatty alcohol sulfates, fatty alcohol ether sulfates, sulfosuccinate monoesters, hydroxyethyl sulfonates, imidazoline derivatives, methyl taurine, sarcosinate, fatty acid amide ether sulfates, alkylamide betaine, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, or ethoxylated glycerol fatty acid esters can be used as carrier components.
[0054] In addition to peptides and carrier components that serve as active ingredients, the cosmetic compositions of the present invention may also include commonly used ingredients in cosmetic compositions, such as conventional additives like oxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances.
[0055] The term "improved skin condition" as used in this instruction manual refers to a comprehensive description of the process or effect of treating, reducing or alleviating skin damage caused by internal or external factors of the skin, such as, but not limited to, exhibiting effects such as reducing or improving inflammation occurring in the skin.
[0056] Another aspect of the present invention relates to the use of a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 in improving skin condition.
[0057] The improvement of skin condition refers to, but is not limited to, improving wrinkles, regenerating skin, improving skin elasticity, inhibiting skin aging, healing wounds, improving acne, or whitening skin.
[0058] Another aspect of the present invention relates to the use of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 or 2 in the prevention or treatment of skin diseases.
[0059] The skin diseases mentioned can include, but are not limited to, psoriasis, atopic dermatitis, non-allergic dermatitis, and xerosis.
[0060] The peptide composed of the amino acid sequence of SEQ ID NO: 1 or 2 is the same as described above.
[0061] As used in this specification, the term "peptide" refers to a linear molecule formed by amino acid residues linked together by peptide bonds. The peptides of this invention can be prepared according to chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid-phase synthesis techniques (U.S. Patent No. 5516891).
[0062] As used in this specification, the term "stability" refers to in vivo stability and storage stability (e.g., room temperature storage stability).
[0063] The term "pharmaceutical effective amount" as used in this instruction manual refers to an amount sufficient to achieve the efficacy or activity of the aforementioned peptide.
[0064] [Beneficial Effects]
[0065] This invention relates to a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3 or 4; a pharmaceutical composition comprising the peptide for the prevention or treatment of skin diseases; a cosmetic composition comprising the peptide for improving skin condition; a food composition comprising the peptide for improving skin condition; a method of using the peptide to prevent or treat skin diseases; and the use of the peptide for the prevention, treatment of skin diseases or improvement of skin condition. [Attached Image Description]
[0066] Figure 1 A graph showing the results of promoting fibroblast proliferation of peptides according to embodiments of the present invention, wherein the peptides consist of the amino acid sequence of SEQ ID NO: 1.
[0067] Figure 2 A graph showing the results of promoting fibroblast proliferation of peptides according to embodiments of the present invention, wherein the peptides consist of the amino acid sequence of SEQ ID NO: 2.
[0068] Figure 3 A graph showing the results of promoting fibroblast proliferation of peptides according to embodiments of the present invention, wherein the peptides consist of the amino acid sequence of SEQ ID NO: 3.
[0069] Figure 4 A graph showing the results of promoting fibroblast proliferation of peptides according to embodiments of the present invention, wherein the peptides consist of the amino acid sequence of SEQ ID NO: 4.
[0070] Figure 5 A graph showing the results of evaluating the peptide that promotes keratinocyte proliferation according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 1.
[0071] Figure 6 A graph showing the results of evaluating the peptide that promotes keratinocyte proliferation according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 2.
[0072] Figure 7 A graph showing the results of evaluating the peptide that promotes keratinocyte proliferation according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 3.
[0073] Figure 8 A graph showing the results of evaluating the peptide that promotes keratinocyte proliferation according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 4.
[0074] Figure 9 A photograph showing the results of measuring the phosphorylation level of MAPK (AKT-removed) in fibroblasts of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 1.
[0075] Figure 10 The photograph shows the results of measuring the phosphorylation level of MAPK (AKT-removed) in fibroblasts of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 2.
[0076] Figure 11 A photograph showing the results of measuring the phosphorylation levels of MAPK and AKT in fibroblasts of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 3.
