Super mini gene editor and application thereof
Patent Information
- Application Number
- CN202310968807.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-03
- Publication Date
- 2026-09-04
- Estimated Expiration
- 2043-08-03
AI Technical Summary
2021年nature报道发现了一个新的小型的TnpB编辑工具,认为是Cas12系统的祖先,而且仅有408个AA,但此报道仅仅在293T细胞中做了靶点的验证,截至目前,尚未见到此编辑工具在其他类型细胞和动物水平的研究报道
[0065] This invention is the first to systematically develop a novel super-mini editor with 380-400 AAs by streamlining the functional domains of the TnpB editor. This super-mini editor can efficiently achieve precise and efficient editing from mammalian cells to live animals, and has great potential for widespread application.
Smart Images

Figure BDA0004374456680000111 
Figure BDA0004374456680000121 
Figure BDA0004374456680000131
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a super-miniature gene editor and its applications. Background Technology
[0002] Gene editing technology refers to the targeted modification (knockout, insertion, replacement, etc.) of genes to obtain new characteristics or functions. From the first-generation DNA nuclease editing system ZFNs and the second-generation TALENs to the third-generation CRISPR / Cas9 system, as well as the CRISPR / Cas9-based BE (Base editing) and PE (Prime editing) systems, gene editing efficiency has continuously improved, editing types have become increasingly diverse, costs have gradually decreased, and the scope of applications has continuously expanded. It has been widely and deeply applied in fields such as medicine, agriculture, energy, materials, and the environment, and many related gene editing products have already been launched on the market, while many more are in clinical trials or pre-market preparation. Of particular importance is that gene editing provides an unprecedentedly powerful tool for the genetic modification and gene therapy of human cells or tissues and other living organisms, which will bring tremendous revolutionary development opportunities to the entire biotechnology industry.
[0003] Early studies revealed that the CRISPR / Cas9 system originates from the innate acquired immune system of bacteria and archaea, defending against the invasion of exogenous DNA through a complex composed of CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), and the Cas9 protein. The in vitro reconstruction of CRISPR / Cas9 in 2012 and the demonstration of its gene-editing function in human cells in 2013 marked the beginning of a new generation of gene editing. Subsequently, this technology has successfully performed gene-editing functions in different cell types and multiple species of plants and animals. However, like TALENs, CRISPR / Cas9 domain ZFNs achieve editing by inducing DNA double-strand breaks at genomic target sites, thereby activating intracellular repair mechanisms. Intracellular DNA double-strand break repair mechanisms include heterologous end joining, which easily induces random insertions and deletions, and homologous recombination repair, which requires the presence of a homologous template for activation. However, heterologous end joining can easily lead to random insertions, which in turn affect the function of the target gene and the stability of the genome. Although homologous recombination (HDR) is more precise than end joining (NHEJ), its homologous recombination repair efficiency in cells is low, approximately 0.1% to 5%, which greatly limits the application of precise gene editing technology. Subsequently, in April 2016, David Liu's laboratory at Harvard University developed a gene editing technology—BE technology—that can perform single-base conversion without relying on DNA double-strand breaks. This technology is based on a complex formed by dCas9 (inactive, ordead Cas9) with no nuclease activity or Cas9n (Cas9 nickase) with single-stranded DNA nicking activity, cytosine deaminase, uracil DNA glycosylase inhibitor (UGI), and sgRNA. Without causing double-stranded DNA breaks, it directly deaminates cytosine (C) at the target site into uracil (U). Due to the presence of the uracil DNA glycosylase inhibitor, the excision of U is inhibited. During DNA replication, U is replaced by thymine (T). Simultaneously, guanine (G), originally complementary to C, on the complementary strand is replaced by adenine (A), ultimately achieving precise single-base editing of CT and GA within a specific activity window. Subsequently, in 2017, a novel single-base editor based on E. coli TadA (ecTadA)—adenine base editors (ABEs)—achieved the conversion of AT base pairs to GC base pairs.Subsequently, scientists both domestically and internationally expanded upon BE technology, successively developing editors such as GCBE and double BE. These various BE editors have been successfully applied to different cell types and different plant and animal species. However, these studies mainly focused on certain types of single-base mutations and could not achieve other types of precise mutations, such as arbitrary point mutations, precise deletions, and insertions. In 2019, David R. Liu's laboratory developed the PE (Prime Editing) system. This system can not only introduce insertions and deletions (indels) but also achieve arbitrary conversions between 12 bases. The working principle of this system is as follows: sgRNA is modified into pegRNA (primeediting guide RNA). PegRNA contains a primer binding site (PBS) region and carries a template sequence for reverse transcription, which can bind to reverse transcriptase (RT). The pegRNA sequence guides the transcription into the target gene sequence to achieve gene editing. Subsequently, domestic and international research groups optimized PE cells in various aspects, such as improving efficiency and increasing the size of deleted and inserted fragments. Moreover, this technology has been successfully applied in various commonly used cells, mouse, zebrafish and other model animals, as well as many plants. However, the editing efficiency in primary cells is currently very low, and there have been no successful reports at the cellular and individual levels in large animals. More importantly, the PE system, like the BE system, is limited in its widespread application in AAV gene therapy systems due to its large size, which is precisely the core key to human gene therapy.
