Co-expression of porcine interleukin 15, 21 and 23 in biological preparation materials and their applications

Abstract

The present invention relates to a biopharmaceutical material and application of co-expressed porcine interleukin 15, 21 and 23, and relates to the field of biotechnology. The present invention provides a fusion protein comprising porcine interleukin 15, porcine interleukin 21 and porcine interleukin 23, consisting of an amino acid sequence as shown in SEQ ID NO: 1. A nucleic acid molecule encoding the fusion protein. A biopharmaceutical material comprising an expression cassette, a recombinant vector, a transfected cell, a recombinant microorganism, a culture product of the transgenic cell line or a fermentation product of the recombinant microorganism having the nucleic acid molecule. The present invention obtains a fusion protein by genetic recombination and fusing porcine interleukin 15, 21 and 23 genes, connecting them to a eukaryotic expression platform, and finding that the fusedly expressed IL-15, 21 and 23 have good biological effects of significantly enhancing the mucosal immune barrier function of animals, enhancing their systemic immunity level and anti-bacterial infection ability, and promoting the growth and development of animals.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to porcine interleukin 15, 21 and 23 co-expression biological preparation materials and applications. Background Art

[0002] A large number of antibiotics are widely used in pig farming as feed additives to promote growth and enhance disease resistance. Among these, multidrug-resistant Salmonella, methicillin-resistant Staphylococcus aureus (MRSA), extended-spectrum β-lactam-resistant bacteria, carbapenem-resistant Enterobacteriaceae, and Pseudomonas aeruginosa have garnered significant attention.

[0003] The use of biocontrol technologies as an alternative to antibiotic therapy is crucial for the prevention and treatment of livestock and human diseases and for curbing the prevalence of antibiotic-resistant bacteria.

[0004] Livestock diseases can also be prevented and treated by boosting their immunity. Cytokines play a crucial role in regulating animal immunity. Therefore, cytokine therapy has the potential to replace antibiotics and improve the effectiveness of animal disease prevention and treatment. In light of this, the present invention provides a biological preparation co-expressing porcine interleukins 15, 21, and 23 and its application. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a biological preparation material and application of co-expression of porcine interleukins 15, 21 and 23, with the purpose of replacing antibiotics and improving the prevention and treatment effect of animal diseases.

[0006] In order to solve the above technical problems, the present invention provides a fusion protein in the first aspect, comprising porcine interleukin 15, porcine interleukin 21 and porcine interleukin 23, wherein the fusion protein is any one of the following (a1) to (a4):

[0007] (a1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; In the amino acid sequence shown in NO: 1, positions 1-329 are porcine interleukin IL-23p40 subunit, positions 330-332 are a connecting peptide (GSG), positions 333-350 are T2A self-splicing peptides, positions 351-365 are secretion signal peptides, positions 366-564 are porcine interleukin IL-23p19, positions 565-567 are a connecting peptide (GSG), positions 568-585 are T2A self-splicing peptides, positions 586-600 are secretion signal peptides, positions 601-758 are porcine interleukin IL-21, positions 659-761 are a connecting peptide (GSG), positions 762-779 are T2A self-splicing peptides, positions 780-794 are secretion signal peptides, and positions 781-962 are porcine interleukin IL-15.

[0008] (a2) a protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0009] (a3) a protein that is 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% or more identical to (a1) and has the function of enhancing animal immunity;

[0010] (a4) A protein obtained by replacing, and / or deleting, and / or adding one or more amino acid residues of the protein described in (a1) and having the function of improving the immunity of animals.

[0011] On the basis of the above technical solution, the present invention can also be improved as follows.

[0012] The second aspect provides a nucleic acid molecule encoding the fusion protein as described above.

[0013] Furthermore, the nucleic acid molecule is any one of the following (b1) to (b3):

[0014] (b1) a nucleic acid molecule consisting of the nucleotide sequence shown in SEQ ID NO: 2;

[0015] (b2) a nucleic acid molecule that hybridizes with the nucleic acid molecule defined in (b1) under stringent conditions and encodes the above-mentioned fusion protein;

[0016] (b3) A nucleic acid molecule that has at least 80%, 85%, 90%, 95%, 98%, or 99% homology with the nucleic acid molecule defined in (b1) and encodes the above-mentioned fusion protein.

[0017] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0018] The term "identity" as used above refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated by the naked eye or with computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0019] The third aspect provides a biological preparation material, wherein the biological preparation material is any one of the following (c1) to (c6):

[0020] (c1) An expression cassette containing the aforementioned nucleic acid molecule; the expression cassette refers to a nucleic acid molecule capable of expressing the nucleotide sequence set forth in SEQ ID NO: 2 in a host cell, and the nucleic acid molecule may include both a promoter for initiating gene transcription and a terminator for terminating gene transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0021] (c2) A recombinant vector containing the above-mentioned nucleic acid molecule; the vector may be a plasmid, cosmid, phage or viral vector, specifically a pINA1297 vector.

[0022] (c3) A transgenic cell line containing the aforementioned nucleic acid molecule; the transgenic cell line may specifically be a transgenic cell line obtained by transfecting a mammal with the recombinant vector.

[0023] (c4) A recombinant microorganism containing the aforementioned nucleic acid molecule; the recombinant microorganism may be obtained by introducing the recombinant vector or a linearized fragment of the recombinant vector into a microorganism. The microorganism may be a yeast, bacterium, algae, or fungus. The yeast may be the Yarrowia lipolytica Po1h strain.

[0024] (c5) culture products of the transgenic cell line;

[0025] (c6) a fermentation product of the recombinant microorganism.

[0026] The culture product of the transgenic cell line or the fermentation product of the recombinant microorganism can be prepared according to a method comprising the following steps: culturing the transgenic cell line or the recombinant microorganism to express the encoding gene, thereby obtaining the culture product of the transgenic cell line or the fermentation product of the recombinant microorganism. For example, the culture product of the transgenic cell line can be the supernatant of the expression product; the fermentation product of the recombinant microorganism can be the supernatant of the fermentation broth.