[0077] Figure 12 A photograph showing the results of measuring the phosphorylation levels of MAPK and AKT in fibroblasts of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 4.
[0078] Figure 13 A photograph showing the results of measuring the phosphorylation level of MAPK (AKT-removed) in keratinocytes of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 1.
[0079] Figure 14 A photograph showing the results of measuring the phosphorylation level of MAPK (AKT-removed) in keratinocytes of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 2.
[0080] Figure 15 The photograph shows the RT-PCR results of collagen 1a, fibronectin and elastin of the peptide according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 1.
[0081] Figure 16 The photograph shows the RT-PCR results of collagen 1a, fibronectin and elastin of the peptide according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 2.
[0082] Figure 17 The photograph shows the RT-PCR results of collagen 1a, fibronectin and elastin of the peptide according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 3.
[0083] Figure 18 The photograph shows the RT-PCR results of collagen 1a, fibronectin and elastin of the peptide according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 4.
[0084] Figure 19 The image shows the RT-PCR results of aquaporin 3 (AQP3) peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 1.
[0085] Figure 20 A photograph showing the RT-PCR results of SIRT1 of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 1.
[0086] Figure 21 The image shows the RT-PCR results of aquaporin 3 (AQP3) peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 2.
[0087] Figure 22 A photograph showing the measurement results of collagen Ia expression of a peptide according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 1.
[0088] Figure 23 A photograph showing the measurement results of fibronectin expression level of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 1.
[0089] Figure 24A photograph showing the elastin expression level measurement results of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 1.
[0090] Figure 25 A photograph showing the measurement results of collagen Ia expression of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 2.
[0091] Figure 26 A photograph showing the measurement results of fibronectin expression level of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 2.
[0092] Figure 27 A photograph showing the elastin expression level measurement results of a peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 2.
[0093] Figure 28 The photograph shows the ELISA results of the peptide, which is composed of the amino acid sequence of SEQ ID NO: 1, according to an embodiment of the present invention.
[0094] Figure 29 A photograph showing the ELISA results of the peptide for procollagen 1a according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 2.
[0095] Figure 30 A photograph showing the ELISA results of the peptide for procollagen 1a according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 3.
[0096] Figure 31 A photograph showing the ELISA results of the peptide for procollagen 1a according to an embodiment of the present invention, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 4.
[0097] Figure 32 The photograph shows the HA ELISA results of the peptide according to an embodiment of the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 2.
[0098] [Best Implementation Method]
[0099] This invention relates to peptides consisting of amino acid sequences of SEQ ID NO: 1, 2, 3 or 4.
Detailed Implementation Methods
[0100] The present invention will now be described in more detail through the following embodiments. However, these embodiments are merely for illustrative purposes, and the scope of the invention is not limited to these embodiments.
[0101]
Synthesis Example 1: Peptide Synthesis
[0102] 70 g of Chloro trityl chloride resin (CTC resin, Novabiochem Cat No. 01-64-0021) was added to a reactor, followed by 490 ml of methylene chloride (MC) and stirring for 3 minutes. The solution was then removed, and 490 ml of dimethylformamide (DMF) was added and stirred for 3 minutes, followed by another solvent removal. Next, 700 ml of dichloromethane solution was added to the reactor, along with 200 mmol of Fmoc-Tyr(tBu)-OH (Bachem, Switzerland) and 400 mmol of diisopropylethylamine (DIEA). The solution was stirred until fully dissolved and reacted with stirring for 1 hour. Following washing, methanol and DIEA (2:1) were dissolved in dichloromethane (DCM), reacted for 10 minutes, and washed with excess DCM / DMF (1:1). Then, the solution was removed, 490 ml of dimethylformamide (DMF) was added, and the mixture was stirred for 3 minutes, followed by further solvent removal. 700 ml of the deprotection solution (20% piperidine / DMF) was added to the reaction vessel, and the mixture was stirred at room temperature for 10 minutes to remove the solution. The same amount of deprotection solution was added, and the reaction was maintained for another 10 minutes. The solution was then removed, and the mixture was washed twice with DMF, once with MC, and once with DMF for 3 minutes each time to prepare Tyr(tBu)-CTC resin (Resin).
