Use of ccl15 neutralizing antibodies in the preparation of a medicament for inhibiting growth of liver cancer

Abstract

The application discloses application of a CCL15 neutralizing antibody in preparation of a medicine for inhibiting growth of liver cancer, and comprises the following steps: S1, constructing a mouse liver cancer PDX model and performing passage; S2, randomly dividing the immunodeficient mouse after passage into a control group and an experimental group, and performing dosing treatment on the control group and the experimental group every three days; S3, PDX model tumor tissue evaluation, stripping tumor tissues after 11 times of dosing of the control group and the experimental group, and respectively observing and recording the volume and weight of the tumor tissues of the control group and the experimental group; the method for inhibiting growth of liver cancer provided by the application, CCL15 acts on the stellate cells to activate the stellate cells and make the expression spectrum of the stellate cells change significantly, the CCL15 neutralizing antibody has an anti-tumor effect in the liver cancer PDX model through injection, and tumor-derived CCL15 can indirectly promote growth of liver cancer cells by activating the hepatic stellate cells.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering. Specifically, it is the application of CCL15 neutralizing antibody in the preparation of a drug for inhibiting the growth of liver cancer. BACKGROUND

[0002] Hepatocellular carcinoma (HCC) accounts for more than 85-90% of primary liver cancer. Although surgical resection is the main treatment method for HCC, due to the insidious clinical manifestations of early HCC, most patients are diagnosed as advanced at the beginning and cannot undergo radical surgery. For patients who have no surgical opportunity, the current treatment methods are mainly interventional therapy and immunotherapy. Although these therapies can achieve some effects, the long-term treatment effects in many patients are not satisfactory. Therefore, exploring new treatment targets is crucial for effective treatment of liver cancer. SUMMARY

[0003] To this end, the technical problem to be solved by the present application is to provide the application of CCL15 neutralizing antibody in the preparation of a drug for inhibiting the growth of liver cancer. CCL15 acts on stellate cells to activate them and cause significant changes in the expression profile. CCL15 from tumors has an anti-tumor effect in liver cancer PDX models by injecting CCL15 neutralizing antibody. Tumor-derived CCL15 can indirectly promote the growth of liver cancer cells by activating hepatic stellate cells.

[0004] To solve the above technical problems, the present application provides the following technical solutions:

[0005] The application of CCL15 neutralizing antibody in the preparation of a drug for inhibiting the growth of liver cancer comprises the following steps:

[0006] S1, constructing a mouse liver cancer PDX model, transplanting a sample of primary tumor tissue into an immunodeficient mouse, and removing the tumor tissue when the tumor in the immunodeficient mouse grows to a predetermined volume to construct a liver cancer xenotransplant PDX model and pass it on;

[0007] S2, administering neutralizing antibodies, and randomly dividing the immunodeficient mice after passage into a control group and an experimental group when the tumor in the immunodeficient mice after passage grows to a predetermined volume. The control group and the experimental group are given drug treatment every three days, wherein the control group of immunodeficient mice is injected with 3 mg / kg of IgG in the abdominal cavity, and the experimental group of immunodeficient mice is injected with 3 mg / kg of CCL15 Ab in the abdominal cavity.

[0008] S3, evaluating the tumor tissue of the PDX model, removing the tumor tissue after 11 administrations in the control group and the experimental group, and observing and recording the volume and weight of the tumor tissue in the control group and the experimental group, respectively.

[0009] The CCL15 from liver cancer cells can significantly affect the proliferation of liver cancer cells in a co-culture experiment system, the expression of human liver stellate cell activation markers alpha-SMA and FAP is increased in a CCL15 dose-dependent manner by adding different concentrations of human recombinant CCL15 in human liver stellate cell culture solution, the liver stellate cells present obvious dendritic and long spindle shape after CCL15 treatment, and CCL15 can promote the migration and invasion ability of liver stellate cells, and the expression of CCL15 and the liver stellate cell activation marker alpha-SMA is positively correlated in liver cancer tissue.

[0010] The technical scheme of the present application achieves the following beneficial technical effects:

[0011] The liver cancer cells in liver cancer specifically secrete CCL15, CCL15 acts on the stellate cells to activate and cause significant changes in the expression profile of the stellate cells, the activated stellate cells promote tumor growth by secreting various pro-cancer factors, in in vivo experiments, the growth of tumors can be effectively inhibited by injecting CCL15 neutralizing antibodies, targeting CCL15 signal may be an effective method to improve the therapeutic effect of liver cancer, the CCL15 neutralizing antibodies have an anti-tumor effect in a liver cancer PDX model, and tumor-derived CCL15 can indirectly promote the growth of liver cancer cells by activating liver stellate cells. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 The immunofluorescence identification schematic diagram of human primary liver cancer cells and fibroblasts for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer;

[0013] Figure 2 The CCL15 qPCR detection result schematic diagram in human primary liver cancer cells and fibroblasts for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer;

[0014] Figure 3 The CCL15 Western blot detection result schematic diagram in human primary liver cancer cells and fibroblasts for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer;

[0015] Figure 4 The CCL15 expression localization schematic diagram in human liver cancer tissue for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer;

[0016] Figure 5 The CCL15 activated liver stellate cell scratch function experiment result schematic diagram for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer;

[0017] Figure 6Figure 1 is a schematic diagram of the transwell function experiment results of CCL15 activated hepatic stellate cells for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer.

[0018] Figure 7 Figure 2 is a schematic diagram of the Western blot experiment results of CCL15 activated hepatic stellate cells for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer.

[0019] Figure 8 Figure 3 is a schematic diagram of the expression profile of the secreted factors of the activated stellate cells stimulated by CCL15 for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer.

[0020] Figure 9 Figure 4 is a schematic diagram of the administration mode of the neutralizing antibody for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer.

[0021] Figure 10 Figure 5 is a schematic diagram of the tumor tissue of the immunodeficient mice for the application of the CCL15 neutralizing antibody of the present application in preparing a drug for inhibiting the growth of liver cancer.