[0004] A significant weakness of Cas9, and the BE and PE systems developed based on it, is the large size of its components, resulting in low cell transfection or delivery efficiency and thus limiting its application. Crucially, the editor's molecular weight is enormous, far exceeding the capacity of AAV gene therapy systems (less than 4.7 kb), thus restricting their application as drugs, treatments, and in vitro / in vivo cellular genetic modifications. The current excessive size of the editor is primarily due to the large molecular weight of the Cas9 core tool, reaching 1368 amino acids. BE and PE systems, built upon this foundation and incorporating other functional domains, further increase the molecular weight, a problem that cannot be solved at the chassis level. Therefore, many research groups both domestically and internationally have begun searching for smaller enzymes within the new Cas system chassis to develop new editing tools. Currently, the main ones include CasMINI (557 AA), AsCas12f1 (422 AA), OgeuIscB (499 AA), and SpCas12f (497 AA), but their efficiency is far lower than Cas9 (averaging only about 2%), and much of the research is limited to the cellular level, rarely extending to animal and plant research or gene therapy studies. While these miniature enzymes are smaller than the Cas9 enzyme (1368 AA), they are still not small enough to fuse different domains for future applications. Clearly, developing a super-small and highly efficient chassis editor remains a core and critical task in the current gene editing research field. In 2021, Nature reported the discovery of a new small TnpB editing tool, considered an ancestor of the Cas12 system, with only 408 AAs. However, this report only validated the target in 293T cells, and to date, no research reports on this editing tool at the other cell types and animal levels have been seen. In 2023, Wang Haoyi et al. reported in Nature 25 TnpBs active in E. coli selected from 64 annotated IS605 members; further cell studies revealed that only 3 were active. Subsequently, through bioinformatics analysis and genomic library screening, editors ISAam1 (369 amino acids) and ISYmu1 (382 amino acids) were obtained. However, these were only validated at the cell level and no gene-edited mouse preparation studies were conducted; their efficiency was also lower than the traditional SaCas9. These studies mainly use big data mining, bioinformatics analysis, and in vitro functional verification to find different types of small editors. However, it is obvious that this method is extremely labor-intensive, and the editing tools selected may not be efficient. For example, AsCas12f and OgeuIscB have almost no editing efficiency at the cellular level. More importantly, there are no reports of the application of these existing editors in the preparation of gene-edited animals. Summary of the Invention
[0005] To address the aforementioned technical challenges, this invention provides a gene editor.
[0006] This invention, for the first time, through engineered operations that streamline the functional domains of the TnpB editor, systematically developed a novel super-mini editor with 380-400 AAs, named SuperMini-(GE380-GE400)-SWL. This editor achieves highly efficient gene editing in different types of mammalian cell lines, with efficiencies ranging from 20% to 60%, averaging 32%, significantly higher than the original TnpB and other small gene editors, and similar to, or even slightly higher than, the classic Cas9 editing efficiency. Furthermore, this invention was the first to successfully apply this novel super-mini editor to gene-edited mice, demonstrating that this super-mini editor can efficiently achieve precise editing from mammalian cells to living animals. Based on this, the invention proposes the following technical solution.
[0007] The development strategy of the gene editor of this invention includes the following steps:
[0008] (1) Analyze the structure of gene editor elements, determine the core functional region and non-core functional region of gene editing, truncate the non-core functional region, and construct gene editor mutants with different truncation types;
[0009] (2) Verify the gene editing efficiency of gene editor mutants at the cellular and / or individual levels.
[0010] In a first aspect, the present invention provides a gene editor having at least one of the following amino acid sequences:
[0011] The amino acid sequences of positions 1-400, 1-399, 1-398, 1-397, 1-396, 1-395, 1-394, 1-393, 1-392, 1-391, 1-390, 1-389, 1-388, 1-387, 1-386, 1-385, 1-384, 1-383, 1-382, 1-381, and 1-380 of the amino acid sequence shown in SEQ ID NO.1.
