Preparation and Uses of a Non-Natural Anti-Human CD45RA Murine Chimeric Antigen Receptor
By designing Mu3A4-CAR gene-modified CAR-T cells, the problems of insufficient targeting and toxic side effects in the treatment of AML by existing CAR-T therapies have been solved. This approach achieves efficient killing of CD45RA-positive leukemia cells and protection of normal cells, providing a new treatment option for leukemia.
Patent Information
- Application Number
- CN202311446355.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-02
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2043-11-02
AI Technical Summary
Existing CAR-T cell therapies for treating AML suffer from insufficient targeting and toxic side effects on normal cells. In particular, the widespread expression of CD45 antibodies on the surface of all hematopoietic cells leads to severe side effects, making it difficult to effectively target and kill leukemia cells without damaging normal cells.
A non-natural murine chimeric antigen receptor, Mu3A4-CAR, was designed. CAR-T cells modified with the CD45RA-CAR gene were constructed through a tandem structure of CD8a leader, 3A4scFv, CD8a hinge, CD8a transmembrane region, 4-1BB, and CD3ζ. T cells were then infected using a lentiviral vector to achieve specific recognition and killing of the CD45RA antigen.
It achieves highly efficient targeted killing of CD45RA-positive leukemia cells, reduces toxic side effects on normal cells, improves the treatment effect of AML, and at the same time maintains the function of normal hematopoietic stem cells, avoiding severe cellular immune deficiencies and infection risks.
Smart Images

Figure HDA0004527504930000011 
Figure HDA0004527504930000012 
Figure HDA0004527504930000013
Abstract
Description
Technical Field
[0001] This invention pertains to biotechnology and mainly relates to the preparation and use of a novel, non-natural murine anti-human CD45RA chimeric antigen receptor. It is a novel chimeric antigen receptor (CAR) gene (Mu3A4-CAR) targeting the novel murine anti-human leukocyte membrane antigen CD45RA, designed and prepared, and its use in the preparation of drug formulations for targeted therapy of hematologic malignancies using CD45RA-CAR gene-modified T cells (MuCD45RA-CAR-T cells). Background Technology
[0002] Leukemia is one of the most common hematologic malignancies. According to data collected in the United States from 2011 to 2015, the incidence rate of leukemia indicates 13.8 new cases and 6.7 leukemia-related deaths per 100,000 men and women annually. In recent decades, with the use of various chemotherapy drugs, risk-stratified chemotherapy regimens, and hematopoietic stem cell transplantation, the prognosis of leukemia has significantly improved. However, relapse and drug resistance remain major challenges in clinical treatment. It has been reported that 20% of children with acute lymphoblastic leukemia (ALL) still face relapse, while the overall survival rate for adult ALL is only 30%-40%. The lack of effective alternative drugs for relapsed and drug-resistant cases poses a significant challenge to clinical treatment.
[0003] In recent years, with the advancements in molecular biology and antibody engineering technology, targeted therapy for leukemia that kills tumor cells without damaging normal cells has received widespread attention and development. CAR-T cell therapy is one such representative approach. Its targeted therapeutic effect involves designing and constructing a chimeric antigen receptor (CAR) gene from autologous or allogeneic T cells to recognize specific antigen targets. This CAR gene is then installed into human T cells using various biological transfection techniques, allowing it to continuously express the CAR fusion protein on the T cell surface. This produces CAR-T cell preparations, which are then infused to selectively target and kill tumors with specific antigen targets, thus exerting a clinical therapeutic effect. The CAR gene is an artificially constructed fusion protein gene containing both an antigen recognition domain and a T cell signaling domain. Genetically engineered T cells to express CAR can specifically recognize antigens and eliminate malignant tumors. CAR-T therapy combines the specificity of CAR antibody targeting antigen recognition with the potent killing effect of T cells, eliminating tumors in a major histocompatibility complex-independent manner. Different recognition domains in CARs exhibit different targeting specificities. For example, CD19CAR primarily targets B-cell system cells, while CD33CAR mainly targets myeloid system cells. Therefore, the recognition domain in the CAR gene structure (usually determined by the recognition characteristics of the single-chain antibody, ScFv, in the antibody structure) determines the targeted therapeutic purpose of a CAR gene. In recent years, CD19CAR-T cell targeted therapy for B-cell malignancies has demonstrated sustained disease remission and prolonged survival, bringing new hope for the treatment of relapsed / refractory AML in children. However, compared to B-cell malignancies, the clinical trial results for this therapy in treating AML are significantly worse than those in ALL, with the most challenging task being the selection of ideal target molecules. Typically, the target antigens present on the AML cell membrane are also highly expressed on the surface of normal myeloid cells. Therefore, while using CAR-T cells to treat relapsed / refractory AML, it can also lead to severe neutropenia, making patients more susceptible to serious bacterial infections and thus causing devastating health consequences. Few AML targets have been approved for clinical treatment. To date, only CD123CAR has been approved by the US FDA for the clinical treatment of relapsed / refractory AML, while CARs targeting other targets, including CD33, CD45, FLT3, Lewis-Y, and CLL-1, are still in therapeutic trials, but the effects have mostly been poor. A crucial issue in CAR-T cell therapy research is identifying highly specific targets to enhance the targeted killing of tumor cells by CAR-T cells while minimizing toxic side effects on normal tissue cells.