[0022] In the figure, (a) is a schematic diagram of the tumor growth curve in vivo of the immunodeficient mice; (b) is a schematic diagram of the weighing results of the tumor tissues peeled off from the immunodeficient mice; and (c) is a schematic diagram of the volume of the tumor tissues peeled off from the immunodeficient mice. DETAILED DESCRIPTION

[0023] In order to further illustrate the technical means adopted by the present application and its effects, the technical solutions of the present application will be further described below by means of specific embodiments, but the present application is not limited in the scope of the embodiments.

[0024] All the animals of the present application are bred and reproduced in the SPF (Specific Pathogen Free) level experimental animal center.

[0025] All the primary tumor tissue samples of the present application are derived from the tumor tissue sample bank of the three-A-level hospital.

[0026] The experimental preparation process is as follows:

[0027] The tissue sections of 31 cases of HCC tissues and para-cancer tissues and 17 cases of HCC tissue samples are provided by the Tumor Hospital of Tianjin Medical University, all the tumor types are diagnosed by pathology, each patient has obtained the written consent for using their tissues for research purposes after surgery, and all the research procedures comply with the regulations of the Research Ethics Committee of the Tumor Hospital of Tianjin Medical University, and the clinical pathological data of the patients are shown in Table 1 and Table 2.

[0028] Table 1 31 cases of HCC tissue and paracancerous tissue

[0029]

[0030] Table 2 17 cases of HCC tissue specimens

[0031] 2、Experimental cells: LX-2.

[0032] 3、Experimental animals: NOD / SCID or NSG mice

[0033] The experimental instruments are shown in Table 3:

[0034] Table 3 Experimental instruments

[0035] The experimental reagents are shown in Table 4:

[0036] Table 4 Experimental reagents

[0037]

[0038] 4.1、Preparation of trypsin digestion solution

[0039] Prepare 4L 1xPBS buffer, after high pressure, stand at room temperature, add 5.48mL 0.5M EDTA solution (PH=8.0) and 10g trypsin powder, stir until dissolved; after surface sterilization with 75% alcohol solution, transfer to biological safety cabinet, filter with 0.22μm filter, aliquot and store at-20℃.

[0040] Accurately weigh 60.57g Tris (250mM) and 87.66g NaCl, add 800mL double distilled water and stir until dissolved, adjust PH to 7.4-7.6, make up to 1L, filter with 0.22μm filter, store at room temperature, when used, take 200mL 10x buffer, add 1800mL double distilled water to dilute to 2L 1xTBS, then add 1mL tween-20, stir well to prepare 1xTBST.

[0041] 4.3、Preparation of 10% protein blocking buffer

[0042] Weigh 5g skimmed milk powder, add 50mL prepared 1xTBST, stir until dissolved, prepare fresh.

[0043] 4.4、Preparation of 10X electrophoresis buffer

[0044] Accurately weigh 30.2g of Tris, 188g of glycine, and 10g of SDS, add double distilled water and stir to dissolve, and then dilute to 1L.

[0045] Accurately weigh 61g of Tris and 288g of glycine, add 1600mL of double distilled water, stir to dissolve, filter through a 0.22μm filter, and then dilute to 2L. Store at room temperature. When used, dilute 100ml of 10x buffer, 100ml of methanol, and double distilled water to 1L to prepare 1x transfer buffer.

[0046] 4.6, Preparation of complete medium

[0047] Take 50mL as an example:

[0048] DMEM base medium (Gibco, C11995500BT, 500mL) - 45mL; inactivated fetal bovine serum (FBS) - 5mL; double antibiotic - 500μL (100x mixture of ampicillin and streptomycin) (P1400, 100mL); non-essential amino acids 100X (N1250, 100ml).

[0049] DMEM / F-12 (1:1) medium (Gibco, C11330500BT, 500mL) - 45mL; inactivated fetal bovine serum (FBS) - 10mL; double antibiotic - 500μL (100x mixture of ampicillin and streptomycin) (P1400, 100mL); non-essential amino acids 100X (N1250, 100ml).

[0050] Take 1mL as an example: inactivated fetal bovine serum - 900ul; DMSO: 100μL.

[0051] (1) Take the cell cryopreservation tube out of liquid nitrogen immediately and place it in a 37℃ constant temperature water bath to quickly thaw the cells;

[0052] (2) Absorb the thawed cell suspension into a centrifuge tube, add 2mL of complete medium, and centrifuge at 800rpm for 5min;

[0053] (3) Discard the supernatant, resuspend the pellet at the bottom of the centrifuge tube with 1mL of new complete medium, transfer the pellet to a culture dish, add 9mL of complete medium to the culture dish, and mix crossly;

[0054] (4) Place in the incubator and culture for 6h, then observe the adhesion of the cells, discard the original culture medium within 12-20h, wash with PPS, and then replace the new culture medium, and then place in a 37℃ constant temperature incubator for continuous culture.

[0055] (1) Discard the culture medium in the culture dish and wash with 2 mL of PBS solution. When washing, do not add PBS directly to the bottom of the culture dish. Instead, add the liquid gently to the edge of the culture dish.

[0056] (2) Discard the PBS and add 2 mL of 0.25% trypsin digestion solution containing EDTA to chelate calcium ions, thereby increasing the digestion capacity. Different cells have different adhesion abilities and corresponding digestion times. Therefore, observe the digestion of the cells under a microscope in a timely manner. When the cell edges are observed to be round and the cell spacing is clear under a microscope, the digestion is complete.

[0057] (3) Discard the trypsin and add complete medium to stop the digestion. Repeat the blowing and beating of the cells in the dish to make them fall off the wall and become a cell suspension, and then place it in a centrifuge tube and centrifuge at 800 rpm for 5 min.

[0058] (4) Resuspend the cell pellet after centrifugation with 2 mL of medium. Divide the cells evenly into two culture dishes and add an equal amount of medium. Mix crosswise and incubate at 37°C in an incubator.