[0027] The fourth aspect provides the use of the above-mentioned fusion protein, the above-mentioned nucleic acid molecule or the above-mentioned biomaterial in the preparation of a product for improving the immune capacity of an animal.

[0028] Furthermore, the improving the animal's immune ability is at least one of the following (d1) to (d8):

[0029] (d1) promoting cellular immunity and / or humoral immunity of effector target animals;

[0030] (d2) Promote the establishment of immune barriers in effector target animals;

[0031] (d3) promoting animal development and growth;

[0032] (d4) Promote the increase of animal immune cells;

[0033] (d5) Promote animal cellular immunity and humoral immunity;

[0034] (d6) Promote the establishment of animal mucosal immune barrier;

[0035] (d7) Anti-pathogenic microbial infection;

[0036] (d8) Promote vaccine-induced immune response.

[0037] Furthermore, the immune cells are lymphocytes (such as T lymphocytes or B lymphocytes), red blood cells or white blood cells; the pathogenic microorganisms are specifically Salmonella typhimurium and Staphylococcus aureus. The antibodies produced after the above immunization are IgG and sIgA.

[0038] Furthermore, the animal is a pig or a mouse.

[0039] The fifth aspect provides a product comprising the fusion protein as described above, the nucleic acid molecule as described above, or the biological preparation material as described above.

[0040] The product can have fusion proteins, nucleic acid molecules, biological preparation materials as active ingredients, or a composition of these and other substances that can improve animal immunity as active ingredients; in addition, product-acceptable carriers and / or excipients can be added.

[0041] Furthermore, the product is a vaccine or a biological preparation. The vaccine may specifically be a vaccine against the aforementioned pathogenic microorganisms. The biological preparation material is a biological drug that improves the immune capacity of animals and treats diseases caused by the aforementioned pathogenic microorganisms.

[0042] The sixth aspect provides a method for improving the immune capacity of an animal, comprising the following steps: administering the product to the animal to improve the immune capacity of the animal; the product comprises the fusion protein as described above, the nucleic acid molecule as described above, or the biological material as described above.

[0043] Experiments have shown that the fermentation products of the fusion protein IL-15 / 21 / 23 molecule and the recombinant yeast containing the IL-15 / 21 / 23 gene of the present invention have the following effects: (1) the application of the recombinant yeast (Po1h-pINA1297-IL-15 / 21 / 23) culture medium significantly increases the proliferation of lymphoblasts; (2) in the Salmonella challenge group, the crypt depth after treatment with the recombinant yeast culture medium is significantly increased compared with the control group and the blank control group, indicating that the recombinant yeast culture medium may increase the growth rate of intestinal crypts to cope with the damage of Salmonella typhimurium to intestinal tissue; (3) in the face of Staphylococcus aureus and Salmonella typhimurium, the crypt depth is significantly increased. Typhimurium) acute infection, the results showed that the expression of IFN-γ and IL-15 at the mRNA level in the mice treated with recombinant yeast culture medium had no significant changes compared with the blank control group, while the expression levels of IL-7, IL-22, IL-23, and TNF-α were significantly increased compared with the blank control group; (4) T lymphocyte differentiation, compared with the blank group and the control group, on the 7th day, the expression of cytotoxic T cells, initial T cells, and central memory T cells (Central Memory T cells, T cells) in the mice treated with recombinant yeast culture medium increased significantly. CM ) increased significantly; the proportion of helper T cells (Helper T cell, T H ), initial T cells, T CM On the 14th day, the proportion of regulatory T cells (T reg ) decreased significantly in 7-28 days, and the effector memory T cells (EffectorMemory T cell, T EM ) and effector T cells (Effector T cell, T eff (4) B lymphocyte differentiation showed that the mice in the recombinant yeast treatment group had higher plasma cells and class-switched memory B cells (B SM ), non-switched memory B cells (Non-switched memory B cell, B NM) ratio; (5) The recombinant yeast-treated mice could more significantly increase the levels of plasma IgG and intestinal sIgA secretion.

[0044] This study, using genetic recombination and fusion of porcine interleukin-15, 21, and 23 genes, linked them to a eukaryotic expression platform to produce a fusion protein. The immunomodulatory effects of the fusion protein and its biological effects in inducing anti-infective activity in mice were further investigated. The results showed that the fused expression of IL-15, 21, and 23 significantly enhanced the immune barrier function of animals, boosting their systemic immunity and resistance to bacterial infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a diagram for verifying the electrophoresis in Example 1 of the present invention;

[0046] Figure 2 This is a graph showing the proliferation activity of pig lymphocytes detected in Example 2 of the present invention;

[0047] Figure 3 This is a graph showing changes in mouse body weight according to Example 3 of the present invention;

[0048] Figure 4 This is a statistical chart of small intestinal tissue sections of mice in each group 14 days after challenge with poison in Example 3 of the present invention;

[0049] Figure 5 This is a graph showing changes in immune-related gene expression levels in small intestinal tissue of mice after challenge with a drug in Example 3 of the present invention;

[0050] Figure 6 This is a diagram showing the differentiation of T lymphocytes in the peripheral blood of mice in Example 3 of the present invention;

[0051] Figure 7 This is a diagram showing the differentiation of B lymphocytes in the peripheral blood of mice in Example 3 of the present invention;

[0052] Figure 8 This is a graph showing changes in IgG levels in mouse plasma and sIgA levels in feces before and after challenge with a virus in Example 3 of the present invention;

[0053] Figure 9 This is a survival curve of mice after virus challenge in Example 3 of the present invention. DETAILED DESCRIPTION

[0054] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0055] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques and conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples are commercially available unless otherwise noted. All recombinant plasmids were verified by sequencing. Unless otherwise noted, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0056] Kunming mice used in the following examples were obtained from the Experimental Animal Center of Sichuan University, with production license number SCXK(Chuan)2018-026. Sichuan-Tibet Black pigs were obtained from the Pig Breeding Research Institute of Sichuan Academy of Animal Science. A 100× penicillin-streptomycin mixture was provided by HyClone. The pINA1297 vector and the Yarrowia lipolytica Po1h strain were both kindly provided by Professor Madzak of the French Academy of Agricultural Sciences and are described in the following literature: Madzak C, Gaillardin C, Beckerich JM. Heterologous protein expression and secretion in the non-conventional alyeast Yarrowia lipolytica: a review. J Biotechnol. 2004 Apr 8; 109(1-2): 63-81. doi: 10.1016 / j.jbiotec.2003.10.027. PMID: 15063615.