[0004] CD45 is a common leukocyte antigen and a hematopoietic cell-specific tyrosine phosphatase. CD45 is expressed on the membranes of all nucleated leukocytes in the hematopoietic system, but not on erythrocytes, megakaryocytes, hematopoietic stem cells, or other solid tissue cells. Alternative splicing of exons 4(A), 5(B), and 6(C) in the CD45 antigen molecule can produce various allosteric variants. To demonstrate whether CD45 antibodies and their targets can be used for clinical treatment, Peter Kletting obtained antibodies under different saturation conditions... 111 The biological distribution of In-labeled anti-CD45 monoclonal antibodies was measured in 5 patients using two measurement series: pre-loaded and unpre-loaded. The biological distribution test showed that the concentration in red bone marrow was significantly higher than that in important tissues such as the liver. Optimal preloading increased bone marrow super-liver selectivity by 3.9 times (Kletting P, Kull T, Bunjes D, Luster M, Reske SN, Glatting G. Optimal preloading in radioimmunotherapy with anti-cD45 antibody. Medical physics. 2011; 38(5):2572-2578.). Currently, radiolabeled CD45 antibodies are used internationally for pretreatment before hematopoietic stem cell transplantation. In a clinical trial, Pagel JM used a pretreatment regimen in 58 patients with advanced AML or high-risk myelodysplastic syndromes to pre-transplant allogeneic hematopoietic stem cell transplantation. 131Treatment with 131I-anti-CD45 antibody combined with fludarabine and 2 Gy total body irradiation resulted in complete remission in all patients (Pagel JM, Gooley TA, Rajendran J, et al. Allogeneic hematopoietic cell transplantation after conditioning with 131I-anti-CD45 antibody plus fludarabine and low-dose total body irradiation for elderly patients with advanced acute myeloid leukemia or high-risk myelodysplastic syndrome. Blood. 2009, 114(27):5444-5453.), indicating that CD45 antibodies can be used in humans without producing clinically unacceptable toxic side effects on other human tissues and cells. However, due to the extensive reactivity of ordinary CD45 antibodies with hematopoietic tissues, especially since they are expressed on the surface of all T, B, granulocytes, monocytes, NK cells, and DC cells, CD45 antibodies are generally not routinely used for targeted therapy of leukemia, in order to avoid severe cellular immunodeficiency or neutrophilia leading to severe bacterial and / or viral infections (Michelle L. Hermiston1, Zheng Xu, et al. CD45: A critical regulator of signaling thresholds in immune cells. Annu. Rev. Immunol. 2003, 21:107–137).