[0103] Add 700 ml of DMF solution to a new reactor, then add 200 mmol of Fmoc-Arg(Pbf)-OH (Bachem, Switzerland), 200 mmol of HoBt, and 200 mmol of HBTu, and stir until fully dissolved. Add 400 mmol of DIEA to the reactor in two portions, stirring for at least 5 minutes each time until all solids are dissolved. Place the dissolved amino acid mixture in a reaction vessel with deprotected resin and react at room temperature with stirring for 1 hour. Remove the reaction solution, stirring three times with DMF solution for 5 minutes each time. Take a small amount of the reaction resin and check the degree of reaction using the Kaiser test (Ninhydrin Test). Perform the deprotection reaction twice with the deprotection solution as described above to prepare Arg(Pbf)-Tyr(tBu)-CTC resin. After thorough washing with DMF and MC, perform the Kaiser test again, and then perform the following amino acid adhesion experiment as described above. Based on the selected amino acid sequences, chain reactions were carried out in the order of Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Trp-OH, and Fmoc-Lys(Boc)-OH. The Fmoc-protecting group was reacted twice with a deprotecting solution for 10 minutes each time, followed by thorough washing and removal. The peptide resin was washed three times with DMF, MC, and methanol, respectively, and dried by slow purging with nitrogen. After complete drying under vacuum (P2O5), 1900 ml of a deprotecting solution [81.5% trifluoroacetic acid, 5.0% distilled water, 5.0% thioanisole, 5.0% phenol, 2.5% ethylenedithiol (EDT), and 1.0% triisopropylsilane (TIS)] was added, and the reaction was maintained by shaking at room temperature for 2 hours. The resin was filtered off and washed with a small amount of TFA solution, then combined with the mother liquor. Cold diethyl ether was added to 2090 ml of the combined mother liquor to induce precipitation, and the precipitate was collected by centrifugation and washed twice more with cold diethyl ether. The mother liquor was removed and the mixture was thoroughly dried under nitrogen to synthesize 79.8 g of the peptide consisting of SEQ ID NO: 1 (yield: 97.0%) prior to purification. The molecular weight was measured using a molecular weight analyzer, yielding a molecular weight of 822.9 (theoretical value: 822.9).
[0104] Peptides consisting of the amino acid sequences of SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 were also synthesized using the same method as described above.
[0105] Table 1
[0106]
[0107] [Example 1: Evaluation of the promotion of fibroblast proliferation]
[0108] Mouse fibroblasts NIH3T3 were used at 5 x 10 3 Cells were seeded at a density of 100 nM in 96-well plates and cultured overnight. Then, after changing to serum-containing media (0.05% serum), the cells were treated with 10 μM or 50 μM of 100 nM basic fibroblast growth factor (bFGF) and a peptide consisting of the amino acid sequences of SEQ ID NO: 1, 2, 3, or 4 as a positive control and cultured for 3 days. The cells were then treated with 4 mg / ml MTT solution and reacted for 4 hours. Next, the generated formazan was dissolved by treatment with dimethyl sulfoxide (DMSO), and the absorbance at 560 nm was measured using a microplate reader. The results are shown below. Figures 1 to 4 As shown in Table 2.
[0109] Table 2: Fibroblast proliferation (%)
[0110]
[0111] from Figures 1 to 4 As shown in Table 2, the efficacy of promoting fibroblast proliferation of peptides composed of the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 has been confirmed.
[0112] [Example 2: Evaluation of the promotion of keratinocyte proliferation]
[0113] Human keratinocytes HaCaT were used at 3x10 5 Cells were seeded at a density of 10 nM in 6-well plates and cultured overnight. Then, after changing to serum-containing media (0.05% serum), the cells were treated with 10 nM epidermal growth factor (EGF) as a positive control and a peptide consisting of the amino acid sequences of SEQ ID NO: 1, 2, 3, or 4 at 10 μM or 50 μM and cultured for 3 days. The cells were then treated with 4 mg / ml MTT solution and reacted for 4 hours. Next, the generated formazan was dissolved by treatment with dimethyl sulfoxide (DMSO), and the absorbance at 560 nm was measured using a microplate reader. The results are shown below. Figures 5 to 8 As shown in Table 3.