[0057] Example 1: Design of Fusion Protein IL-15 / 21 / 23 Encoding Gene and Construction of Recombinant Yarrowia lipolytica and Study of In Vitro Activity I. Design of Fusion Protein IL-15 / 21 / 23 Encoding Gene and Construction of Recombinant Vector

[0058] The porcine (Sus scrofa) IL-15 (Sequence ID: NM_214390.1), IL-21 (Sequence ID: NM_214415.1), IL-23p40 (Sequence ID: NM_214013.1), and IL-23p19 (Sequence ID: NM_001130236.1) gene sequences were obtained from GenBank.

[0059] The flexible peptide sequence GSG, the foot-and-mouth disease virus self-splicing 2A short peptide sequence (P2A), and the yeast secretory signal peptide sequence (XRP2Pre) were selected as fusion gene elements. These elements were used to ligate the porcine IL-23p40, IL-23p19, IL-21, and IL-15 genes, minus their original signal peptides and stop codons. BamHI and KpnI restriction sites were designed at either end of the fusion sequence for ligation into the shuttle vector plasmid pINA1297. These fusion genes were optimized based on the codon preference of Pichia pastoris to ensure normal expression in Y. lipolytica cells. The sequences of the recombinant gene elements are shown in Table 1.

[0060] The resulting fusion gene structure is as follows:

[0061] BamH Ⅰ-IL23p40-6×His-GSG-P2A-XPR2 pre-IL23p19-6×His-GSG-P2A-XPR2pre-IL21-4GSG-IL15-6×His-Kpn Ⅰ.

[0062] Table 1 Recombinant gene element sequence

[0063]

[0064] The fusion gene is named IL-15 / 21 / 23, and its sequence is shown in SEQ ID NO: 2. It is 2889 bp in length, wherein the molecular weight of IL-15 protein is 18.44 kDa; the molecular weight of IL-21 protein is 17.58 kDa; the protein size of IL-23p40 subunit is 336.83 kDa, and the protein size of IL-23p19 is 21.14 kDa. In the nucleotide sequence shown in SEQ ID NO: 2, positions 1-987 are porcine interleukin IL-23p40 subunit, positions 988-996 are a connecting peptide (GSG), positions 997-1050 are a T2A self-splicing peptide, positions 1051-1095 are a secretion signal peptide, positions 1096-1692 are porcine interleukin IL-23p19, and positions 1693-1701 are a connecting peptide (GSG). Positions 1702-1755 are T2A self-splicing peptides, positions 1756-1800 are secretion signal peptides, positions 1801-2274 are porcine interleukin IL-21, positions 2275-2283 are connecting peptides (GSG), positions 2284-2337 are T2A self-splicing peptides, positions 2338-2382 are secretion signal peptides, and positions 2383-2889 are porcine interleukin IL-15.

[0065] The fusion gene IL-15 / 21 / 23 was constructed into the self-cloning shuttle vector pINA1297 to obtain Po1h-pINA1297-IL-15 / 21 / 23. The synthesis of the fusion gene IL-15 / 21 / 23 and the construction of the self-cloning shuttle vector were commissioned to Nanjing GenScript Biotechnology Co., Ltd. The results were verified by 1.5% agarose gel electrophoresis. Figure 1 Lanes 1-8: pINA1297 plasmid digested with BamHI and KpnI; Lane M: DL 5000 DNA marker. The inserted IL-15 / 21 / 23 gene is approximately 2900 bp in size, consistent with the design.

[0066] The amino acid sequence of the fusion protein IL-15 / 21 / 23 is shown in SEQ ID NO: 1. In the amino acid sequence shown in SEQ ID NO: 1, positions 1-329 are porcine interleukin IL-23p40 subunit, positions 330-332 are a connecting peptide (GSG), positions 333-350 are a T2A self-splicing peptide, positions 351-365 are a secretion signal peptide, positions 366-564 are porcine interleukin IL-23p19, positions 565-567 are a connecting peptide (GSG), positions 568-585 are a T2A self-splicing peptide, positions 586-600 are a secretion signal peptide, positions 601-758 are porcine interleukin IL-21, positions 659-761 are a connecting peptide (GSG), positions 762-779 are a T2A self-splicing peptide, positions 780-794 are a secretion signal peptide, and positions 781-962 are porcine interleukin IL-15.

[0067] 2. Transformation of Recombinant Shuttle Vector into E. coli and Identification

[0068] 1. Transformation of Escherichia coli with recombinant shuttle vector

[0069] (1) Take E. coli Top10 competent cells (purchased from Shanghai Weidi Biotechnology), thaw on ice, add 1 μL (10-100 ng) of the recombinant shuttle vector Po1h-pINA1297-IL-15 / 21 / 23 to every 100 μL of thawed competent cells, mix well, and incubate on ice for 30 minutes;

[0070] (2) Heat shock at 42°C for 60 seconds, immediately ice-bath for 5 minutes, add 0.8 mL of Luria-Bertani (LB) medium to the mixture of competent cells and recombinant shuttle vector, culture in a shaker at 37°C for 1 hour, then centrifuge at 6000 rpm for 3 minutes, remove the supernatant (retain about 200 μL of liquid), and suspend the bacterial pellet;

[0071] (3) Use a disposable spreading stick to evenly spread the bacterial solution on LB solid medium containing 20 μg / mL kanamycin (Kana). After culturing upright for 30 minutes, invert the medium and incubate overnight at 37°C. Observe the results the next day.