[0059] Generally, the color of the culture medium during cell culture is pink and alkaline. However, during cell culture, the solution may turn yellow or slightly yellow due to the digestion and absorption of nutrients by the cells and the secretion of intracellular substances, which can be used as an indicator for medium replacement.

[0060] The application of CCL15 neutralizing antibody in the preparation of a drug for inhibiting the growth of liver cancer includes the following steps:

[0061] S1, constructing a mouse liver cancer PDX model, transplanting a sample of primary tumor tissue into an immunodeficient mouse, and stripping the tumor tissue when the tumor in the immunodeficient mouse grows to a predetermined volume to construct a liver cancer xenograft PDX model and pass it on;

[0062] S2, administering neutralizing antibodies, and after the tumor in the immunodeficient mouse after passage grows to a predetermined volume, randomly dividing the immunodeficient mouse after passage into a control group and an experimental group, and every three days administering drug treatment to the control group and the experimental group, respectively, wherein the control group of immunodeficient mice is injected intraperitoneally with 3 mg / kg of IgG, and the experimental group of immunodeficient mice is injected intraperitoneally with 3 mg / kg of CCL15 Ab;

[0063] S3, PDX model tumor tissue evaluation, stripping the tumor tissue after 11 administrations of the control group and the experimental group, and observing and recording the volume and weight of the tumor tissue of the control group and the experimental group, respectively.

[0064] Example 1: Experimental verification of CCL15 secreted by cancer cells in liver cancer

[0065] I. Extraction and identification of human primary hepatocarcinoma cells and fibroblasts

[0066] (1) Tissue preparation: immediately after the tissue is removed from the body, small pieces of hepatocarcinoma tissue (about 1 cm 3 ) are cut and placed in DMEM / F-12 culture medium containing 1% penicillin-streptomycin, which must be absolutely sterile, and then transferred to a clean bench as soon as possible, and the following operations are prepared;

[0067] (2) Trim the cancer and paracancer tissue pieces in serum-free medium (paracancer tissue is liver tissue 2 cm away from the tumor edge, the case comes from the Department of Hepatobiliary Surgery of Tianjin Tumor Hospital, the patient underwent partial hepatectomy, the diagnosis is hepatocellular carcinoma, and the patient has not undergone radiotherapy and chemotherapy before surgery, which meets the ethical review standards and obtains the informed consent of the patient), cut into pieces of about 1-3 mm, trim the tissue pieces, and wash the blood in the tissue with serum-free medium, transfer the tissue pieces and serum-free medium (hereinafter referred to as "wash") to a 15 mL centrifuge tube, stand for 1-2 min, and use the wash to repeat 2-3 times to make the tissue transparent to reduce the retention of blood cells as much as possible;

[0068] (3) Discard the wash, add 5 mL of trypsin, and digest in a 37°C water bath for 5-10 minutes. Observe the tissue in the 15 mL centrifuge tube to coagulate and adhere to the best degree of digestion;

[0069] (4) Discard the trypsin, add wash to stop trypsin digestion, and repeat the wash 2-3 times to remove the remaining trypsin;

[0070] (5) Discard the wash, add 3-5 mL of IV collagenase-containing medium, transfer to a 50 mL centrifuge tube for digestion, and observe the tissue pieces to be best digested when they are connected by silk. Add medium to stop digestion and transfer to a 15 mL centrifuge tube;

[0071] (6) Centrifuge at 3500 rpm for 3 minutes, discard the supernatant, wash the collagenase 2-3 times with wash, centrifuge, discard the supernatant, add DMEM / F-12 medium, mix well, and transfer to a culture bottle or dish. Add 20% FBS DMEM / F-12 medium (containing 1% double antibody) to the culture bottle or dish, mix gently, and place in a 37°C, 5% CO2 incubator.

[0072] (7) Purification of human primary liver cancer cells and CAF: Change the medium every 3 days. When the cells grow to cover 70% to 80% of the bottom of the flask, separate and purify the primary cells. For culture dishes with abundant CAF, use natural passage method for purification. Then add DMEM / F-12 medium (serum concentration of 20%) containing 100 ng / ml bFGF and continue to culture. Passage 3 times. For culture dishes with abundant epithelial cells, use collagenase digestion method for purification. Wash twice with PBS and add 2 ml of 0.5% type IV collagenase solution. Stop digestion when most fibroblast-like cells become round and fall off. Wash twice with PBS and add DMEM / F-12 medium (serum concentration of 20%) and continue to culture. When the cells cover 80% to 90% of the bottom of the flask again, repeat this process until the cell morphology tends to be stable.

[0073] (8) Identification of human primary liver cancer cells and CAF: After the liver cancer cells and CAF cells have reached 80%-90% confluence, they are digested, centrifuged and collected. After resuspending in culture medium, they are dropped into 24-well plates with cell spreaders. After culturing in a 37°C, 5% CO2 incubator for 24 hours, when the cell confluence rate reaches 40%-50%, they are washed 3 times with pre-cooled PBS for 5 minutes each time.

[0074] (9) Fix the cells in 4% formaldehyde at room temperature for 20 min, and wash them three times with PBS for 5 min each time;

[0075] (10) Treat with 0.1% Triton X-100 for 10 min at room temperature, then wash with PBS 3 times for 5 min each time;

[0076] (11) Block with 5% BSA, incubate at room temperature for 20 min, add primary antibody, incubate overnight at 4°C, wash 3 times with PBS for 5 min each time;

[0077] (12) Add fluorescent secondary antibody, incubate at room temperature in the dark for 2 hours, wash with PBS 3 times, 5 minutes each time;

[0078] (13) Stain the nuclei with DAPI, incubate in the dark for 5 min, and wash with PBS 3 times, 5 min each time;

[0079] (14) Observe the quantity and distribution of fluorescence under a fluorescence microscope.