[0005] CD45RA is an allosteric variant of the CD45 molecule, expressed on the surface of naive T cells, B cells, some granulocytes, and some monocytes, but not on activated T cells, memory T cells, mature erythrocytes, platelets, and parenchymal organ tissue cells. Therefore, it does not cause anemia, thrombocytopenia, or damage to other solid tissue cells (Li S, Tang Y, Zhang J, et al. 3A4, a new potential target for B and myeloid lineage leukemias[J]. JDrug Target, 2011, 19(9):797-804.). Drug-resistant leukemia stem cells (LSCs) are considered a cause of relapse after treatment for acute myeloid leukemia (AML). CD45RA is expressed in leukemia cells in most AML patients. CD45RA is a specific marker for AML-LSC cell subpopulations (Kersten B, Valkering M, Wouters R, et al. CD45RA, a specific marker for leukaemia stem cell subpopulations in acute myeloid leukaemia. British journal of haematology. 2016, 173(2):219-235.). Anti-CD45RA monoclonal antibodies can effectively target AML cancer cells through their effector functions and apoptosis-inducing effects (Habibi-Anbouhi M, Kafi Z, Ghazizadeh L, et al. Cytotoxicity Assessment and Apoptosis-related Gene Profiling of Antibody Treated Acute Myeloid Leukemia (AML) and Acute Lymphocytic Leukemia (ALL) Cancer Cell Lines. Iranian journal of allergy, asthma, and immunology. 2019; 18(6):679-687.). CD45RA does not respond to memory T cell subsets (CD45RO+) that have been stimulated by antigens and have established immune activity against previously exposed antigens, but only to unstimulated T cell subsets (CD45RO+). T) response (Tchilian EZ, Beverley PC. Altered CD45 expression and disease. Trends in immunology. 2006; 27(3):146-153.), therefore, when using CD45RA as a molecularly targeted killer or treatment, it should not damage the body's already established cellular immune function, and Because T cells are cleared by CD45RA antibodies, the body loses part of its cellular immune response. However, after treatment, normal hematopoietic stem cells can generate a replacement. T cells can compensate for this temporary decline in cellular immunity. As for the high expression of CD45RA on B cells, humoral immunity can be compensated for by infusion of gamma globulin. Therefore, CD45RA should be a relatively ideal target for killing leukemia cells, and the development of CAR-T cells targeting the CD45RA antigen may provide new targeted therapeutic agents for the clinical treatment of leukemia. Summary of the Invention
[0006] The purpose of this invention is to provide a non-natural murine anti-human CD45RA chimeric antigen receptor, which is a CAR-T cell preparation capable of recognizing CD45RA antigen-positive leukemia cells, namely, a non-natural murine anti-human CD45RA-CAR gene-modified CAR-T cell. The CD45RA-CAR gene is composed of the following structure: CD8a leader is the CAR leader chain, 3A4scFv is the target recognition region, CD8a hinge is the hinge region, CD8a transmembrane is the CAR transmembrane region, and the intracellular signal transduction region of 4-1BB (CD137) and the intracellular signal transduction region of CD3ζ are tandemly linked to form the intracellular segment of the CAR. The nucleotide sequence of the murine 3A4scFv heavy chain gene is shown in SEQ ID NO.3, and its amino acid sequence is shown in SEQ ID NO.4. The nucleotide sequence of the 3A4scFv light chain gene is shown in SEQ ID NO.5, and its amino acid sequence is shown in SEQ ID NO.6.
[0007] Based on the existing murine anti-human CD45RA immunoglobulin (ZCH-6-3A4 monoclonal antibody, abbreviated as Mu3A4) gene sequence, a murine chimeric antigen receptor (Mu3A4-CAR) gene against human CD45RA was developed using molecular biology techniques and prepared through the following steps:
[0008] (1) Review and compare literature to determine the basic structure of the second-generation 3A4CAR. Search the National Center for Biotechnology Information (NCBI) to verify the gene sequences of the 3A4CAR hinge region, transmembrane region and intracellular signal transduction region, and commission a company to synthesize pUC / 4-1BB-3ζ and pUC / 4-1BB-3ζ-EGFP (enhanced green fluorescent protein);
[0009] (2) The eukaryotic expression vectors pcDNA3.1 / Mu3A4-4-1BB-3ζ, pcDNA3.1 / Mu3A4-4-1BB-3ζ-EGFP and the lentiviral expression vector pLenti / Mu3A4-4-1BB-3ζ of Mu3A4CAR were constructed by genetic engineering and molecular cloning methods.
[0010] (3) Activity identification of Mu3A4CAR eukaryotic expression vector and lentiviral expression vector: detect whether the vector expresses and whether the protein is correctly localized, compare the transfection and expression efficiency of the two expression vectors, and select the optimal CAR expression vector.
[0011] Two expression vectors, characterized in that the vectors contain the sequences CD8aleader(SEQ ID NO 1)-CD45scFv(SEQ ID NO 3+SEQ ID NO 5)-CD8ahinge(SEQ ID NO 7)-CD8a transmembrane region(SEQ ID NO 9)-CD137(SEQ ID NO 11)-CD3ζ(SEQ ID NO 13) or CD8aleader(SEQ ID NO 1)-3A4scFv(SEQ ID NO 3+SEQ ID NO 5)-CD8a hinge(SEQ ID NO 7)-CD8a transmembrane region(SEQ ID NO 9)-CD137(SEQ ID NO 11)-CD3ζ(SEQ ID NO 13), wherein the vectors are eukaryotic expression vectors pcDNA3.1(+)-MuCD45RACAR or pcDNA3.1(+)-Mu3A4CAR genes and lentiviral vectors pLenti-MuCD45RACAR or pLenti-Mu3A4CAR genes.