[0072] 2. Screening and identification of positive clones

[0073] (1) Identify clones carrying the IL-15 / 21 / 23 fusion gene insert from Kana-resistant positive transformants by colony PCR and sequencing;

[0074] (2) Colony PCR was used to identify positive clones. Positive transformants grown on the Kana resistance plate were randomly picked with a sterile pipette tip and placed in a PCR tube. A 25 μL PCR reaction system was prepared in the tube. The PCR system was added according to Table 2 (primer sequences are shown in Table 3). The mixture was mixed by centrifugation, and the PCR cycle program was set according to Table 4 for PCR.

[0075] Table 2 Colony PCR system

[0076] reactants Volume (μL) <![CDATA[ddH2O]]> 18.5 Buffer 2.5 <![CDATA[MgCl2]]> 1.5 4×dNTP 1 Primer 1 0.5 Primer 2 0.5 Taq enzyme 0.5 Colony 1 single colony total 25

[0077] Table 3 PCR primers

[0078] serial number Primer name-size sequence Primer 1 QF-4420bp ATCCATGCATCTTCAACAGCTAGTA Primer 2 QR-4420bp GGTACCTCAATGGTGGTGGTG

[0079] Table 4 PCR program

[0080]

[0081]

[0082] After the PCR reaction, 9 μL of the amplified product was mixed with 1 μL of 10× Loading Buffer for electrophoresis on a 1% agarose gel. Recombinants that were positive by colony PCR were sequenced by Beijing Qingke Xinye Biotechnology Co., Ltd., and the sequencing results were compared using DNAMAN software (version 6.0).

[0083] 3. Construction of recombinant Yarrowia lipolytica

[0084] 1. Preparation and linearization of recombinant plasmid Po1h-pINA1297-IL-15 / 21 / 23

[0085] (1) The positive recombinant E. coli obtained above was inoculated into 5 mL of LB liquid medium containing 3 μg / L Kana and cultured in a shaking incubator at 37°C for 12-16 h;

[0086] (2) Take 1.0-5.0 mL of bacterial solution and centrifuge at 10,000 × g for 1 min at room temperature to collect the cells;

[0087] (3)Reference The Po1h-pINA1297-IL-15 / 21 / 23 recombinant plasmid was extracted according to the instructions of Plasmid DNA Mini Kit I (Omega Bio-Tek, US);

[0088] (4) Store the extracted plasmid at -20°C for later use;

[0089] (5) The obtained recombinant plasmid Po1h-pINA1297-IL-15 / 21 / 23 was linearized using Not Ⅰ restriction enzyme. The single enzyme digestion system was prepared according to Table 5. After adding each reagent to the centrifuge tube, the tube was centrifuged briefly to mix, and the reaction was continued at 37°C for 3 h.

[0090] Table 5 Enzyme digestion system

[0091] Element Volume (μL) Not Ⅰ 2.5 10×Quick Buffer 5 Linearized recombinant plasmid 1 (μg) <![CDATA[ddH2O]]> <![CDATA[42.5-V 质粒 ]]> Total volume 50

[0092] 2. Preparation and transformation of Yarrowia lipolytica Po1h competent cells

[0093] Yarrowia lipolytica Po1h competent cells were prepared according to the instructions of the Frozen-EZ Yeast Transformation II Kit (Zymo Research, Germany) and transformed with the pINA1297-IL-15 / 21 / 23 recombinant plasmid.

[0094] (1) Preparation of yeast cells

[0095] The recombinant yeast cells were cultured in 10 mL YPD liquid medium at 30 °C until the OD 600 =0.8-1.0. The following steps are completed at room temperature.

[0096] ① Centrifuge the culture medium at 500×g for 4 minutes and discard the supernatant;

[0097] ② Add 10 mL of Frozen-EZ Yeast Solution 1 to wash the cells, rinse the cells and discard the supernatant;

[0098] ③Add 1 mL of Frozen-EZ Yeast Solution 2 to resuspend the cells.

[0099] (2) Conversion

[0100] ① Mix 50 μL of the above suspended cells with 0.2-1 μg of pINA1297-IL-15 / 21 / 23 recombinant plasmid. Add 500 μL of Frozen-EZ Yeast Solution 3 and mix thoroughly.

[0101] ② Incubate at 30°C for 45 minutes, mixing vigorously by flicking or vortexing. During the incubation process, flick or vortex twice.

[0102] ③ 50-150 μL of the above transformation mixture was spread on uracil-deficient SD plates (Beijing Bio-Rad Biotechnology Co., Ltd.);

[0103] ④ Incubate the coated uracil-deficient SD plate upside down at 30°C for 5-7 days.

[0104] 3. Screening and identification of positive clones

[0105] (1) The recombinants were screened on uracil-deficient SD plates, and the positive single colonies on the plates were picked to obtain the positive recombinants that were successfully transformed;

[0106] (2) Colony PCR and 1% agarose gel electrophoresis were performed according to the system described in Table 2 and the PCR program in Table 3 to identify positive clones. The Po1h-pINA1297-IL-15 / 21 / 23 strain was obtained;

[0107] (3) Recombinant bacteria that were positive by colony PCR were sent to Beijing Qingke Xinye Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared using DNAMAN software (version 6.0);

[0108] (4) The empty vector pINA1297 can be transformed into Yarrowia lipolytica Po1h cells using the same method to obtain the empty vector Yarrowia lipolytica Po1h-pINA1297 strain.

[0109] IV. Expression of IL-15 / 21 / 23 Fusion Protein Genes in Yarrowia lipolytica and Study of Its In Vitro Activity

[0110] 1. ELISA detection of Po1h-pINA1297-IL-15 / 21 / 23 protein expression

[0111] The expression of Po1h-pINA1297-IL-15 / 21 / 23 protein levels was detected by direct method using porcine IL-15 and IL-23 ELISA kits purchased from Wuhan Huamei Bioengineering Co., Ltd., and then the sample OD was measured. 450The expression level of the fusion cytokine protein was determined by comparing with the standard curve. The content of histidine-tagged protein in the culture medium of Po1h-pINA1297-IL-15 / 21 / 23 was detected using a competitive inhibition assay.