[0080] The results of immunofluorescence staining were as follows: Figure 1 As shown, CK18 staining was positive in the cytoplasm of primary liver cancer cells, while CAF was positive for α-SMA protein staining, indicating that liver cancer cells and CAF have been successfully isolated. Therefore, it can be concluded that CK18 staining was positive in the cytoplasm of primary liver cancer cells, while α-SMA protein staining was positive for CAF.

[0081] II. qPCR to detect mRNA level of CCL15 secreted by cancer cells specifically in hepatocellular carcinoma

[0082] After the hepatocellular carcinoma cells and CAFs are cultured to 80-90% confluence, the cell culture solution is aspirated and discarded, an appropriate amount of Trizol is added, and the adherent cells are blown off by pipetting with a pipette gun, transferred to a 1.5 mL enzyme-free EP tube, and repeatedly blown to completely lyse. The consumables used in the experiment are all free of RNase, including the following steps:

[0083] (1) Add 1 / 5 volume of chloroform to the EP tube, shake well for about 30 seconds, and stand at room temperature for 15 minutes. Centrifuge (12000 rpm, 4°C) for 15 minutes;

[0084] (2) Carefully aspirate the upper aqueous phase, and transfer the collected upper aqueous phase to a new Eppendorf tube. Add an equal volume of isopropanol, mix well by repeatedly inverting, and stand at room temperature for 30 minutes. Centrifuge (12000 rpm, 4°C) for 30 minutes;

[0085] (3) Discard the isopropanol, add 1 mL of 75% ethanol prepared by DEPC, mix gently, and centrifuge (12000 rpm, 4°C) for 5 minutes;

[0086] (4) Repeat steps (1)-(3), discard the 75% ethanol, and dry the precipitate;

[0087] (5) Add 15-25 μL (depending on the yield) of DEPC-treated TE buffer or water to the RNA precipitate;

[0088] (6) The RNA solution is detected for purity and concentration using NanoDrop2000, and is stored at -80°C for standby. Samples with a total mass of greater than 1 μg can be used for further experiments.

[0089] (7) Reverse transcription, using Hifair® Ⅲ 1st Strand cDNA Synthesis Kit (gDNA digester plus) kit (Cat#19332 Yixing), reverse transcription of total RNA into complementary deoxyribonucleic acid (cDNA), according to the kit instructions, first remove residual genomic DNA, prepare the mixture in an RNase free centrifuge tube, prepare the system as shown in Table 5, gently mix with a pipette, and incubate at 42°C for 2 min;

[0090] Table 5 Reverse transcription system mixture preparation

[0091]

[0092] (8) The reverse transcription reaction system was prepared (20 μL system) in the reaction tube after removing residual genomic DNA according to Table 6, and mixed gently with a pipette.

[0093] Table 6 Reverse transcription reaction system preparation

[0094]

[0095] (9) The reverse transcription standard program was set as shown in Table 7;

[0096] Table 7 Reverse transcription standard program

[0097]

[0098] 10) The reverse transcription product was stored at -20°C for standby;

[0099] (11) The sample map was designed according to the sample and primer design;

[0100] (12) The system was configured (configuration system number = sample number + 1, system number = primer number, avoid light), and the expression level of CCL15 in the sample was detected by 2xSYBR Green qRT-PCR Mix (With ROX) kit (Sparkjade), the PCR primer was synthesized by Sangon Biotech, the upstream and downstream primers of CCL15 were 5' GCATGAAAAAGCTGAAGCCCT 3' and 5' ACCAAGAAACTCACAGGAGGT 3', the upstream and downstream primers of the internal reference gene GAPDH were 5' GAGTCAACGGATTTGGTCGT 3' and 5' TTGATTTTGGAGGGATCTCG 3', the primer sequence was shown in Table 8, and the reaction system (20 μL) was shown in Table 9 according to the kit instructions:

[0101] Table 8 Primer sequence

[0102]

[0103] Table 9 Real-time fluorescent quantitative PCR system preparation

[0104]

[0105] (14) The program was set, and the real-time quantitative PCR instrument was used according to the following program: 94 ℃, 3 min, 94 ℃, 30 s, Tm 30 s, 72 ℃, 1.5 min, 35 cycles;

[0106] (15) Data processing: GAPDH was used as the internal reference gene. The average CT value of the three replicates was taken as the CT value of the sample. ΔCT = CT (target gene) - CT (internal reference), ΔΔCT = ΔCT (experimental group) - ΔCT (control group), and the relative expression level = 2. -ΔΔCT .

[0107] qPCR test results as follows Figure 2 As shown, CCL15 is expressed in primary hepatocellular carcinoma cells, while almost no CCL15 is expressed in CAF cells, suggesting that CCL15 is specifically expressed in hepatocellular carcinoma cells. Therefore, the level of CCL15 mRNA is specifically expressed in hepatocellular carcinoma cells.

[0108] III. Western blot analysis of protein levels: CCL15 is specifically secreted by liver cancer cells.

[0109] 1) Protein extraction

[0110] (1) Use a suction pump to aspirate the culture medium in the well plate, wash with pre-cooled PBS solution and discard. When aspirating the culture medium, follow the well wall and do not aspirate the cells. Aspirate the PBS dry to prevent dilution of subsequent solutions.

[0111] (2) Add RIPA cell lysis buffer to the well plate, place it on ice and shake it together on a shaker at 80-100 rpm / min to allow it to fully lyse. Note that the protease inhibitor PMSF (1:100) should be added before using RIPA.

[0112] (3) Use a cell scraper to scrape the cells to the bottom, and use a pipette tip to mix them and aspirate them into an EP tube;

[0113] (4) Place the mixed sample from step (3) in a high-speed centrifuge at 13000 rpm and centrifuge at 4°C for 30 min;

[0114] (5) Aspirate the supernatant, discard the precipitate at the bottom of the EP tube, and add 5× loading dye;

[0115] (6) Place the sample from step (5) in a 98°C metal bath for 15 minutes. Note that if boiling is used, water must not enter the EP tube. The EP tube will be heated and the pressure will increase, causing the EP tube cap to burst. Therefore, you must continuously release the gas.