[0114] Table 3: Keratinocyte proliferation (%)
[0115]
[0116]
[0117] [Example 3: Measurement of phosphorylation levels of MAPK and AKT]
[0118] 3-1. Fibroblasts
[0119] Mouse fibroblasts NIH3T3 were used at 5 x 10 3 Cells were seeded at a density of 100 nMbFGF in 6-well plates and cultured overnight. Then, after changing to 0.05% FBS-containing medium, the cells were treated with 10 μM or 50 μM of positive control 100 nMbFGF and a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3, or 4 and cultured for 30 minutes. Cell lysates were prepared by cell recovery. Next, Western blotting was performed using P-MAPK (p-Erk, p-JNK, p-p38), p-Akt, or actin antibodies (Santacruz Biotechnology, USA) to compare phosphorylation patterns. The results are as follows: Figures 9 to 12 As shown.
[0120] like Figures 9 to 12 As shown, peptides consisting of amino acid sequences of SEQ ID NO: 1, 2, 3 or 4 were confirmed to promote proliferation by activating MAPK (ERK, p38, JNK) and AKT, which are signaling factors associated with fibroblast proliferation.
[0121] 3-2. Keratinocytes
[0122] Human keratinocytes HaCaT were used at 3x10 5 Cells were seeded at a density of 10 nM in 6-well plates and cultured overnight. Then, after changing to 0.05% FBS-containing medium, the cells were treated with 10 nM EGF (positive control) and a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 at 10 μM or 50 μM and cultured for 30 minutes. Cell lysates were prepared by cell recovery. Next, Western blotting was performed using P-MAPK (p-Erk, p-JNK, p-p38) and p-Akt antibodies (Santacruz Biotechnology, USA) to compare phosphorylation patterns. The results are shown below. Figure 13 and Figure 14 As shown.
[0123] like Figure 13 and Figure 14 As shown, the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 was confirmed to promote proliferation by activating ERK and p38, which are signaling factors associated with human keratinocyte proliferation.
[0124] [Example 4: RT-PCR of Collagen 1a, fibronectin, and elastin]
[0125] Mouse fibroblasts NIH3T3 were used at 5 x 10 3 Cells were seeded at a density of 100 nM in 6-well plates and cultured overnight. Then, the medium was replaced with 0.05% FBS and cultured for 4 hours. Cells were then treated with 10 μM or 50 μM of 100 nM insulin-like growth factor (IGF)-1 (as a positive control) and a peptide consisting of the amino acid sequences of SEQ ID NO: 1, 2, 3, or 4 and cultured for 24 hours. RNA was isolated by cell recovery. After RNA quantification, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea), and PCR was performed using PCR premix (Intron, Korea) and the respective primers for collagen 1a, fibronectin, elastin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) listed in Table 4 below. Next, the mRNA expression levels of the growth factors under each peptide treatment condition were compared by electrophoresis on a 5% agarose gel, and the results are shown below. Figures 15 to 18 As shown.
[0126] Table 4
[0127] SEQ ID NO: Primers Sequence (5'-3') 5 Collagen 1a_F CACCCTCAAGAGCCTGAGTC 6 Collagen 1a_R AGACGGCTGAGTAGGGAACA 7 Fibronectin_f CCAGGAACCGAGTACACCAT 8 Fibronectin_R ATACCCAGGTTGGGTGATGA 9 Elastin_F GGACCCCTGACTCGCGACCT 10 Elastin_R GGGGAGGTGGGACTGCCCAA 11 Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)_F GGTGTGAACGGATTTGGCCGTATTG 12 Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)_R CCGTTGAATTTGCCGTGAGTGGAGT
[0128] As in Figures 15 to 18 As can be seen, the peptide composed of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 has been confirmed to have the effect of increasing the expression of collagen, fibronectin and elastin mRNA, which are components of ECM, by promoting fibroblast activity.