[0112] The results are shown in Table 6. The target proteins were expressed in the culture supernatant of the recombinant yeast Po1h-pINA1297-IL-15 / 21 / 23. The levels of porcine IL-15, IL-23, and histidine tag were 14923.5 pg / ml, 14392.5 pg / ml, and 56.94 ng / ml, respectively. No expression of the corresponding target proteins was detected in the culture supernatant of the empty yeast Po1h-pINA1297.

[0113] Table 6 Results of ELISA detection of fusion protein expression levels

[0114]

[0115] Example 2: Effects of target proteins secreted and expressed by recombinant yeast on target cells

[0116] 1. Isolation of porcine lymphocytes

[0117] Under sterile conditions, 5 mL of peripheral blood was collected from the anterior vena cava of pigs, anticoagulated with EDTA-2K, and pig lymphocytes were isolated according to the instructions of the lymphocyte separation medium of Tianjin Haoyang Huake Biotechnology Co., Ltd.

[0118] The isolated cells were diluted with complete 1640 culture medium (containing 10% calf serum, 100 μg / mL ampicillin, and 100 μg / mL streptomycin) to a final cell concentration of 2×10 6 / mL, and divided into cell culture dishes with a diameter of 10 cm, 10 mL per dish, and finally added with Concanavalin A (Con A) with a final concentration of 10 μg / mL for stimulation, and cultured in a 37°C, 5% CO2 cell culture incubator for 24 hours.

[0119] 2. Detection of the proliferation activity of porcine lymphocytes by Po1h-pINA1297-IL-15 / 21 / 23 - CCK-8 method

[0120] The CCK-8 cell proliferation and activity detection kit provided by Beijing Juhemei Biotechnology Co., Ltd. was used to detect the activity of recombinant protein in regulating lymphocyte proliferation.

[0121] (1) After culturing the isolated porcine lymphocytes for 24 h, the cells in the culture dish were collected into a clean centrifuge tube and centrifuged at 500 × g for 15 min to collect the cells; the cells were washed twice with 1640 complete medium (containing double antibody and serum) and centrifuged at 500 × g for 15 min; the cells were adjusted to approximately 6 × 10 6 / mL;

[0122] (2) Add 10 μL of Po1h-pINA1297-IL-15 / 21 / 23 culture supernatant and Po1h-pINA1297 supernatant to the culture plate;

[0123] (3) Place the culture plate in a 37°C, 5% CO2 cell culture incubator and incubate for 48 h;

[0124] (4) Add 10 μL of CCK-8 solution to each well;

[0125] (5) Continue incubating in the cell culture incubator for 4 h;

[0126] (6) The absorbance at 450 nm was measured using a Bio-Reader 680 microplate reader.

[0127] See the results Figure 2 The ability of the recombinant yeast Po1h-pINA1297-IL-15 / 21 / 23 culture supernatant to promote the proliferation of porcine lymphoblasts was detected using a CCK-8 kit (purchased from Yisheng Biotechnology). It was found that the Po1h-pINA1297-IL-15 / 21 / 23 culture supernatant significantly increased the proliferation of lymphoblasts compared with the empty group PBS and the blank control group Po1h-pINA1297 (P<0.05), indicating that the recombinant protein has biological activity.

[0128] Example 3: Study on the biological activity of fusion protein IL-15 / 21 / 23 in mice

[0129] 1. Preparation of recombinant yeast fermentation broth

[0130] Po1h-pINA1297 and Po1h-pINA1297-IL-15 / 21 / 23 were streaked onto YPD plates (10 g / L yeast extract, 20 g / L tryptone, 20 g / L glucose, and 15 g / L agar) and placed in a constant temperature incubator at 28°C for 48 hours. A single colony was then picked and inoculated into 1 L of YPD liquid medium (10 g / L yeast extract, 20 g / L tryptone, and 20 g / L glucose) and placed in an air bath shaking incubator at 28°C and 200 rpm for 24 hours. Overnight culture (100 mL) was inoculated into a 2 L shake flask containing 1 L of YPD liquid medium at a 1% (v / v) ratio and placed in a shaking incubator at 28°C and 200 rpm for 48 hours.

[0131] 2. Mouse Experimental Treatment Plan

[0132] 1. Grouping of mice

[0133] Thirty healthy female Kunming mice aged 4-5 weeks and weighing approximately 18 grams were randomly divided into three groups, numbered C, R, and Q, with 10 mice in each group. Group C served as the PBS-treated control group, R served as the blank plasmid control group, and Group Q served as the experimental group.

[0134] 2. Mouse inoculation treatment

[0135] Under the condition of ensuring adequate food, water and other basic living conditions for mice, mice in group C were gavaged with 0.1 mL PBS once every 3 days, and mice in group R were gavaged with 0.1 mL Po1h-pINA1297 empty yeast culture medium once every 3 days (4×10 8 CFU / mouse / time, and mice in group Q were gavaged with 0.1 mL of Po1h-pINA1297-IL-15 / 21 / 23 culture medium once every 3 days (4×10 8 CFU / mouse / time). The first oral gavage was recorded as day 0, and a total of 10 oral gavages were performed on day 28 of immunization. The challenge experiment was performed on day 28.

[0136] 3. Mouse challenge experiment

[0137] On the 28th day of the mouse immunization procedure, 0.3 mL of 1×10 9 CFU / ml of Staphylococcus aureus (ATCC25923) and 0.3 mL of 1×10 9 Mice were orally gavaged with LB culture medium containing CFU / ml of Salmonella typhimurium (ATCC14028). In each group of 10 mice, 5 mice were randomly selected and gavaged with different challenge strains.

[0138] 4. Sample and Data Collection

[0139] The mice were weighed weekly for 4 consecutive weeks, and their survival was observed and recorded daily throughout the experiment. On day 28 after immunization and day 3 after challenge, 1 g of feces was collected and assayed for sIgA using ELISA.

[0140] Peripheral blood was collected from the tail vein of mice on days 7, 14, 21, and 28 after immunization and on day 3 after challenge. 100 μL of peripheral blood was collected from each mouse and mixed with 10 μL of anticoagulant (SolarBio, IH1440). On day 14 of challenge, the remaining mice were sacrificed, and small intestinal tissue was collected and stored in liquid nitrogen until further use. Blood samples were collected for flow cytometry analysis of immune cells and routine blood analysis; plasma was collected after centrifugation and stored at -80°C until further use.