[0116] (7) After centrifuging and vortexing to mix the protein sample, centrifuge again, label it and store it in a refrigerator at -20℃ or -80℃ for a long time.

[0117] 2) Western Blot

[0118] (1) Prepare the glue mixing clamp and glass plate for glue mixing, and check for any damage;

[0119] (2) leak detection, clean the glass plate-thin plate and thick plate, and splice the thick plate with the thin plate, align the lower part, put it into the clamp, clamp it, and clamp it on the plastic shelf, add steam water, observe whether the liquid level will decrease over time, then pour off the water and wipe dry with absorbent paper;

[0120] (3) glue preparation (15% ExpressCast PAGE color gel kit P2014, Xin Saimei Biological Technology Co., Ltd.), the thickness of the prepared gel is 1.50 mm, including the following steps:

[0121] ① Respectively take equal volume of lower layer glue solution 4 ml and lower layer glue buffer 4 ml, mix gently;

[0122] ② Add 80 μl of modified coagulant to the above mixture, mix well;

[0123] ③ Pour the prepared solution into the gel plate, add an appropriate amount of alcohol or water, press flat and separate the gel for 15-30 min, after the lower layer of glue solidifies, discard the upper layer of water or alcohol, and use filter paper to absorb the excess water or alcohol;

[0124] ④ Respectively take equal volume of upper layer glue solution 1 ml and color upper layer glue buffer 1 ml, mix gently;

[0125] ⑤ Add 20 μl of modified coagulant to the above mixture, mix well;

[0126] ⑥ Pour the prepared solution into the gel plate, slowly insert the comb;

[0127] ⑦ After the upper layer of glue solidifies (15-30 min), remove the comb;

[0128] (4) The prepared gel plate is temporarily stored in a 4°C refrigerator, wrapped with toilet paper and plastic wrap;

[0129] (5) After the sample is taken out from the -20°C refrigerator, it is placed on ice to melt, boiled again, shaken and mixed, and centrifuged, and the maker is prepared;

[0130] (6) Place the prepared gel plate and the balance plate in the electrophoresis tank and clamp them, ensure that the added electrophoresis liquid is not leaked between the gel plate and the balance plate, and note that the thin plate is inside and the thick plate is outside;

[0131] (7) Configure the electrophoresis liquid, dilute 10X running buffer to 1X before use, and add the prepared liquid between the two plates without damaging the gel;

[0132] (8) Gently pull out the comb on the gel plate, add the sample, insert the lead wire, the red color is the positive electrode, and the black color is the negative electrode, and the initial voltage is 90V;

[0133] (9) Electrophoresis to the desired maker, when in the right position, turn off the electrophoresis instrument, and prepare for the membrane transfer;

[0134] (10) Membrane transfer, before membrane transfer, the PVDF membrane needs to be activated with methanol, the gel plate is taken out and placed on the prepared tray, the prepared membrane transfer solution is added to the tray, the thick plate is pried open with a lever, and the protein is cut off according to the required position and maker, the cut gel strip is immersed in the membrane transfer solution, the clamp is placed, and the blackboard is placed downward in sequence, sponge-filter paper-PVDF membrane-gel strip-filter paper-sponge blackboard, and each layer needs to be soaked in the membrane transfer solution to chase the bubbles;

[0135] (11) The gel plate and the balance plate after electrophoresis in step (9) are placed in the membrane transfer groove, the membrane transfer solution is added, an ice bag is covered on the electrode cover, and the whole membrane transfer groove is placed in ice;

[0136] (12) Adjust the membrane transfer voltage and membrane transfer time according to the size of the different proteins, and do not move the clamp during membrane transfer to prevent the membrane from being damaged;

[0137] (13) Prepare the blocking milk, mix 100 mL TBST + 10 g skim milk powder on a homogenizer for subsequent use;

[0138] (14) After membrane transfer, the PVDF membrane is taken out and soaked in the prepared milk, and placed on a shaker for 2 hours;

[0139] (15) Prepare the primary antibody, use the primary antibody diluent, prepare the primary antibody according to the proportion in the instruction, take the membrane out of the milk, add the primary antibody, and shake at 4°C overnight;

[0140] (16) Add the secondary antibody, take the membrane out of the primary antibody, wash it in 1*TBST for 3 times within 5 minutes, add the secondary antibody, the species of the secondary antibody is determined according to the primary antibody, and the dilution multiple of the secondary antibody is determined according to the instruction, and place it at room temperature for 2 hours;

[0141] (17) Exposure, take the membrane out of the secondary antibody, wash it in 1*TBST for 3 times within 5 minutes, add AB luminescent solution on the membrane, and place it in an exposure machine for exposure.

[0142] The Western blot detection result is shown as Figure 3 indicated, CCL15 is expressed in primary liver cancer cells, and CAF cells have almost no CCL15 expression, indicating that CCL15 is specifically expressed in cancer cells in liver cancer, and therefore the protein level of CCL15 is specifically expressed in cancer cells in liver cancer.

[0143] Four, multicolor immunohistochemical detection of CCL15 expression localization in liver cancer tissue

[0144] (1) Paraffin section dewaxing to water, the section is placed in environmental protection type dewaxing liquid I 10 min-environmental protection type dewaxing liquid II 10 min-environmental protection type dewaxing liquid III 10 min-anhydrous ethanol I 5 min-anhydrous ethanol II 5 min-anhydrous ethanol III 5 min-distilled water wash;

[0145] (2) Antigen repair, the repair process should prevent the buffer from excessive evaporation, do not dry the slice, after the repair is completed, naturally cool, place the slide in PBS (PH 7.4) in the decoloring shaker and wash 3 times, 5 min each time;

[0146] (3) Circle drawing, hydrogen peroxide sealing, group organization pen draws a circle around the tissue, the section is placed in 3% hydrogen peroxide solution, incubated at room temperature for 25 min, sealing endogenous peroxidase, place the slide in PBS (PH 7.4) in the decoloring shaker and shake 3 times, 5 min each time;