[0129] [Example 5: Aquaporin 3 (AQP3) and SIRT1 RT-PCR]
[0130] Human keratinocytes HaCaT were used at 3x10 5Cells were seeded at a density of 100 nM EGF in 6-well plates and cultured overnight. Then, the medium was replaced with 0.05% FBS and cultured for 4 hours. Positive control group was treated with 100 nM EGF and peptides consisting of the amino acid sequence of SEQ ID NO: 1 or 2 at 10 μM and 50 μM, respectively, and cultured for 24 hours. RNA was isolated by cell recovery. After RNA quantification, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea), and PCR was performed using PCR premix (Intron, Korea) and the respective primers for AQP3, SIRT1, and GAPDH listed in Table 5 below. Next, the mRNA expression levels of the growth factors under each peptide treatment condition were compared by electrophoresis on a 5% agarose gel, and the results are shown below. Figures 19 to 21 As shown.
[0131] Table 5
[0132] SEQ ID NO: Primers Sequence (5'-3') 13 Aquaporin 3 (AQP3)_F CCTTCTTGGGTGCTGGAATA 14 Aquaporin 3 (AQP3)_R ACACGATAAGGGAGGCTCTG 15 SIRT1_F TCAGTGGCTGGAACAGTGAG 16 SIRT1_R TCTGGCATGTCCCACTATCA
[0133] As in Figures 19 to 21 As can be seen, the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 was confirmed to have the effect of increasing the expression of AQP3, a protein associated with skin barrier enhancement, by promoting keratinocyte activity.
[0134] [Example 6: Measurement of collagen 1a, fibronectin and elastin expression levels]
[0135] Mouse fibroblasts NIH3T3 were used at 5 x 10 3 Cells were seeded at a density of 100 nM bFGF in 6-well plates and cultured overnight. Then, after changing to serum-free media, the positive control group was treated with 100 nM bFGF and 10 μM or 50 μM of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 and cultured for 24 hours, followed by fixation with 4% paraformaldehyde for 30 minutes. Next, after washing three times, the cells were reacted with 0.5% Triton X-100 for 15 minutes, followed by three more washes. Then, the cells were blocked with 3% BSA for 1 hour, and primary antibodies (1:100) against collagen 1a, fibronectin, and elastin were incubated overnight at 4°C. Subsequently, secondary antibodies (1:500) were incubated at room temperature for 2 hours, followed by DAPI staining and observation under a fluorescence microscope. The results are shown below. Figures 22 to 27 As shown.
[0136] As in Figures 22 to 27As can be seen, the peptide composed of the amino acid sequence of SEQ ID NO: 1 or 2 was confirmed to have the effect of increasing the expression of collagen, fibronectin and elastin, which are components of ECM, by promoting fibroblast activity.
[0137] [Example 7: Procollagen 1a ELISA]
[0138] Mouse fibroblasts NIH3T3 were used at 5 x 10 3 Cells were seeded at a density of 100 nM IGF-1 in 6-well plates and cultured overnight. The medium was then replaced with 0.05% FBS and cultured for 4 hours. The positive control group was treated with 100 nM IGF-1 and a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3, or 4, and cultured for 72 hours before the medium was recovered. The concentration in the medium was measured using a procollagen 1a ELISA kit (Usbiological lifescience, USA), and the results are as follows: Figures 28 to 31 As shown in Table 6.
[0139] Table 6: Precollagen 1a expression (%)
[0140]
[0141] As in Figures 28 to 31 As can be seen in Table 6, when peptides consisting of amino acid sequences of SEQ ID NO: 1, 2, 3 or 4 were processed, increased expression of procollagen 1a protein in fibroblasts was confirmed.