[0141] 1. Flow cytometry analysis of changes in immune cells in mouse peripheral blood

[0142] (1) 150 μL of anticoagulated blood collected from the mouse tail vein was transferred to a flow cytometry tube. 3 ml of red blood cell lysis buffer (SolarBio, R1010) was added per 150 μL of blood and incubated at room temperature for 20 min.

[0143] (2) The incubated blood cell solution was centrifuged at 500 g with the speed set to level 9 at 4°C for 10 min. The red supernatant was discarded and the cell pellet was resuspended and washed once with 3 ml of PBS solution. The cell pellet was centrifuged again under the same conditions, the supernatant was discarded, and the cell pellet was resuspended with 100 μL of PBS solution.

[0144] (3) Add 1 μL of each flow cytometry antibody to 100 μL of sample and incubate at 4°C in the dark for 30 min (see Table 7 for antibody selection scheme);

[0145] (4) After incubation, add 3 ml of PBS solution to the cell sample and wash once. Centrifuge at 500 g, set the speed to gear 9, and centrifuge at 4°C for 10 min. Discard the supernatant and resuspend the cell pellet in 100 μL of PBS solution.

[0146] (5) The B cell group can be directly analyzed after being resuspended into 200 μL cell suspension;

[0147] (6) T cell groups require fixation and permeabilization procedures to stain the intracellular marker protein Foxp3. 100 μL of cell sample per tube was thoroughly resuspended and mixed, then added with 1 ml of 1× Fix / Perm fixative solution (BD, Pharmingen Transcription Factor Buffer Set, 562574) and incubated at 4°C in the dark for 40 min.

[0148] (7) After incubation, add 1 ml of 1× Perm / Wash solution to each tube and wash once. Centrifuge at 500 g, set the speed to level 9, and centrifuge at 4°C for 10 min. Discard the supernatant and resuspend the cell pellet in 100 μL of PBS solution.

[0149] (8) Add 1 μL of FOXP3 flow cytometry antibody to each tube of 100 μL cell sample and incubate at 4°C in the dark for 30 min.

[0150] After incubation, each tube was washed once by adding 2 ml of 1× Perm / Wash solution, centrifuged at 500 g with the speed set to gear 9, and centrifuged at 4°C for 10 min. The supernatant was discarded and the cell pellet was resuspended in 200 μL of PBS solution before analysis (see Table 8 for gating logic).

[0151] Table 7 Flow cytometry antibody color scheme

[0152]

[0153]

[0154] Table 8 Flow cytometry gating logic

[0155]

[0156] 2. Fluorescence quantitative PCR analysis of changes in immune-related genes in small intestinal tissues of mice before and after PBC and virus challenge

[0157] (1) Extraction of total RNA from mouse peripheral blood cells (PBC) and small intestinal tissue

[0158] ① Blood samples: 200 μL of tail vein blood was collected from each mouse in Groups C, R, and Q on days 7, 14, and 28, and on day 3 after challenge, and EDTA was added for anticoagulation;

[0159] ② Small intestinal samples: Fresh small intestinal tissues of mice sacrificed on the 42nd day were quickly frozen with liquid nitrogen, quickly transferred to a mortar pre-cooled with liquid nitrogen, and ground with a pestle. Liquid nitrogen was continuously added during the grinding process until it was ground into powder (no obvious visible particles).

[0160] (2) RNA extraction

[0161] Total RNA was extracted from mouse peripheral blood cells (PBC) and small intestinal tissue using the RNA-easy Isolation Reagent kit provided by Novozymes Biotech.

[0162] The concentration and purity of the extracted RNA products were directly detected using the NanoDrop 2000 ultra-micro spectrophotometer. The concentration values of each group were recorded (diluted according to the requirements of the subsequent reverse transcription system). The OD values were recorded. 260 / 280 , OD 260 / 230 The ratio was used to evaluate the results of the peripheral blood RNA extraction experiment.

[0163] (3) Reverse transcription of total RNA into cDNA

[0164] Use One-Step gDNA Removal and cDNA Synthesis SuperMix( , AT311) kit (One-Step gDNA Removal) (Transgen, Beijing, China), the reverse transcription reaction system was configured according to Table 9, and the total RNA was reverse transcribed at 42°C for 15 min.

[0165] Table 9 RNA reverse transcription system

[0166]

[0167]

[0168] ①RT-PCR procedure: incubate at 42°C for 30 min;

[0169] ②Heat at 85℃ for 5s The RT / RI Enzyme was inactivated and the samples were stored at 4°C.

[0170] (4) Fluorescence quantitative PCR detection of changes in immune-related genes in PBC and small intestinal tissues

[0171] Based on the relevant gene sequences in GenBank, 23 pairs of primers for qPCR of immune-related genes were designed and synthesized (Table 10).

[0172] Table 10 Primer sequences used in qPCR

[0173]

[0174]

[0175] 3. Changes in total IgG in mouse plasma and sIgA in feces before and after challenge

[0176] (1) Processing and collection of test samples

[0177] ① Plasma: Use a pyrogen- and endotoxin-free tube, avoid any cell stimulation during the operation, centrifuge at 2400×g for 20 minutes, carefully separate the plasma, and store below -20°C to avoid repeated freezing and thawing;

[0178] ② Feces: Take fresh feces of mice collected on the 28th day and the 3rd day after infection, suspend them in 0.01M PBS and 0.05M EDTA buffer at 4mL / g, shake on ice for 15min, centrifuge at 10000×g at 4℃ for 5min, and freeze the supernatant at -80℃ for use.

[0179] (2) Detection of plasma IgG and fecal sIgA levels

[0180] The enzyme-linked immunosorbent assay (ELISA) kit of Ruixin Biotechnology Co., Ltd. was used to detect the levels of mouse plasma IgG and fecal sIgA, and the IgG and sIgA levels were obtained by comparison with the standard curve.