[0012] Preferably, the gene editor comprises the above-mentioned amino acid sequence and a functional protein; or comprises the above-mentioned amino acid sequence and a polypeptide.
[0013] The functional protein or polypeptide, when linked to the above-mentioned amino acid sequence, will not affect the activity of the above-mentioned amino acid sequence (activity of binding to guide RNA, endonuclease activity, activity of binding to and cleaving specific sites of the target sequence under the guidance of guide RNA, etc.).
[0014] By linking functional elements of functional proteins or peptides, the above-mentioned amino acid sequences can be endowed with a wider range of applications. For example, linking them to nuclear localization signal sequences can enhance the activity of the protein of the present invention in entering the cell nucleus; linking them to key regulatory factors of cell repair mechanisms can increase the proportion of specific repairs by regulating in vivo repair mechanisms.
[0015] Preferably, the functional protein or polypeptide is selected from at least one of the following: epitope tag, reporter gene sequence, nuclear localization signal sequence, transmembrane peptide, targeting portion, transcription activation domain, transcription repression domain, nuclease domain, or domain having the following activities: nucleotide deaminase, methyltransferase activity, demethylase, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity, or nucleic acid binding activity.
[0016] In practice, epitope tags are those well-known to those skilled in the art, including but not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc. Those skilled in the art can select appropriate epitope tags based on the desired purpose (e.g., purification, detection, or tracing).
[0017] In the specific implementation process, the reporter gene sequence is well known to those skilled in the art, including but not limited to GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.
[0018] In practice, the nuclear localization signal sequence (NLS) comprises one or more NLS sequences. The nuclear localization signal sequence is located at, near, or close to the end (e.g., the N-terminus or C-terminus) of the gene editor of this invention.
[0019] In specific implementation, the membrane-penetrating peptides include, but are not limited to, TAT, CPP5, etc., to increase the ability of the gene editor of the present invention to penetrate the cell membrane.
[0020] Secondly, the present invention provides a nucleic acid encoding the aforementioned gene editor.
[0021] In practice, the nucleic acid can be codon-optimized for expression in prokaryotic or eukaryotic cells.
[0022] Thirdly, the present invention provides a complex comprising a protein component and a nucleic acid component;
[0023] The protein component is the aforementioned gene editor;
[0024] The nucleic acid component contains TTGAT / TTTAT features and a guide sequence capable of hybridizing with the target sequence;
[0025] Or the nucleic acid component may contain a nucleotide sequence of guide RNA.
[0026] Protein components and nucleic acid components can combine to form complexes.
[0027] Protein and nucleic acid components can be naturally occurring or modified.
[0028] In some implementations, the target sequence is a non-naturally occurring DNA or RNA sequence.
[0029] In practice, when the target sequence is DNA, the target sequence is located at the 5' end of the adjacent motif (TAM) of the original spacer sequence.
[0030] In some implementations, the target sequence is located inside the cell.
[0031] In some implementations, the target sequence is located in the cell nucleus or in the cytoplasm (such as organelles).
[0032] Preferably, the cells are prokaryotic cells.
[0033] Fourthly, the present invention provides a biological material containing the above-mentioned gene editor, or nucleic acid, or complex, wherein the biological material is an expression cassette, vector, host cell, transgenic cell line, or recombinant microorganism.
[0034] In specific implementation, the vector is a cloning vector or an expression vector. The vector is capable of expressing the aforementioned gene editor, or nucleic acid encoding the gene editor, or the aforementioned complex. The vector includes, but is not limited to, plasmids, bacteriophages, and Cosmids.
[0035] In practice, host cells include, but are not limited to, prokaryotic cells (e.g., Escherichia coli cells), eukaryotic cells (e.g., yeast cells), insect cells, plant cells, or animal cells (e.g., mammalian cells, such as mouse cells or human cells). Host cells can also be cell lines, such as the 293T cell line.
[0036] Fifthly, the present invention provides a delivery composition comprising a delivery vector and at least one of the following components: the gene editor, nucleic acid, complex, and biomaterial described above.
[0037] Preferably, the delivery vector is at least one of the following: lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene gun vectors, and viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses, or adeno-associated viruses).
[0038] The delivery compositions of the present invention can be delivered by any method known in the art, including but not limited to electroporation, lipid transfection, nuclear transfection, microinjection, acoustic pore effect, gene gun, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipid transfection, puncture transfection, optical transfection, reagent-enhanced nucleic acid uptake, and delivery via vectors such as liposomes, immunoliposomes, viral particles, and artificial viruses.