[0142] Example 9: HA ELISA
[0143] Human keratinocytes HaCaT were used at 3x10 5 Cells were seeded at a density of 100 nM IGF-1 in 6-well plates and cultured overnight. The medium was then replaced with 0.05% FBS and cultured for 4 hours. The positive control group was treated with 100 nM IGF-1 and a peptide consisting of the amino acid sequence of SEQ ID NO: 2, and cultured for 72 hours before the medium was recovered. The concentration in the medium was measured using an HA ELISA kit (Echelon, USA), and the results are as follows: Figure 32 As shown in Table 7.
[0144] Table 7: HA Expression (ng / ml)
[0145]
[0146] As in Figure 32 As can be seen in Table 7, the peptide consisting of the amino acid sequence of SEQ ID NO: 2 was confirmed to have the effect of increasing the expression of HA, a protein associated with skin barrier enhancement, by promoting keratinocyte activity.
[0147] [Industrial Applicability]
[0148] This invention relates to a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3 or 4; a pharmaceutical composition comprising the peptide for the prevention or treatment of skin diseases; a cosmetic composition comprising the peptide for improving skin condition; a food composition comprising the peptide for improving skin condition; a method of using the peptide to prevent or treat skin diseases; and the use of the peptide for the prevention, treatment of skin diseases or improvement of skin condition.
[0149] This instruction manual also includes the following:
[0150] 1. A peptide having skin-improving activity, comprising an amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
[0151] 2. The peptide according to Embodiment 1, wherein improving skin condition refers to improving wrinkles, regenerating skin, improving skin elasticity, inhibiting skin aging, healing wounds, improving acne, or whitening skin.
[0152] 3. A cosmetic composition for improving skin condition, comprising at least one peptide selected from the amino acid sequence of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 2, the amino acid sequence of SEQ ID NO: 3, and the amino acid sequence of SEQ ID NO: 4.
[0153] 4. The cosmetic composition according to Embodiment 3, wherein the improvement of skin condition refers to improving wrinkles, regenerating skin, improving skin elasticity, inhibiting skin aging, healing wounds, improving acne, or whitening skin.
[0154] 5. A pharmaceutical composition for the prevention or treatment of skin diseases, comprising at least one peptide selected from the amino acid sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2.
[0155] 6. The pharmaceutical composition according to Embodiment 5, wherein the skin disease refers to psoriasis, atopic dermatitis, non-allergic dermatitis, and xerosis.
[0156] 7. A food composition for improving skin condition, comprising at least one peptide selected from the amino acid sequence of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 2, the amino acid sequence of SEQ ID NO: 3, and the amino acid sequence of SEQ ID NO: 4.
[0157] 8. The food composition according to embodiment 7, wherein the improvement of skin condition refers to improving wrinkles, regenerating skin, improving skin elasticity, inhibiting skin aging, healing wounds, improving acne, or whitening skin.
Claims
1. A peptide with skin-improving activity, consisting of the amino acid sequence of SEQ ID NO:
4.
2. The peptide according to claim 1, wherein the improvement of skin condition is to improve wrinkles, regenerate skin, improve skin elasticity, inhibit skin aging, heal wounds, improve acne, or whiten skin.
3. A cosmetic composition for improving skin condition, comprising a peptide consisting of the amino acid sequence of SEQ ID NO:
4.
4. The cosmetic composition according to claim 3, wherein the improvement of skin condition is to improve wrinkles, regenerate skin, improve skin elasticity, inhibit skin aging, heal wounds, improve acne, or whiten skin.
5. A pharmaceutical composition for the prevention or treatment of skin diseases, comprising a peptide consisting of the amino acid sequence of SEQ ID NO:
4.
6. Use of the peptide consisting of the amino acid sequence of SEQ ID NO: 4 in the preparation of a composition for improving skin condition, wherein the improvement of skin condition is to improve wrinkles, regenerate skin, improve skin elasticity, inhibit skin aging, heal wounds, improve acne, or whiten skin.
7. The use according to claim 6, wherein the composition is a cosmetic composition.
Citation Information
Patent Citations
Liquid phase synthesis of peptides and peptide derivatives
US5516891A
Peptide having cytoprotective effect against environmental pollutant and use thereof
CN110461864A