[0181] 4. Morphological changes of small intestine in mice before and after infection

[0182] The small intestinal tissue collected after killing the mice was soaked in 4% formalin solution and commissioned to Chengdu Lilai Biotechnology Co., Ltd. to prepare paraffin specimens and perform hematoxylin and eosin (H&E) staining, and measure three indicators: villus height, crypt depth and intestinal wall thickness.

[0183] 5. Number of mice surviving after infection

[0184] The survival of mice was recorded every day after the challenge.

[0185] Figure 3 The results showed that the body weight of mice in the Po1h-pINA1297-IL-15 / 21 / 23 group was not significantly different from that of the blank control group (PBS) and the Po1h-pINA1297 empty-load control group throughout the observation period (P>0.05), indicating that the recombinant yeast has reliable biosafety.

[0186] Figure 4The following are small intestinal tissue sections of mice in each group 14 days after infection. The results showed that in both infection models, the villus height of mice in the Po1h-pINA1297-IL-15 / 21 / 23 recombinant yeast-treated group was significantly different from that in the blank control group (PBS) and the Po1h-pINA1297 control group (P < 0.01). In the Salmonella-infected group, the crypt depth after Po1h-pINA1297-IL-15 / 21 / 23 recombinant yeast treatment was significantly increased compared with the Po1h-pINA1297 control group and the blank control group (PBS) (P < 0.01), indicating that Po1h-pINA1297-IL-15 / 21 / 23 recombinant yeast may increase the growth rate of intestinal crypts to cope with the damage of S. typhimurium to intestinal tissue.

[0187] Figure 5 The results show that when infected with S. aureus and S. typhimurium, the expression of Bd2, the antimicrobial protein Reg3, and S100a8 in the intestine of mice in the Po1h-pINA1297-IL-15 / 21 / 23 recombinant yeast group was significantly increased compared with the control group (P < 0.01). Furthermore, compared with the control group, the Po1h-pINA1297-IL-15 / 21 / 23 group significantly upregulated the expression of the cytokine TNF-α and the downstream pathway protein JAK1 in the small intestine of mice (P < 0.05). However, in S. aureus infection, STAT1 expression in the Po1h-pINA1297-IL-15 / 21 / 23 group was significantly downregulated compared with the control group (P < 0.05); in S. typhimurium infection, TGF-β expression in the Po1h-pINA1297-IL-15 / 21 / 23 group was significantly downregulated (P < 0.01). We also used qPCR to detect the expression levels of PBC cytokines ( Figure 6 The results showed that the expression levels of IFN-γ and IL-15 at the mRNA level in the Po1h-pINA1297-IL-15 / 21 / 23 group mice were not significantly changed compared with the PBS blank control group (P>0.05), while the expression levels of IL-7, IL-22, IL-23, and TNF-α were significantly increased compared with the blank control group (P<0.05).

[0188] Figure 6 The results show that compared with the blank group and the Po1h-pINA1297 control group, the T lymphocyte subsets in the Po1h-pINA1297-IL-15 / 21 / 23 group were significantly increased on day 7. C , and T CM ( Figure 6 ) increased significantly; on the 14th day, T H , naive T cells and T CM In addition, the T reg Significantly decreased in 7-28 days ( Figure 6 However, compared with the blank control group, the peripheral blood T cells of the Po1h-pINA1297 control group and the Po1h-pINA1297-IL-15 / 21 / 23 group mice EM and T eff There was no significant difference in the proportions.

[0189] Figure 7 The results showed that the mice in the Po1h-pINA1297-IL-15 / 21 / 23 recombinant yeast treatment group had higher plasma cells, B lymphocytes and B-cell differentiation on day 14 compared with the control group. SM 、B NM Proportion( Figure 7 )(P<0.05).

[0190] Figure 8 The results showed that before the challenge, the plasma IgG level in mice in the Po1h-pINA1297-IL-15 / 21 / 23 group was significantly increased compared with the blank control group (P < 0.01). In response to S. typhimurium and S. aureus infection, the Po1h-pINA1297-IL-15 / 21 / 23 group significantly increased the plasma IgG level in mice (P < 0.01) and the intestinal sIgA secretion level (P < 0.01) compared with the Po1h-pINA1297 control group.

[0191] Figure 9 The figure shows the survival curve of mice after challenge. The results show that mice in the Po1h-pINA1297-IL-15 / 21 / 23 oral gavage group had stronger resistance to infection with S. aureus and S. typhimurium, with a survival rate of 80%, far higher than the 20% survival rate of the control mice and the 40% survival rate of the empty yeast group.

[0192] Example 4: Study on the biological activity of porcine interleukin-15, 21 and 23 fusion proteins in piglets

[0193] 1. Preparation of recombinant yeast Po1h-pINA1297-IL-15 / 21 / 23 fermentation products

[0194] 1. Inoculate the recombinant yeast Po1h-pINA1297-IL-15 / 21 / 23 into 2.5 mL of liquid YPD medium and culture overnight at 28°C and 200 rpm in an air bath.

[0195] 2. Take the bacterial solution obtained in step 1 and inoculate it into a 2L shake flask containing 1L liquid YPD medium. Cultivate it in an air bath at 28°C and 220 rpm until the OD 600 20 (about 24h);

[0196] 3. Take the bacterial solution obtained in step 2 and inoculate it into a 15L fermenter containing 10L BSM fermentation medium at a 10% inoculum volume. Stir and culture at 28°C and 400rpm until the OD 600 The fermentation temperature was 80 (approximately 48 hours), and the resulting fermentation system was named Po1h-pINA1297-15 / 21 / 23 fermentation product. The following table contains 1 L of BSM fermentation medium: 85% phosphoric acid (26.7 ml), 0.93 g of calcium sulfate, 18.2 g of potassium sulfate, 14.9 g of magnesium sulfate heptahydrate, 4.13 g of potassium hydroxide, 40.0 g of glycerol, and distilled water to 1 L. The following table contains 1 L of PTM1: 6.0 g of anhydrous copper sulfate, 0.08 g of sodium iodide, 3.0 g of manganese sulfate monohydrate, 0.2 g of sodium molybdate dihydrate, 0.02 g of boric acid, 0.5 g of cobalt chloride, 20.0 g of zinc chloride, 65.0 g of ferrous sulfate heptahydrate, 0.2 g of biotin, and 5.0 ml of concentrated sulfuric acid. The mixture was sterilized by 0.22 μm filtration at room temperature. 40 mL of PTM1 was added to 1 L of BSM medium.