[0012] Another object of the present invention is to provide the use of the chimeric antigen receptor gene (Mu3A4-CAR) in the preparation of a medicament for treating diseases mediated by cells expressing CD45RA, specifically in the preparation of a drug formulation for the targeted treatment of hematologic malignancies using CD45RA-CAR gene-modified T cells (Mu3A4-CAR-T cells).
[0013] The disease in question refers to neoplastic diseases that express the CD45RA membrane antigen, mainly malignant hematological diseases, specifically acute myeloid leukemia, acute lymphoblastic leukemia, malignant lymphoma, chronic myeloid leukemia, and chronic lymphoblastic leukemia.
[0014] This invention uses murine 3A4 antibodies as a base and employs molecular biology techniques to construct eukaryotic expression vectors pcDNA3.1 / Mu3A4-4-1-BB-3z and pcDNA3.1 / Mu3A4-4-1BB-3ζ-EGFP, and lentiviral expression vector pLenti / Mu3A4-4-1BB-3ζ. The lentiviral expression vector pLenti / Mu3A4-4-1BB-3ζ can successfully infect human T cells and effectively kill 3A4-positive target cells, KG1a cells and Raji cells. Mu3A4CAR antigen recognition is independent of the antigen presentation process and is not MHC-restricted, thus overcoming tumor immune escape and more effectively killing 3A4-positive tumor cells.
[0015] This invention utilizes the obtained Mu3A4CAR for a series of experiments. After successful infection of T cells with Mu3A4CAR, in vitro antigen-binding activity assays showed that Mu3A4CAR-T cells could specifically bind to the KG1a myeloid leukemia cell line, which highly expresses CD45RA. Mu3A4CAR-T cells can target and kill leukemia cells in 3A4-positive cell lines and newly diagnosed AML patients. Mu3A4CAR-T cells can be used for the treatment of leukemia with high CD45RA antigen expression.
[0016] This invention utilizes the obtained non-natural Mu3A4CAR protein, which recognizes antigens independently of the antigen presentation process and is not restricted by MHC. Therefore, it can overcome tumor immune escape and more effectively kill 3A4-positive tumor cells. Attached Figure Description
[0017] Figure 1Schematic diagram of the Mu3A4CAR gene structure. The CD8a leader is the CAR leader strand, Mu3A4scFv is the target recognition region, CD8a hinge is the hinge region, CD8aTM is the CAR transmembrane region, 4-1BB is the intracellular co-stimulatory signal transduction region, and CD3ζ is the intracellular signal transduction region. These functional regions are tandemly connected to form the complete Mu3A4CAR CAR gene. The sequence length of CD8aleader (NM_001768) is 51 bp; the sequence length of CD8a HingeTM (NM_001768) is 207 bp; the sequence length of 4-1BB (NM_001561) is 126 bp; and the sequence length of CD3ζ (NM_198053) is 336 bp. The Mu3A4scFv light and heavy chain genes are derived from patent ZL 2009 1 0246023.X.
[0018] Figure 2 Schematic diagrams of the eukaryotic expression vectors pcDNA3.1 / Mu3A4-4-1-BB-3z (a), pcDNA3.1 / Mu3A4-4-1BB-3ζ-EGFP (b), and the lentiviral expression vector pLenti / Mu3A4-4-1BB-3ζ (c). a represents the murine receptor without fluorescence, b represents the murine receptor with EGFP fluorescence (EGFP-Murine), and a and b are transition vectors for transient expression. c represents the lentiviral murine receptor, which is recombined into the cell genome for stable and high expression, and can be used for lentiviral packaging to infect T cells, i.e., CAR-T cells.
[0019] Figure 3 Expression of Mu3A4CAR-EGFP fusion protein under inverted fluorescence microscopy (200x).
[0020] CHO cells infected with pcDNA3.1 / 3A4CAR-EGFP (a) showed green EGFP fluorescence under an inverted fluorescence microscope after 24 hours (b), while CHO cells transfected with the empty vector (c) showed no fluorescence under an inverted fluorescence microscope after 24 hours (d), indicating that the 3A4CAR-EGFP fusion protein could be successfully expressed.