[0039] In a sixth aspect, the present invention provides a pharmaceutical product comprising at least one of the following components: the gene editor, nucleic acid, complex, biomaterial, and delivery composition described above.
[0040] The drugs mentioned include, but are not limited to, those used for gene editing.
[0041] In a seventh aspect, the present invention provides a reagent or kit containing at least one of the following components: the gene editor, nucleic acid, complex, biomaterial, and delivery composition described above.
[0042] The components contained in the reagents or kits of the present invention can be provided in any suitable container.
[0043] In some embodiments, the reagent or kit further comprises one or more buffer solutions. The buffer solution can be any buffer solution, including but not limited to sodium carbonate buffer, sodium bicarbonate buffer, borate buffer, Tris buffer, MOPS buffer, HEPES buffer, and combinations thereof.
[0044] In some embodiments, the reagent or kit further comprises one or more oligonucleotides corresponding to a guide sequence for insertion into the vector to operatively link the guide sequence and the regulatory element.
[0045] In some implementations, the reagent or kit includes a homologous recombinant template polynucleotide.
[0046] Eighthly, the present invention provides the application of the above-mentioned gene editor, nucleic acid, complex, biomaterial, delivery composition, pharmaceutical, reagent or kit in gene editing.
[0047] Preferably, the gene editing is eukaryotic gene editing.
[0048] The eukaryotic organisms include, but are not limited to, humans, monkeys, mice, pigs, cattle, sheep, and rabbits.
[0049] In a ninth aspect, the present invention provides a method for modifying a target gene, comprising modifying the target gene using the aforementioned gene editor, nucleic acid, complex, biological material, delivery composition, pharmaceutical, reagent or kit.
[0050] In the specific implementation process, the above-mentioned gene editor, nucleic acid, complex, biological material, delivery composition, drug, reagent or kit is modified by contacting the target gene, or delivered to cells or embryos containing the target gene, wherein the target sequence is present in the target gene.
[0051] In some implementations, the target gene is present in the embryo or cell.
[0052] Preferably, the target gene is present in eukaryotic cells, more preferably in mammalian cells. The mammalian cells include, but are not limited to, human cells, monkey cells, and cells from non-human primates, cattle, pigs, or rodents.
[0053] In some implementations, the cells are non-mammalian eukaryotic cells, such as poultry or fish.
[0054] In some implementations, the cells are plant cells, such as cultivated plant (e.g., corn, sorghum, wheat, or rice), algae, tree, or vegetable cells.
[0055] In some implementations, the target gene is present in an in vitro nucleic acid molecule (such as a plasmid).
[0056] In some implementations, the method causes a break in the target sequence of the target gene (e.g., a DNA double-strand break or an RNA single-strand break).
[0057] In some implementations, the break results in a reduction in the transcription of the target gene.
[0058] Preferably, the modification method further includes editing the target gene using an editing template (e.g., exogenous nucleic acid).
[0059] In practice, the editing template is brought into contact with the target gene for editing, or it is delivered to cells or embryos containing the target gene for editing.
[0060] In some implementations, the method repairs a broken target gene by homologous recombination with an editing template (e.g., an exogenous nucleic acid), wherein the repair results in a mutation, including the insertion, deletion, or substitution of one or more nucleotides of the target gene.
[0061] In some implementations, the mutation results in a change in one or more amino acids in a protein expressed from a gene containing the target sequence.
[0062] In some implementations, the modification also includes inserting an editing template (e.g., a foreign nucleic acid) into the broken target gene.
[0063] In some embodiments, the modification method is used to modify a cell, cell line, or organism by altering one or more target sequences in a target gene or a nucleic acid molecule encoding a target gene product.
[0064] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0065] This invention is the first to systematically develop a novel super-mini editor with 380-400 AAs by streamlining the functional domains of the TnpB editor. This super-mini editor can efficiently achieve precise and efficient editing from mammalian cells to live animals, and has great potential for widespread application. Attached Figure Description
[0066] Figure 1 This is a graph validating the gene editing efficiency mediated by the original TnpB in HEK293T cells.
[0067] Figure 2 This is a schematic diagram illustrating the development principle of the gene editor SuperMini-(GE380-GE400)-SWL.
[0068] Figure 3 The technology roadmap for the development of the gene editor SuperMini-(GE380-GE400)-SWL.
[0069] Figure 4 This is a diagram validating the efficiency of gene editing mediated at the cellular level by the gene editor SuperMini-(GE380-GE400)-SWL.
[0070] Figure 5 This is a statistical chart showing the in vitro blastocyst rate and mouse birth rate efficiency of the gene editor SuperMini-(GE380-GE400)-SWL.