[0147] (4) Serum sealing, shake dry PBS, drop BSA (the first antibody is goat-derived, use 10% rabbit serum to seal, the first antibody is other-derived, use 3% BSA to seal), seal for 30 min;

[0148] (5) Add the first kind of first antibody, remove the sealing liquid, drop the prepared first antibody, and incubate overnight at 4°C in a wet box;

[0149] (6) Add the corresponding HRP-labeled second antibody, place the slide in PBS (PH 7.4) in the decoloring shaker and wash 3 times, 5 min each time, drop the corresponding HRP-labeled second antibody, incubate at room temperature for 50 min;

[0150] (7) Add CY5-TSA (or 488-TSA), place the slide in PBS (PH 7.4) in the decoloring shaker and wash 3 times, 5 min each time, drop TSA, avoid light, incubate at room temperature for 10 min, after incubation, place the slide in TBST in the decoloring shaker and shake 3 times, 5 min each time;

[0151] (8) Microwave treatment, place the tissue section in a repair box filled with repair buffer in the microwave oven for heating treatment (the type of repair liquid is the same as the first repair, keep consistent), 8 min at medium heat, 8 min after stopping the fire, 7 min at medium-low heat;

[0152] (9) Add the second kind of first antibody, drop the prepared first antibody, and incubate overnight at 4°C in a wet box;

[0153] (10) Add the corresponding secondary antibody, and shake the slide in PBS (PH 7.4) on a decolorizing shaker for 3 times, 5 min each time, add the corresponding HRP-labeled secondary antibody dropwise into the circle, incubate at room temperature for 50 min in the dark, and shake the slide in PBS (PH 7.4) on a decolorizing shaker for 3 times, 5 min each time;

[0154] (11) DAPI re-stain the cell nucleus, add DAPI staining solution dropwise, and incubate at room temperature for 10 min in the dark;

[0155] (12) Quench the tissue autofluorescence, shake the slide in PBS (PH 7.4) on a decolorizing shaker for 3 times, 5 min each time, add autofluorescence quencher B solution, and incubate for 5 min, and then rinse with running water for 10 min;

[0156] (13) Mounting: mount the slide with an anti-fluorescence quenching mounting agent;

[0157] (14) Collect images, DAPI excitation wavelength 330-380 nm, emission wavelength 420 nm, 488 excitation wavelength 465-495 nm, emission wavelength 515-555 nm, and CY5 excitation wavelength 608-648 nm, emission wavelength 672-712 nm.

[0158] The results of the multi-color immunohistochemical detection are shown as Figure 4 indicated, the localization of CCL15 is co-localized with CK18 (a liver cancer marker) in primary liver cancer cells, indicating that CCL15 is specifically expressed in liver cancer cells in liver cancer tissue, and therefore CCL15 is specifically expressed in liver cancer cells in liver cancer tissue.

[0159] (1) According to the required cells, the seeding cell amount reaches 70-80% of the monolayer after 24 h of culture in the culture well plate;

[0160] (2) Then remove the cell culture medium, then add PBS for washing, use a 1 mL pipette gun head to gently draw a line in the hole, the head should be vertical during drawing, and the drawing process must not stop, and the entire scratch width should be kept consistent, about 2-3 straight lines are drawn in one hole, and then the PBS is used to wash away the detached cells, and then fresh complete culture medium is supplemented, at this time the experimental group treatment is added, and then cultured for 48 h;

[0161] 3) During this period, at time points 12, 24, 36, and 48, observe the monolayer cells under a microscope, and take pictures of the monolayer view with a microscope for quantitative evaluation.

[0162] The results of the scratch test are shown as Figure 5As shown, the migration ability of LX-2 cells was increased after treatment with 75 ng / ml rCCL15, and the migration ability of LX-2 cells was decreased after treatment with 75 ng / ml rCCL15 and addition of blocking agent BX471, thus it can be known that CCL15 can activate hepatic stellate cells through CCR1 receptor, so as to activate stellate cell line and accelerate the migration ability of cells.

[0163] II. Transwell detection of activation of stellate cell line by CCL15

[0164] (1) Matrigel plating: Matrigel gel was taken out from -20°C and placed in 4°C overnight to melt, and was prepared in ice box. The required pipette tip and EP tube should be pre-cooled in -20°C refrigerator. Matrigel gel was diluted with RPMI1640 culture medium stock solution at a ratio of 1:4, and was evenly plated into the chamber in two times of 30 ml each time, and was placed in 37°C incubator for 30 min each time to make Matrigel into flat and bubble-free gel (transfection experiment does not need to plate gel, and other steps are the same).

[0165] (2) Preparation of cell suspension: the cell density of digested cells was adjusted to 5×10 5 cells / ml;

[0166] (3) Cell inoculation: cell suspension was added to the chamber (5×10 4 cells);

[0167] (4) 500 μL of culture medium containing 20% FBS was added to the lower chamber of 24-well plate;

[0168] (5) Incubation in 37°C cell culture incubator for 24-48 hours;

[0169] (6) Result statistics:

[0170] ① Take out the Transwell chamber and discard the culture medium in the chamber;

[0171] ② Soak with PBS for 2-3 times, 5 minutes each time;

[0172] ③ Fix with 4% paraformaldehyde fixing solution for 30 minutes;

[0173] ④ Soak with PBS for 2-3 times, 5 minutes each time;

[0174] ⑤ Stain with 0.1% crystal violet for 20 minutes;

[0175] ⑥ Gently wipe the cells in the chamber with a wet cotton swab;

[0176] ⑦ Soak with PBS for 2-3 times, 5 minutes each time;

[0177] (8) Microscope observation, counting and statistics.

[0178] Transwell function experiment results showed that, as shown in Figure 6 75ng / ml rCCL15 treatment LX-2 accelerated the migration and invasion ability of cells, 75ng / ml rCCL15 treatment LX-2 while adding BX471 can block this phenomenon, suggesting that CCL15 activates hepatic stellate cells, so CCL15 can activate hepatic stellate cells through CCR1 receptor, accelerate the migration and invasion ability of cells.