[0021] Figure 4 Detection of the expression of the fusion protein Mu3A4CAR-EGFP in CHO cells using immunofluorescence assay; Figure 4 a,i are bright fields. Figure 4 b,j represents the blue field: DAPI. Figure 4 ce stands for green field: EGFP. Figure 4 d, f, g, h represent the red square: TRITC Figure 4 g,h,l means merge.
[0022] Figure 5 Flow cytometry was used to detect the eukaryotic expression vector pcDNA3.1 / Mu3A4-4-1BB-3ζ and...
[0023] Both pLenti / Mu3A4-4-1BB-3ζ lentiviral expression vectors were successfully expressed in CHO cells, and the expression efficiency of the lentiviral expression vector pLenti / 3A4CAR was higher than that of the eukaryotic expression vector pcDNA3.1 / 3A4CAR.
[0024] Figure 6 Flow cytometry confirmed that Mu3A4CAR could be successfully expressed on the surface of T cells. The lentiviral supernatant of Mu3A4CAR could infect T cells with high efficiency (over 40%) and maintain stable expression. In the figure, a is a scatter plot, b is the T cell group uninfected with CAR, and c is the T cell group infected with Mu3A4CAR lentiviral vector. The infected cells were distributed in two groups: one group consisted of Mu3A4CAR+ T cells, and the other group consisted of ordinary T cells. The lentiviral supernatant of Mu3A4CAR could infect T cells with high efficiency (over 40%) and maintain stable expression.
[0025] Figure 7 Flow cytometry results of the binding of 3A4CAR-T cells to KG1a target cells with different effector-to-target ratios showed that as the effector-to-target ratio increased, the ratio of the number of free KG1a cells to the number of bound KG1a cells (upper left quadrant / upper right quadrant) decreased sequentially. When the effector-to-target ratio reached 5:1 or higher, more than 70% of the target cells could be bound by 3A4CAR-T cells.
[0026] Figure 8 The killing effect of Mu3A4CAR-T cells on 3A4 (CD45RA)-positive leukemia cell lines. KG1a is an acute myeloid leukemia cell line, Raji is a B-cell lymphoma cell line, and Nalm-6 is a 3A4-negative B-cell lymphocytic leukemia cell line. Mu3A4CAR-T cells showed significant targeted killing effect on 3A4-positive leukemia / lymphoma cell lines in a dose-dependent manner, but no significant targeted killing effect on 3A4-negative Nalm-6 cells. In the figure, bar represents mean ± standard error. Detailed Implementation
[0027] The present invention will be further described in conjunction with the accompanying drawings and embodiments.
[0028] Example 1: Nucleotide sequence of a chimeric antigen receptor gene of the present invention:
[0029] Through literature review and NCBI analysis, we established the basic structure of Mu3A4CAR: the CD8a leader is the CAR leader chain, Mu3A4scFv is the target recognition region (a single-chain antibody of murine 3A4), the CD8a hinge is the hinge region, the CD8a transmembrane is the CAR transmembrane region, and the intracellular signal transduction region of 4-1BB and the intracellular signal transduction region of CD3ζ are tandemly linked to form the intracellular segment of the CAR. Figure 1 The sequences were verified by comparison with the NCBI gene database. The sequence of CD8a leader (NM_001768) is 51 bp; the sequence of CD8a HingeTM (NM_001768) is 207 bp; the sequence of 4-1BB (NM_001561) is 126 bp; and the sequence of CD3ζ (NM_198053) is 336 bp. The 3A4scFv light and heavy chain genes are derived from patent ZL 2009 10246023.X: the nucleotide sequence of the murine 3A4scFv heavy chain gene is shown in SEQ ID NO.3, and its amino acid sequence is shown in SEQ ID NO.4; the nucleotide sequence of the 3A4scFv light chain gene is shown in SEQ ID NO.5, and its amino acid sequence is shown in SEQ ID NO.6.