[0197] 2. Grouping and Treatment of Experimental Animals

[0198] 1. Four pens were selected for the study, consisting of healthy, weaned Chuanxiang Black piglets from the same batch with an average weaning weight of approximately 9 kg. The pigs were divided into a control group (PBS) and an experimental group (Po1h-pINA1297-IL-15 / 21 / 23) based on weight. Each treatment consisted of two replicates, with 50 piglets per replicate. The formulation was added to the piglet nursery feed once every two days in the morning, mixed thoroughly, and fed for a total of 35 days.

[0199] 2. The experimental feed was based on the commercial feed used in the pig farm, with additional fermentation products added. The control group was fed a basic diet + an equal amount of PBS, while the experimental group was fed a basic diet + yeast fermentation liquid, with an addition amount of 40 ml / head / 2 days. The commercial feed was a piglet compound feed (620) produced by Cargill Feed (Chongqing) Co., Ltd. The raw material composition was puffed corn, corn, soybean meal, sugar, whey powder, stone powder, calcium dihydrogen phosphate, sodium chloride, vitamins and vitamin-like substances, mineral elements and their complexes (chelates), zinc chloride, L-lysine, DL-methionine, threonine and mildew inhibitor (calcium propionate), etc. The nutritional composition of the commercial feed is shown in Table 11.

[0200] Table 11 Composition and nutritional composition of commercial feed

[0201] feed 620 Moisture ≤13.0 crude protein ≥17 crude fiber ≤6 Crude ash ≤7 calcium 0.50-0.90 Total phosphorus ≥0.45 Lysine ≥1.20 Sodium chloride 0.30-1.00

[0202] 3. Production performance testing

[0203] The experimental piglets were managed by a dedicated person, with each group under identical feeding and environmental conditions. After the experiment began, the pigs were fed every two days, keeping the feed fresh and the piggery environment comfortable. The pigs' feeding, health, and activity were observed daily. Any sick pigs were marked, and the date of illness, duration, treatment plan, and recovery were recorded. Severely ill pigs were removed from the experimental pen, and sick pigs were weighed, with the date and weight recorded.

[0204] Table 12 shows the production performance of the experimental pigs. Table 12 shows that: (1) in terms of average daily feed intake (ADFI): the control group was 715.06±30.81g, and the experimental group was 638.66±25.92g, which was 10.68% lower than that of the control group (P<0.05); (2) in terms of average daily weight gain (ADG): the control group was 380.65±33.48g, and the experimental group was 426.91±44.05g, which was 12.15% higher than that of the control group (P<0.05); (3) in terms of feed to meat ratio (FCR): the control group was 1.89±0.08, and the experimental group was 1.51±0.09, which was 20.11% lower than that of the control group (P<0.05); Based on the above production performance indicators, the recombinant yeast fermentation broth helps to improve the production performance of weaned piglets and significantly promotes the growth and development of piglets.

[0205] Table 12 Production performance of experimental pigs

[0206]

[0207]

[0208] In summary, the present invention achieved this by genetically recombining and fusing porcine interleukin-15, 21, and 23 genes, linking them to a eukaryotic expression platform to produce a fusion protein. The immunomodulatory effects of the fusion protein, its ability to induce anti-infection activity in mice, and its biological effects on improving immunity and growth in pigs were further investigated. The results showed that the fused expression of IL-15, 21, and 23 significantly enhanced the immune barrier function of animals, boosted their systemic immunity and resistance to bacterial infection, and promoted their growth and development.

[0209] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A fusion protein, characterized in that It comprises porcine interleukin 15, porcine interleukin 21 and porcine interleukin 23, and the fusion protein consists of the amino acid sequence shown in SEQ ID NO:

1.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the fusion protein according to claim 1.

3. A nucleic acid molecule according to claim 2, characterized in that The nucleic acid molecule consists of the nucleotide sequence shown in SEQ ID NO:

2.

4. A biological preparation material, characterized in that: The biological preparation material is any one of the following (c1) to (c6): (c1) an expression cassette containing the nucleic acid molecule according to claim 2 or 3; (c2) a recombinant vector containing the nucleic acid molecule according to claim 2 or 3; (c3) a transgenic cell line containing the nucleic acid molecule according to claim 2 or 3; (c4) a recombinant microorganism containing the nucleic acid molecule according to claim 2 or 3; (c5) a culture product of a transgenic cell line containing the nucleic acid molecule according to claim 2 or 3; (c6) A fermentation product of a recombinant microorganism containing the nucleic acid molecule according to claim 2 or 3.

5. An application, characterized in that: The fusion protein according to claim 1; the nucleic acid molecule according to claim 2 or 3; or the biological preparation material according to claim 4 is used to prepare a product for improving the immune ability of an animal; the animal includes a mouse or a pig.

6. The use according to claim 5, characterized in that The improving of the animal's immune capacity is at least one of the following (d1) to (d8): (d1) promoting cellular immunity and / or humoral immunity of effector target animals; (d2) Promote the establishment of immune barriers in effector target animals; (d3) promoting animal development and growth; (d4) Promote the increase of animal immune cells; (d5) Promote animal cellular immunity and humoral immunity; (d6) Promote the establishment of animal mucosal immune barrier; (d7) resistance to Salmonella typhimurium and standard Staphylococcus aureus ATCC14028 infection; (d8) Promote vaccine-induced immune response.

7. The use according to claim 6, characterized in that The immune cells are lymphocytes, red blood cells or white blood cells.

8. The use according to any one of claims 5 to 7, characterized in that The animal is a pig or a mouse.

9. A product, characterized in that The invention comprises the fusion protein according to claim 1, the nucleic acid molecule according to claim 2 or 3, or the biological preparation material according to claim 4.

10. The product according to claim 9, characterized in that: The product is a vaccine.

Images