[0179] Western blot experiment results showed that, as shown in Figure 7 CCL15 stimulates hepatic stellate cells to make hepatic stellate cell activation marker α-SMA, Vimentin, FAP expression up-regulation, while BX471 can block this phenomenon, suggesting that CCL15 activates hepatic stellate cells, thus illustrating that CCL15 can activate hepatic stellate cells through CCR1 receptor, make stellate cell line activation marker up-regulation, suggesting that CCL15 activates hepatic stellate cells.

[0180] Example 3: CCL15 stimulates activated stellate cell secretion factor expression profile changes

[0181] (1) Collect PBS, stimulate hepatic stellate cell supernatant with CCL15 recombinant protein;

[0182] (2) According to the manufacturer's instructions, qualitative analysis was performed using human cytokine array kit.

[0183] Cytokine chip information is shown as follows:

[0184] Human Cytokine Array Kit (ARY022B; R&D Systems)

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191] Cytokine-like array experiment results are shown as follows: Figure 8As shown, CCL15 stimulates hepatic stellate cells to up-regulate the expression of 9 cytokines such as PLAUR, TSP-1, MIF, etc., thereby indicating that CCL15 stimulates the activation of hepatic stellate cells and up-regulates the expression of 9 cytokines such as PLAUR, TSP-1 (THBS1), MIF, PTX3 (TSG-14), CXCL5 (ENA-78), CCL2 (MCAF), FGF-19, CST3 (ARMD11), and BDNF, among which there are proteins that promote the proliferation of hepatocellular carcinoma cells.

[0192] Example 3: Intraperitoneal injection of CCL15 neutralizing antibody inhibits tumor growth in a mouse PDX model of hepatocellular carcinoma

[0193] (1) In the operating room, use sterile instruments to obtain fresh ex vivo tumor tissue from the patient and place it in a sterile centrifuge tube containing PDX protection solution (DMEM / F-12 medium + 1% double antibody);

[0194] (2) Within 2 hours, transfer the centrifuge tube containing the tumor tissue to the experimental animal center in a low-temperature (4°C on ice) environment;

[0195] (3) Sterilize the biosafety cabinet in advance with ultraviolet light, and wash the tumor tissue once with PDX protection solution to remove surface residual bloodstains;

[0196] (4) In a sterile cell culture dish, use sterile instruments to remove the fascia and necrotic tissue, then cut the fresh tumor tissue into 2 parts, the first part is used for mouse in vivo planting, and the second part is fixed with tissue fixative and paraffin-embedded;

[0197] (5) Separate the first part of step (4) into several 2 mm diameter small tumor tissue particles in a cell culture dish;

[0198] (6) Shave the NOD / SCID or NSG mouse in the biosafety cabinet, disinfect with alcohol cotton ball, then use a trocar to inoculate the tumor tissue particles subcutaneously on the dorsal side of the NOD / SCID or NSG mouse, and label and mark it well.

[0199] (7) Identification and subculture of PDX model, including the following steps:

[0200] ① After inoculation of the tumor tissue particles, observe the NOD / SCID or NSG mouse for the presence of tumor mass on the body surface twice a week;

[0201] ② After the first observation of tumor mass on the body surface of the NOD / SCID or NSG mouse, measure the tumor growth twice a week using a vernier caliper, record the long diameter (L) and short diameter (W) of the tumor, and calculate the tumor volume (TV): TV = (L x W x W) / 2;

[0202] ③ When the tumor volume in mice reaches 1000 mm 3 In accordance with animal ethics, the mice were euthanized, tumor tissue was extracted, and the tissue was passaged, preserved alive, fixed, and RNA was preserved.

[0203] ④ The patient's original tumor tissue is named P0, the tumor tissue that grows after the first inoculation into the mouse is named P1, and the corresponding tumor tissues are named P2 and P3 in turn as the number of passages continues.

[0204] ⑤ Use paraffin-embedded specimens of the patient's original tumor tissue (P0) and the tumor tissue grown by mice (P1) for HE staining and immunohistochemical staining for liver cancer markers. The pathologist confirms the similarity of the tissue morphology of P0 and P1 and the tumor nature of P1.

[0205] ⑥ The P1 tumor tissue was confirmed as liver cancer, and the PDX model that was highly similar to P0 (similarity greater than 90%) was further passaged or the tissue was preserved alive.

[0206] II. CCL15 Neutralizing Antibody Information

[0207] mouse anti-human CCL15 (MAB363; R&D Systems)

[0208] III. Neutralizing Antibody Administration Methods

[0209] Neutralizing antibody administration methods such as Figure 9 As shown, in order to study the therapeutic effect of CCL15 neutralizing antibody, a pharmacodynamic experiment was conducted on a nude mouse subcutaneous tumor model using PDX tumors that expressed CCL1AB5 positive. When the tumor volume reached about 100 mm3, the nude mice were randomly divided into a control group (IgG) and an experimental group (CCL15 Ab, 3 mg / kg), with 7 mice in each group. The drugs were administered every three days for a total of 11 administrations.

[0210] from Figure 10 As shown in (a), the tumor growth curves indicate that CCL15 Ab treatment significantly delayed tumor growth compared to the control group (P=0.0060). The tumors were collected and weighed after the mice were sacrificed on day 36, showing the following results: Figure 10 (b) and Figure 10 As shown in (c), the tumor weight in the control group was 2.783±0.7807g, and the tumor weight in the experimental group was 1.639±0.5997g. The tumor volume and weight were smaller after CCL15 Ab treatment.

[0211] From the above, liver cancer cells specifically secrete CCL15 in liver cancer, CCL15 acts on stellate cells to activate them and cause significant changes in the expression profile, activated stellate cells promote tumor growth by secreting various pro-cancer factors, in in vivo experiments, the growth of tumors can be effectively inhibited by injecting CCL15 neutralizing antibodies, targeting CCL15 signal may be an effective method to improve the therapeutic effect of liver cancer, CCL15 neutralizing antibodies have anti-tumor effect in liver cancer PDX model.