[0071] Figure 6 This figure validates the efficiency of gene editing mediated at the blastocyst level in mice using the gene editor SuperMini-(GE380-GE400)-SWL.
[0072] Figure 7 This figure validates the efficiency of gene editing mediated at the individual level in SuperMini-(GE380-GE400)-SWL mice using the gene editor. Detailed Implementation
[0073] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0075] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0076] The gene editing principle of the programmable nuclease provided by this invention is as follows: Figure 2 As shown, specifically, when SuperMini-(GE380-GE400)-SWL recognizes the presence of a TAM sequence, the complex formed by the reRNA and the SuperMini-(GE380-GE400)-SWL protein targets the DNA sequence complementary to the reRNA's bases. The DNA double helix opens, and the reRNA binds to one of the single strands, the target strand (TS). At this point, the cleavage activity of the SuperMini-(GE380-GE400)-SWL protease is activated, and both the target strand (TS) and the non-target strand (NTS) are cleaved by the SuperMini-(GE380-GE400)-SWL protease. In the presence of a suitable TAM, different reRNA sequences can be designed to target different DNA fragments.
[0077] Example 1: Cloning of SuperMini-(GE380-GE400)-SWL
[0078] 1. Construction of the original TnpB expression vector
[0079] The amino acid sequence of the original TnpB used in the experiment is shown in SEQ ID NO.1, and the gene sequence is shown in SEQ ID NO.2. The gene fragment was synthesized by Shanghai Bioengineering Co., Ltd. The gene fragment and the pST1374 (Addgene, #13426) vector were digested with EcoRI (purchased from NEB), and then the gene fragment and vector were recombined using recombinase (purchased from Novizan). The recombinant plasmid vector was identified by sequencing, and then the plasmid was extracted.
[0080] 2. Construction of reRNA
[0081] Five endogenous genes were selected from HEK293T cells, and five reRNAs were designed. The site sequences are shown in Table 1 below.
[0082] Table 1. ReRNA recognition sequence list
[0083]
[0084] Twenty complementary upstream and downstream primers were designed based on the target site sequence and dissolved in sterile water to a concentration of 10 μM. After annealing, they were ligated into the pGL3-U6-sgRNA (Addgene, #51133) vector, and the target-specific reRNA was constructed after sequencing verification.
[0085] 3. Culture and transfection of HEK293FT cells
[0086] HEK293FT cells (purchased from ATCC) were resuscitated and cultured in 10 cm culture dishes (Corning, 430167) in DMEM (HyClone, SH30243.01) containing 10% fetal bovine serum (HyClone, SV30087). The culture temperature was 37°C and the carbon dioxide concentration was 5%. After passage, when the cell density reached 80%, the cells were transferred to 12-well plates.
[0087] (1) After cells were separated into trays for 12-14 hours, when the cell concentration was about 80%, transfection was performed using lipo3000 cell transfection reagent (purchased from Thermo);
[0088] (2) The total amount of plasmid transfected per well is 1 μg, of which TnpB expression plasmid and reRNA expression plasmid are mixed at a 1:1 ratio. Mix the plasmids in 75 μl of Opti-MEM (Gibco, 11058021) medium, add 2.5 μl of Lipo3000 cell transfection reagent, and let stand for 5 minutes;
[0089] (3) In addition, 2.75 μl of Lipo3000 cell transfection reagent Lipo3000 was mixed into 75 μl of Opti-MEM medium and left to stand for 5 minutes.
[0090] (4) Mix (2) and (3) slowly by blowing and stirring, and let stand for 20 minutes;
[0091] (5) Add the above-mixed and settled transfection solution to the cultured cells respectively;
[0092] (6) 48-72 hours after transfection, remove the culture medium, wash the cells once with PBS, then digest the cells with TE (Thermo Fisher, R001100), stop the digestion with DMEM containing 10% FBS, centrifuge to collect the cells, and finally resuspend them with culture medium.
[0093] 4. Cutting efficiency verification
[0094] One-sixth of the collected cells were directly lysed, and the target site fragments were amplified by PCR. Primer designs are shown in Table 2. The genomic target site fragments were amplified by PCR using the Novizan High Fidelity Enzyme Kit (Vazyme, p501-d2).
[0095] Table 2 Primers for PCR amplification at different target sites
[0096]
[0097]
[0098] The PCR reaction system is shown in Table 3:
[0099] Table 3 PCR reaction system
[0100]
[0101] The PCR reaction procedure followed the kit instructions. PCR amplification products were purified and recovered using the AxyPrep PCR Clean-up kit (Axygen, AP-PCR-500G) and then analyzed by next-generation sequencing (Shanghai Bioengineering Co., Ltd.). Analysis revealed editing efficiency at all five detected loci, ranging from 20% to 60%. Figure 1 ).