[0030] Example 2
[0031] Primers were designed based on the sequences of Mu3A4scFv and the CD8a leader. The Mu3A4scFv sequence containing the CD8a leader was amplified by PCR, with Hind III and EcoRI restriction sites added upstream and downstream, respectively. The upstream primer 3A4-leader P1 sequence is as follows:
[0032] The downstream primer 3A4-leader P2 sequence is: AAGCTTATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCGGCGGCCCAGCCGGCCCAG. Using pcDNA3.1 / Hm3A4-His as a template, the PCR reaction conditions were: 95℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, and 72℃ extension for 1 minute 30 seconds, for a total of 30 cycles; after the last cycle, a 72℃ extension repair for 10 minutes was performed. The reaction was terminated at 4℃ for 20 minutes. The target gene fragment CD8a-3A4 was purified by gel excision, cloned using TA, and ligated to... The easy vector was used to ligate the product and transform competent DH5α bacteria. The transformed bacteria were then plated on LB agar plates containing X-gal, IPTG, and 100 g / ml ampicillin and incubated overnight at 37°C in a water-insulated incubator. A single, well-separated, translucent, pinhead-sized white colony was picked from the TA clone blue-white selection plate using a sterile toothpick and placed in 7 ml of LB liquid medium containing 100 μg / ml ampicillin. The plasmid pGEM-T / CD8a-3A4 was purified and labeled as pGEM-T / CD8a-3A4.
[0033] The plasmids pcDNA3.1 / BB-3ζ (containing TAA), pcDNA3.1 / BB-3ζ-EGFP, and pGEM-T / CD8a-3A4 were extracted and purified. They were digested with EcoRI and HindIII, respectively. The digestion products were subjected to 1% agarose gel electrophoresis at 100V for 30 min. The results were observed using a gel imaging system, and the target gene fragment was recovered from the agarose gel. Ligation was performed using T4 ligase. The ligation product was transformed into competent DH5α cells. Clones were picked from plates and amplified by shaking. Plasmids were extracted, electrophoresed, and the bacterial culture was sent to a gene company for sequencing. Bacterial cultures with correct sequencing results were mixed with 15% glycerol and stored at -80℃. The plasmids were labeled pcDNA3.1 / 3A4-4-1BB-3ζ and pcDNA3.1 / 3A4-4-1BB-3ζ-EGFP, respectively.
[0034] Plasmids pGEM-T / 3A4-4-1BB-3ζ and pLenti were extracted and purified, digested with Xbal I and Sal I, respectively. The digestion products were subjected to 1% agarose gel electrophoresis at 100V for 30 min. The results were observed using a gel imaging system, and the target gene fragment in the agarose gel was recovered. The ligation product was transformed into competent Trans1-Blue cells, and clones were picked and amplified by shaking. Plasmids were extracted, electrophoresed, and the bacterial culture was sent to a relevant gene company for sequencing. The correctly sequenced plasmid was labeled as pLenti / 3A4-4-1BB-3ζ and stored at -80℃.
[0035] Example 3
[0036] (1) Slide preparation: ordinary coverslips are washed, soaked in acid overnight, rinsed with running water, dried, sterilized by autoclaving, and then dried for later use;
[0037] (2) Take Chinese hamster ovary (CHO) cells in the logarithmic growth phase, digest them with trypsin, and thoroughly pipette them to make a single-cell suspension.
[0038] (3) Take a six-well plate, add a small amount of culture medium, carefully place the glass slide into it, and drop the single-cell suspension onto the glass slide one drop at a time, inoculating 4 × 10⁶ cells per well. 5Cells. Incubate overnight at 37°C with 5% CO2;
[0039] (4) After 24 hours, once the cells have grown and fused to about 80% on the coverslip, proceed with the Lipofectamine treatment. TM Following the LTX and Plus instructions, CHO cells were infected with pcDNA3.1 / 3A4-4-1BB-3ζ-EGFP (pcDNA3.1 / 3A4-CAR-EGFP) and pcDNA3.1 plasmid. A negative control group (containing only Lipofectamine) was also set up. TM LTX and Plus), pcDNA3.1 group (CHO / pcDNA3.1) and pcDNA3.1 / 3A4-CAR-EGFP group (CHO / pcDNA3.1-3A4-CAR-EGFP);
[0040] (5) 24 h after transfection, the six-well plate was removed from the 37°C incubator and observed under a fluorescence inverted microscope for the presence of EGFP green fluorescence; 48 h-72 h later, the slide was removed from the six-well plate and rinsed three times with 1×PBS for 5 minutes each time.
[0041] (6) Fix with 4% paraformaldehyde at room temperature for 10 min, then rinse three times with 1×PBS for 5 min each time;
[0042] (7) Permeabilize with 0.2% Triton X-100 for 5 minutes, wash three times with 1×PBS for 5 minutes each time. Block with 4% normal goat serum for 30 minutes;
[0043] (8) Discard the goat serum, wash three times with 1×PBS (5 min each time), add GAM Fab-TRITC humidified chamber (1:200 dilution) and incubate at 37°C for 1 h, then rinse three times with PBS containing 1% Tween for 5 min each time;
[0044] (9) Stain with DAPI for 1 min, then add a drop of glycerin and mount the slide;
[0045] (10) Observe and photograph under a fluorescence microscope.