[0212] Although CCL15 can promote the invasion and migration ability of liver cancer cells, it has no direct effect on the proliferation of liver cancer cells itself, the above results show that the expression level of CCL15 is significantly positively correlated with the size of liver cancer, which suggests that CCL15 may have an indirect role in promoting liver cancer growth, therefore, it can be known that stromal cells in the microenvironment of liver cancer may play an important role, and hepatic stellate cells are the most important stromal cells in the microenvironment of liver cancer, therefore, co-culture experiments of liver cancer cells and human hepatic stellate cells were carried out, the results showed that CCL15 from liver cancer cells can significantly affect the proliferation of liver cancer cells in the co-culture system, further, it can be known that the addition of different concentrations of human recombinant CCL15 in human hepatic stellate cell culture medium increased the expression of α-SMA and FAP, the activation markers of human hepatic stellate cells, and had CCL15 dose-dependent, after CCL15 treatment, hepatic stellate cells showed obvious dendritic, long spindle shape, at the same time, CCL15 can promote the migration and invasion ability of hepatic stellate cells, and a positive correlation between CCL15 and the expression of α-SMA, the activation marker of hepatic stellate cells, was found in liver cancer tissue, which indicated that tumor-derived CCL15 can indirectly promote the growth of liver cancer cells by activating hepatic stellate cells.

[0213] Obviously, the above embodiments are only examples for the purpose of clear illustration, and are not intended to limit the embodiments. Based on the above description, other different forms of changes or variations can also be made by those of ordinary skill in the art. Here, it is not necessary and impossible to exhaust all embodiments. The obvious changes or variations derived therefrom are still within the protection scope of the claims of the present patent application.

Claims

1. Use of a CCL15 neutralizing antibody for the manufacture of a medicament for inhibiting the growth of a liver cancer, characterized in that, CCL15 activates the astrocyte line, including the following steps: S1, constructing a mouse liver cancer PDX model, transplanting a sample of primary tumor tissue into an immunodeficient mouse, and stripping the tumor tissue when the tumor in the immunodeficient mouse grows to a preset volume to construct a liver cancer xenograft PDX model and passaging; S2, administering neutralizing antibodies, after the tumor in the immunodeficient mouse after passaging grows to a preset volume, the immunodeficient mouse after passaging is randomly divided into a control group and an experimental group, and the control group and the experimental group are respectively administered every three days, wherein the control group of immunodeficient mice is injected with 3 mg / kg of IgG in the abdominal cavity, and the experimental group of immunodeficient mice is injected with 3 mg / kg of CCL15 Ab in the abdominal cavity; S3, PDX model tumor tissue evaluation, after the control group and the experimental group are administered 11 times, the tumor tissue is stripped, and the volume and weight of the tumor tissue in the control group and the experimental group are observed and recorded.

2. Use of the CCL15 neutralizing antibody according to claim 1 for the manufacture of a medicament for inhibiting the growth of a liver cancer. The immunodeficient mouse is any one or a combination of NOD / SCID and NSG.

3. Use of the CCL15 neutralizing antibody according to claim 1 for the manufacture of a medicament for inhibiting the growth of liver cancer. In step S1, the method for constructing a mouse liver cancer PDX model includes the following steps: (1) using sterile instruments to place fresh ex vivo primary tumor tissue in a sterile centrifuge tube containing PDX protection solution, shaving the immunodeficient mouse in a biological safety cabinet and disinfecting with alcohol cotton balls; (2) after removing the fascia and necrotic tissue in the primary tumor tissue with sterile instruments in a sterile cell culture dish, cutting the tumor tissue into two parts, the first part is used for mouse in vivo planting, and the second part is fixed with tissue fixative and paraffin-embedded; (3) separating the first part of the primary tumor tissue in A2 into several 2 mm diameter tumor tissue particles P0 in a cell culture dish, using a trocar to inoculate the tumor tissue particles P0 into several immunodeficient mice subcutaneously on the back, and labeling and marking well; (4) after inoculating the primary tumor tissue particles P0 into the immunodeficient mouse, observing the immunodeficient mouse's body surface tumor twice a week, and measuring the tumor growth with a vernier caliper; (5) When the tumor volume of the mice grows to 1000 ± 100 mm 3 , the mice are sacrificed according to the animal ethics and the tumor tissue P1 is stripped. According to the continuation of the number of passages, the tumor tissues are sequentially P2, P3, …, Pn. The initial tumor tissue PO and the paraffin specimen of the tumor tissue P1 inoculated into the mouse body for the first time are subjected to HE staining and immunohistochemical staining of liver cancer markers. The similarity of the morphologies of PO and P1 tissues and the tumor properties of P1 are confirmed by a pathologist. (6) confirming the P1 tumor tissue as liver cancer, and further passaging or tissue alive preserving the PDX model with a similarity of more than 90% to P0.

4. Use of the CCL15 neutralizing antibody according to claim 3 for the manufacture of a medicament for inhibiting the growth of a liver cancer. In step (1), the PDX protection solution is a mixture of DMEM / F-12 medium and 1% double-antibody; In step (2), the tumor tissue in the centrifuge tube is washed with PDX protection solution to remove surface bloodstains before being transferred to a sterile cell culture dish for sterilization treatment in a biological safety cabinet sterilized with ultraviolet light.

5. Use of the CCL15 neutralizing antibody according to claim 3 for the manufacture of a medicament for inhibiting the growth of a liver cancer, characterized in that, In step (4), after the immunodeficient mouse's body surface first appears a lump, the tumor growth is measured twice a week using a vernier caliper, and the long diameter (L) and short diameter (W) of the tumor are recorded, and the tumor volume (TV) is calculated: TV= (L x W x W) / 2.

Images