[0102] Example 2: Development of a novel super-mini editor, SuperMini-GE380-GE400-SWL, and verification of its cell-mediated gene editing activity.
[0103] 1. TnpB Functional Domain Truncation and Efficiency Testing
[0104] Based on the efficient gene editing of the original TnpB, this invention analyzes its structure and truncates non-core functional domains. Figure 2 This invention primarily focuses on truncating the functional domain at the C-terminus. Details regarding the different truncated mutant sizes and the verification process can be found in [link to relevant documentation]. Figure 3As shown. Using pST1374-TnpB constructed in Example 1 as the backbone vector, the vector was digested with FseI and BsaI (both purchased from NEB) and purified and recovered using the AxyPrep PCR Clean-up kit (Axygen, AP-PCR-500G). Subsequently, different truncated variants were designed. Using the original TnpB (SEQ ID 2) as a template, forward and reverse primers were designed (primers are shown in Table 4). Forward / Reverse-1, Forward / Reverse-2, Forward / Reverse-3, Forward / Reverse-4, Forward / Reverse-5, Forward / Reverse-6, and Forward / Reverse-7 were used to PCR amplify fragments of 884bp, 911bp, 812bp, 842bp, 902bp, 932bp, and 962bp, respectively, obtaining different truncated variants. The main difference lies in the deletion of 34aa, 25aa, 58aa, 48aa, 28aa, 18aa, and 8aa amino acids at the N-terminus of TnpB. Homologous recombination was used to ligate the backbone vector with the amplified products of different truncated variants, obtaining novel gene editors with different truncated types.
[0105] Table 4 Primer Design for Truncated Verb PCR Amplification
[0106] Forward SEQ ID NO.18 Reverse-1 SEQ ID NO.19 Reverse-2 SEQ ID NO.20 Reverse-3 SEQ ID NO.21 Reverse-4 SEQ ID NO.22 Reverse-5 SEQ ID NO.23 Reverse-6 SEQ ID NO.24 Reverse-7 SEQ ID NO.25
[0107] Subsequently, the functional activity of the six truncated variants was verified using the same methods as shown in 2-3 of Example 1. The truncated variant TnpB and reRNA targeting the endogenous genes ROSA26 and EMX1 were co-transformed into HEK293T cells. After 72 hours, the genome was lysed, and after regional PCR amplification and fragment recovery, the efficiency was first verified using T7E1.
[0108] 1) PCR products were subjected to gradient annealing.
[0109] The concentration of the recovered PCR product obtained above was determined, and the PCR product was subjected to gradient annealing to obtain the gradient annealed PCR product.
[0110] The gradient annealing system described above is shown in Table 5 below.
[0111] Table 5 shows the gradient annealing system.
[0112]
[0113]
[0114] The gradient annealing procedure for the PCR products is shown in Table 6.
[0115] Table 6 shows the gradient annealing procedure for PCR products.
[0116]
[0117] 2) The gradient-annealed PCR products obtained in 1) above were digested with T7E1 enzyme. The digestion system is shown in Table 7 below.
[0118] Table 7 Enzyme digestion system
[0119]
[0120] Reaction procedure: The enzyme digestion reaction shown in Table 7 was carried out in a constant temperature incubator at 37℃ for 1 hour to obtain the enzyme digestion product.
[0121] The enzyme digestion products were analyzed by polyacrylamide gel electrophoresis (PAGE) using an 8% polyacrylamide gel. After electrophoresis, the PAGE gel was stained with EB. The T7E1 cleavage efficiency results are as follows: Figure 4 As shown in Figure A, WT represents HEK293T cells without any transfection. ROSA26 represents the cleavage activity of the original TnpB on the endogenous gene ROSA26. T1-T7 represent the cleavage activities of different truncated TnpB (i.e., the super-novel mini TnpB, named SuperMini-(GE380-GE400)-SWL in this invention) on the endogenous gene ROSA26. Cas represents the cleavage activity of the CRISPR / Cas9 control target designed in this region. The results show that in HEK293T cells, targeting the endogenous gene ROSA26 site and truncating it to 380 aa still exhibits cleavage activity similar to the original TnpB. When further truncated, its cleavage activity is inactivated. No significant difference was observed compared with the cleavage efficiency of the designed Cas9 target.