[0046] After CHO was infected with pcDNA3.1 / 3A4-CAR-EGFP, EGFP green fluorescence could be observed under an inverted fluorescence microscope after 24 hours. Figure 3 Preliminary results indicate that the 3A4-CAR-EGFP fusion protein can be successfully expressed.
[0047] Cell immunofluorescence results showed that ( Figure 4 In transfected CHO cells, TRITC-stained 3A4-CAR expression was observed both intracellularly and in the cell membrane. Figure 4(d, f, g, h white arrows) Intracellular EGFP fluorescent expression is visible. Figure 4 c, e, g, h (white arrows), and DAPI-stained cell nuclei ( Figure 4 (b, c, d, h). The colors of the three are almost completely overlapping. However, CHO cells infected with the empty pcDNA3.1 plasmid only show DAPI-stained nuclei.
[0048] Example 4: Flow cytometry detection of pcDNA3.1 / 3A4-CAR and pLenti / 3A4-CAR protein expression.
[0049] (1) Count the CHO cells transfected for 3-4 days and adjust the concentration to 1×10⁻⁶. 6 / ml, 200μl of cell suspension was taken from each flow cytometry tube, and the empty vector group, pcDNA3.1 / 3A4-CAR group and pLenti / 3A4CAR group were set up;
[0050] (2) Two flow cytometry tubes were set up for each group. The first tube was the isotype control tube, with 4 μl of sheep IgG1-FITC added; the second tube was filled with 4 μl of GAM Fab IgG1-FITC; and incubated at 4°C for 30 minutes.
[0051] (3) After incubation, wash with PBS, centrifuge at 1000 rpm for 5 min each time, twice in total, and detect by flow cytometry.
[0052] The results show ( Figure 5 Both the lentiviral expression vector pLenti / 3A4CAR and the eukaryotic expression vector pcDNA3.1 / 3A4CAR could successfully express the 3A4CAR recombinant protein in CHO cells; and the expression efficiency of the lentiviral expression vector pLenti / 3A4CAR was higher than that of the eukaryotic expression vector pcDNA3.1 / 3A4CAR (mean: 90% vs. 23%; P<0.05).
[0053] Example 5: Flow cytometry detection of 3A4CAR expression on T cell membranes
[0054] (1) Harvest 3A4CAR-T cells and uninfected synchronous T cells around day 7 of infection. After cell counting, collect cells by centrifugation at 1000 rpm for 5 min;
[0055] (2) Two tubes were set up for each group of cells, with 2 x 10 cells per tube. 5 The first tube is the isotype control tube, with 4 μl of sheep IgG1 FITC added; the second tube is the experimental tube, with 4 μl of GAM-Fab-FITC added.
[0056] (3) Incubate at 4℃ in the dark for 30 min;
[0057] (4) Add PBS, wash twice at 1000 rpm for 5 min, and then detect by flow cytometry.
[0058] The results show ( Figure 6 The infected cells were distributed in two groups: one group consisted of 3A4CAR-positive T cells, and the other group consisted of ordinary T cells. After multiple optimizations of the virus packaging, T cell sorting, activation, infection, and culture processes, we were able to package 3A4CAR lentivirus supernatant to infect T cells with high efficiency (over 50%) and achieve stable expression.
[0059] Example 6: Mu3A4CAR-T Specific Killer Leukemia Cell Line
[0060] (1) 3A4-positive KG1a and Raji, and 3A4-negative Nalm-6 were used as target cells and divided into three groups for killing. Each group had five concentration gradients with an effector-to-target ratio (E:T ratio) of 1:1, 2:1, 5:1, 10:1, and 16:1. Under each E:T ratio gradient, a normal T cell group was set as a negative control well, and a Mu3A4 CAR-T cell group was set as an experimental well.
[0061] (2) Count the KG1a, Raji, and Nalm-6 cells in the logarithmic growth phase and take a sufficient number of target cells according to the above experimental design.
[0062] (3) Calcein-AM was dissolved in DMSO to prepare a 1 mg / ml stock solution and stored at -20°C. After diluting the Calcein-AM stock solution 1:4000 with PBS, 10% of the cell volume of the Calcein-AM dilution was added to the target cell suspension. After staining at 37°C for 0.5 h, the cells were washed twice by centrifugation with RPMI 1640 to remove excess dye.