[0122] The T7E1 results targeting the endogenous genes EMX1 and AGBL1 further confirmed the results of the truncated variant, namely, when TnpB is truncated to 380 aa, it still has cleavage activity similar to the original TnpB. Upon further truncation, its cleavage activity is inactivated. Figure 4 (C, E). Notably, compared to the Cas9 target cleavage efficiency at this site, the cleavage activity of TnpB and each truncated variant was significantly higher than that of Cas9.
[0123] The PCR products were then subjected to amplicon sequencing, and the sequencing results were statistically analyzed using the online software CRISPResso2. Next-generation sequencing analysis further confirmed the T7E1 experimental results. Figure 4(B, D, F). The above results fully demonstrate that the novel super-mini gene editor SuperMini-(GE380-GE400)-SWL obtained in this invention can effectively mediate gene editing at the cellular level.
[0124] Example 3: Validation of gene editing activity at the mouse blastocyst and individual levels mediated by the novel SuperMini-(GE380-GE400)-SWL gene editor.
[0125] This embodiment uses truncated SuperMini-GE380-SWL / SuperMini-GE390-SWL / SuperMini-GE400-SWL (380AA, 390AA, 400AA) and the original TnpB as a chassis to verify its gene editing activity at the blastocyst and individual levels. To facilitate observation of mouse phenotypes, we used the candidate tyr gene as the target; homozygous mutations in this gene can cause mouse fur to change from black to white. The flowchart is shown below. Figure 5 As shown in Figure A.
[0126] 1. Construction of the SuperMini-(GE380-GE400)-SWL expression vector targeting the Tyr gene
[0127] This study selected exon 1 of the Tyr gene as the target site and designed reRNA ( Figure 5 (As shown in B). Subsequently, 20 complementary upstream and downstream primers were designed to target the site sequence. The forward primer is shown in SEQ ID NO.26, and the reverse primer is shown in SEQ ID NO.27. The primers were dissolved in sterile water to a concentration of 10 μM. After annealing, the primers were ligated into the pGL3-U6-sgRNA (Addgene, #51133) vector. Sequencing confirmed the construction of the target-specific reRNA.
[0128] 2. Preparation of tyr gene-edited blastocysts and mice by microinjection
[0129] 1) Superovulation was performed on mice of appropriate age by injecting 10 IU of PMSF (purchased from Ningbo No. 2 Hormone Pharmaceutical Factory) into each mouse intraperitoneally. 48 hours later, 10 IU of HCG (purchased from Ningbo No. 2 Hormone Pharmaceutical Factory) was injected into the intraperitoneal cavity.
[0130] 2) After injecting HCG, female mice were mated with male mice at a 1:1 ratio, and at the same time, eligible recipient female mice were mated with vasectomized male mice at a 1:1 ratio.
[0131] 3) On the second day after mating, select female mice with visible plugs and recipient female mice;
[0132] 4) The female mouse with the plug was euthanized by dislocation, the skin was cut open, and the left and right ovaries of the mouse were removed with ophthalmic scissors and forceps to locate the dilated part of the fallopian tube;
[0133] 5) The fertilized egg is removed from the dilated part of the fallopian tube using an embryo manipulation needle, treated with hyaluronidase (purchased from Sigma), and then collected in the embryo manipulation fluid (purchased from Sigma).
[0134] 6) SuperMini-GE380-SWL, SuperMini-GE390-SWL, SuperMini-GE400-SWL, TnpB, and reRNA were transcribed in vitro (purchased from Thermo). The transcribed products were mixed 1:1, totaling 200 ng / µl. The mixture was then injected into animal embryos using a micromanipulator. Half an hour later, the fertilized eggs in good condition were either placed in mouse embryo culture medium (purchased from Sigma) for in vitro culture or transferred to surrogate mice. For in vitro cultured fertilized eggs, blastocysts could be collected for testing after 3.5 days. For transferred fertilized eggs, mice were born 19 days later, and their phenotypes were observed and their genotypes were analyzed. Statistical analysis of the blastocyst rates revealed that after injection of SuperMini-GE380-SWL, SuperMini-GE390-SWL, SuperMini-GE400-SWL, and TnpB, the blastocyst rates were 73.3%, 75%, 78.7%, and 73.8%, respectively, with no significant difference. Furthermore, this data was essentially consistent with the blastocyst rate of the wild-type control group in vitro. Figure 5 (As shown in C). Further statistical analysis of mouse birth rates revealed that after injection of SuperMini-GE380-SWL, SuperMini-GE390-SWL, SuperMini-GE400-SWL, and TnpB, the birth rates of mice were 37.5%, 34%, 40.4%, and 39.1%, respectively. This is consistent with the birth rates of gene-edited individuals reported in the literature. Figure 5 (As shown in D). The above results confirm that the injected components have no toxic side effects on blastocyst formation and individual birth.