[0063] (4) After centrifugation at 1000 rpm for 5 min, the cell concentrations of the three target cells were adjusted to 10 using fresh RPMI 1640 medium. 6 / ml, take 100μl of each well and add it to the corresponding well plate;
[0064] (5) Prepare Mu3A4 CAR-T cells and T cells at effector-to-target ratios of 1:1, 2:1, 5:1, 10:1, and 16:1. After centrifugation at 1000 rpm for 5 min, remove the magnetic beads, resuspend in fresh 1640 medium, and add to the target cells at the corresponding effector-to-target ratio. Mix thoroughly by pipetting and aspiration.
[0065] (6) Add an appropriate amount of RPMI 1640 complete medium to each well to adjust the cell concentration during incubation of the effector cell and target cell mixture to 1.5 x 10⁻⁶ cells / well. 6 Approximately / ml;
[0066] (7) Place the cells in a 48-well plate and incubate at 37°C in a 5% CO2 incubator for 5 hours in the dark. Then, use a flow cytometer to detect the fluorescence intensity of the target cells. Collect the same number of cells from each tube.
[0067] (8) Kill rate = (fluorescence intensity of target cells in T cell group - fluorescence intensity of target cells in Mu3A4CAR-T cell group) / fluorescence intensity of target cells in T cell group.
[0068] Figure 7 As shown, after 5 hours of incubation, the fluorescence intensity of Calcein-AM in target cells gradually decreased as the effector-to-target ratio increased. Specifically, target cells KG1a were incubated with 3A4CAR-T at different effector-to-target cell (E:T) ratios. With increasing effector-to-target ratio, the ratio of free KG1a to bound KG1a (upper left quadrant / upper right quadrant) decreased sequentially, as follows: (a) E:T = 1:1, ratio 3.24; (b) E:T = 5:1, ratio 0.41; (c) E:T = 10:1, ratio 0.243; (d) E:T = 20:1, ratio 0.126.
[0069] Figure 8 The results showed that Mu3A4CAR-T cells had a certain killing effect on both KG1a and Raji cells compared with uninfected T cells; and the killing function increased with the increase of effector-to-target ratio; Mu3A4CAR-T cells did not have a significant killing effect on Nalm-6 cells that do not express 3A4 antigen.
Claims
1. Use of a non-natural anti-human CD45RA murine-derived chimeric antigen receptor in the manufacture of a medicament for the treatment of B lymphocytic lineage lymphoma, characterized in that, The targeting recognition region of the chimeric antigen receptor is a human CD45RA antigen target, and the chimeric antigen receptor is composed of the following structures in series: a CD8a leader region as a leader region of the chimeric antigen receptor, a murine CD45RA single-chain antibody 3A4scFv as a targeting recognition region, a hinge region of CD8a as a hinge region of the chimeric antigen receptor, a transmembrane region of CD8a as a transmembrane region of the chimeric antigen receptor, an intracellular signal transduction region of 4-1BB and an intracellular signal transduction region of CD3ζ, the 3A4scFv heavy chain gene nucleotide sequence is shown as SEQ ID NO 3, and the amino acid sequence is shown as SEQ ID NO 4; the 3A4scFv light chain gene nucleotide sequence is shown as SEQ ID NO 5, and the amino acid sequence is shown as SEQ ID NO 6; the nucleotide sequence of the CD8a leader region gene is shown as SEQ ID NO 1, the nucleotide sequence of the CD8a hinge region gene is shown as SEQ ID NO 7, the nucleotide sequence of the CD8a transmembrane region gene is shown as SEQ ID NO 9, the nucleotide sequence of the 4-1BB intracellular signal transduction region gene is shown as SEQ ID NO 11, and the nucleotide sequence of the CD3ζ intracellular signal transduction region gene is shown as SEQ ID NO 13.
2. Use of an effector cell in the manufacture of a medicament for treating a B-lymphocyte lineage lymphoma, characterized in that, The effector cell is obtained by transfecting a human T cell with an expression vector, wherein the expression vector comprises a gene encoding the chimeric antigen receptor of claim 1, and the expression vector is a lentivirus vector pLenti-Mu3A4CAR.
Citation Information
Patent Citations
Anti-human CD45RA rat immune globulin variable region gene and application
CN101831434A
Chimeric antigen receptor immune cell provided with safety switch as well as preparation method and application of chimeric antigen receptor immune cell
CN106755023A
Compositions and uses of CD45 targeted chimeric antigen receptor modified t cells
US20230338531A1