[0135] 3. Detection and analysis of single blastocysts in mice
[0136] Subsequently, single blastocysts from mice were collected, and efficiency statistical analysis was performed on the single blastocysts. The specific procedures are as follows:
[0137] 1) Place the mouse blastocysts in PBS (purchased from Gibco) and rinse 3 times;
[0138] 2) Aliquot 10 μL of embryo lysis buffer (purchased from Thermo) into a 200 μL PCR tube. Use a microinjection needle to aspirate single blastocysts into the lysis buffer. Place the above system in a PCR instrument and run the following program: 55°C for 2 h; 95°C for 10 min.
[0139] 3) The processed single blastocysts were subjected to nested PCR amplification, with Tyr-F / R used for the first round of amplification and Tyr-F1 / R1 used for the second round of amplification. The nested amplification primers were designed as follows:
[0140] Tyr-F: TTAACCTATTGGTGCAG (SEQ ID NO. 28);
[0141] Tyr-R: TTAACCTATTGGTGCAG (SEQ ID NO. 29);
[0142] Tyr-F1: GTGATGACCGTGAGTCCT (SEQ ID NO. 30);
[0143] Tyr-R1: CCCAGTTAGTTCTCGAATTTC (SEQ ID NO. 31);
[0144] The PCR amplification system was the same as described in section 1.4 of Example 1. The PCR amplification products obtained from single blastocyst amplification were subjected to T7E1 assays (method described in Example 2) and next-generation sequencing analysis. The results are as follows... Figure 6 As shown, SuperMini-GE380-SWL, SuperMini-GE390-SWL, and SuperMini-GE400-SWL can all effectively mediate gene editing at the mouse blastocyst level.
[0145] 4. Genotyping analysis at the individual mouse level
[0146] Two weeks after birth, the mice's phenotype was observed. Phenotypic analysis revealed that mice born after the injection exhibited varying degrees of albinism. Figure 7 As shown in Figure A). By extracting the mouse tail genome for PCR amplification (using the same amplification system as described above) and next-generation sequencing analysis, varying degrees of gene editing were observed in the Tyr gene in mice. Figure 7 (As shown in BC).
[0147] In summary, this invention effectively overcomes the shortcomings of existing gene editing tools. The newly discovered super-mini gene editor can efficiently mediate gene editing at the cellular / individual level and has high industrial application value.
[0148] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A gene editor, characterized in that, Its amino acid sequence is positions 1 to 400 of the sequence shown in SEQ ID NO.
1.
2. The nucleic acid encoding the gene editor of claim 1.
3. A complex, characterized in that, Includes protein components and nucleic acid components; The protein component is the gene editor as described in claim 1; The nucleic acid component contains TTGAT features and a guide sequence capable of hybridizing with the target sequence; Or the nucleic acid component may contain a nucleotide sequence of guide RNA.
4. A biomaterial, characterized in that, It contains the gene editor of claim 1, or the nucleic acid of claim 2, or the complex of claim 3; the biological material is an expression cassette, a vector, or a host cell.
5. A delivery composition, characterized in that, It contains a delivery vector and at least one of the following components: the gene editor of claim 1, the nucleic acid of claim 2, or the complex of claim 3.
6. The delivery composition according to claim 5, characterized in that, The delivery vector is at least one of the following: lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene gun vectors, and viral vectors.
7. A medicine, characterized in that, It contains at least one of the following components: the gene editor of claim 1, the nucleic acid of claim 2, the complex of claim 3, the biomaterial of claim 4, and the delivery composition of claim 5 or 6.
8. A reagent or kit, characterized in that, It contains at least one of the following components: the gene editor of claim 1, the nucleic acid of claim 2, the complex of claim 3, the biomaterial of claim 4, and the delivery composition of claim 5 or 6.
9. The use of the gene editor of claim 1, the nucleic acid of claim 2, the complex of claim 3, the biomaterial of claim 4, the delivery composition of claim 5 or 6, the pharmaceutical product of claim 7, and the reagent or kit of claim 8 in gene editing; wherein the use is for purposes other than disease diagnosis and treatment.
10. A method for modifying a target gene for purposes other than disease diagnosis and treatment, characterized in that, include: The target gene is modified using at least one of the gene editor of claim 1, the nucleic acid of claim 2, the complex of claim 3, the biomaterial of claim 4, the delivery composition of claim 5 or 6, the pharmaceutical product of claim 7, and the reagent or kit of claim 8.
11. The modification method according to claim 10, characterized in that, The modification method also includes editing the target gene using an editing template.