Use of a csrnpi inhibitor in the preparation of a medicament for the treatment of liver ischemia reperfusion injury

By designing CSRNP1 inhibitors to interfere with CSRNP1 gene expression and inhibit the MAPK pathway, the problem of effective treatment for hepatic ischemia-reperfusion injury was solved, significantly reducing hepatocyte apoptosis and providing a new molecular mechanism for the treatment of HIRI.

CN117281906BActive Publication Date: 2026-06-26ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311350004.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-18
Publication Date
2026-06-26
Estimated Expiration
2043-10-18

AI Technical Summary

Technical Problem

Current technologies lack effective drugs to prevent or treat liver ischemia-reperfusion injury (HIRI), especially given the high incidence of early graft dysfunction (EAD) after liver transplantation and the worsening situation when using extended standard donors (ECD). The role of altered CSRNP1 gene expression in HIRI remains unclear.

Method used

We designed siRNA and shRNA targeting the CSRNP1 gene as CSRNP1 inhibitors. By inhibiting the expression or activity of the CSRNP1 gene, we interfered with the MAPK pathway, especially the phosphorylation of SAPK, and reduced hepatocyte apoptosis.

Benefits of technology

It significantly reduces hepatocyte apoptosis after hypoxia-reoxygenation, alleviates HIRI, provides a new molecular mechanism for the treatment of HIRI, and offers a new strategy for clinical treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004499951050000031
    Figure BDA0004499951050000031
  • Figure BDA0004499951050000041
    Figure BDA0004499951050000041
  • Figure HDA0004499951080000011
    Figure HDA0004499951080000011
Patent Text Reader

Abstract

The application provides application of a CSRNP1 inhibitor in preparation of a medicine for treating liver ischemia-reperfusion injury. The application further clarifies a molecular mechanism in which CSRNP1 improves hepatocyte injury by targeting a MAPK signaling pathway mediated cell apoptosis in the process of ischemia-reperfusion, and provides a new treatment strategy for reducing ischemia-reperfusion injury in a liver surgery process, by deeply analyzing expression changes of CSRNP1 in the process of liver ischemia-reperfusion and correlation between the expression changes and ischemia-reperfusion injury caused by a liver surgery.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the application of CSRNP1 in the preparation of drugs for treating hepatic ischemia-reperfusion injury. Background Technology

[0002] Hepatic ischemia-reperfusion injury (HIRI) is a significant factor influencing postoperative mortality and complications after liver surgery. HIRI can further lead to dysfunction and damage in other remote organs, ultimately resulting in multiple organ dysfunction syndrome. Despite numerous efforts to protect the liver from injury, there are currently no effective drugs to prevent or treat HIRI, and the incidence of early allograft dysfunction (EAD) after liver transplantation remains between 2% and 23%. Unfortunately, the situation is exacerbated when using marginal liver transplants from extended criteria donors (ECDs). While the use of ECD donors expands the donor pool, these pre-damaged organs are more prone to HIRI during organ storage and transplantation. HIRI can be caused by hypoxic injury, intracellular metabolic dysfunction, oxidative stress, innate immune responses, adaptive immunity, and ultimately, hepatocyte death. The mitogen-activated protein kinase (MAPK) pathway plays a crucial role in the progression of HIRI. Key proteins in the MAPK family include extracellular signal-regulated kinase (ERK), c-jun-terminal kinase (JNK, also known as stress-activated kinase (SAPK)), and p38 MAPK (p38). Pro-inflammatory cytokines produced during hepatic irritable renal inflammatory syndrome (IRI), including TNF-α and ROS, can regulate MAPK activation. Therefore, targeting key regulatory molecules of redox responses and blocking oxidative stress are important strategies for treating IRI.

[0003] The cysteine- and serine-rich nucleoprotein 1 (CSRNP1), also known as axin1 upregulation 1 (Axud1), is a novel protein that plays a crucial role in cell proliferation and apoptosis. Previous studies have shown that CSRNP1, carrying AXIN gene mutations in human cancer cells, may act as a tumor suppressor. In Drosophila, Glavic et al. first demonstrated a direct link between CSRNP1 induction and apoptosis, with CSRNP1 overexpression inducing SAPK-dependent apoptosis. Consistent with this, CSRNP1 has also been reported to induce apoptosis by upregulating SAPK phosphorylation. However, whether altered CSRNP1 gene expression during HIRI affects hepatocyte apoptosis remains uncertain. This study aimed to investigate the gene expression profiles in human and mouse liver samples under HIRI conditions and to examine the role of CSRNP1 in mediating HIRI. Our results indicate that increased CSRNP1 gene expression was detected in both mouse liver IRI and hepatocyte hypoxia-reoxygenation models, thereby inducing hepatocyte apoptosis. In addition, the MAPK signaling pathway has been identified as being involved in CSRNP1-mediated hepatocyte apoptosis. Summary of the Invention

[0004] In light of the above background, this invention proposes the application of CSRNP1 in the treatment of HIRI. By deeply analyzing the changes in CSRNP1 expression during HIRI and its correlation with ischemia-reperfusion injury caused by liver resection or liver transplantation, this invention further elucidates the molecular mechanism by which increased CSRNP1 transcription during ischemia-reperfusion and the significant inhibition of MAPK pathway phosphorylation by CSRNP1 knockdown, especially stress-activated protein kinase (SAPK), thereby alleviating hepatocyte apoptosis injury. This provides a new treatment strategy for the clinical treatment of HIRI.

[0005] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0006] This invention, based on extensive and in-depth research using in vitro cell models, in vivo animal models, and clinical patient samples, has for the first time discovered a close correlation between CSRNP1 gene expression levels and ischemia-reperfusion injury after liver transplantation. It can serve as a potential target for further research into the application of the CSRNP1 gene and its encoded protein in the prevention, treatment, or alleviation of HIRI. Specifically, this involves the application of CSRNP1 inhibitors in the preparation of drugs for treating ischemia-reperfusion injury after liver transplantation, wherein the CSRNP1 inhibitor is a reagent that inhibits the expression or activity of the CSRNP1 gene.

[0007] This invention utilizes siRNA technology to design siRNA targeting the CSRNP1 gene as a CSRNP1 inhibitor. It was verified that knocking down CSRNP1 gene expression can reduce hepatocyte apoptosis by inhibiting MAPK pathway activation, thereby alleviating hepatocyte damage after in vitro hypoxia-reoxygenation. Furthermore, this invention utilizes adeno-associated virus type 8 (AAV) encapsulation and delivery shRNA technology to design shRNA targeting the CSRNP1 gene as a CSRNP1 inhibitor. In mouse liver, it was verified that knocking down CSRNP1 gene expression can reduce hepatocyte apoptosis by inhibiting MAPK pathway activation, thereby alleviating hepatocyte-induced liver injury (HIRI) in mice. Therefore, the CSRNP1 gene in this invention has the function of regulating hepatocyte hypoxia-reoxygenation injury and alleviating HIRI in mice.

[0008] The CSRNP1 inhibitor is siCSRNP1, the sense sequence of siCSRNP1 is shown in SEQ ID NO.1, and the antisense sequence is shown in SEQ ID NO.2;

[0009] Or shCSRNP1, the sequence of which is shown in SEQ ID NO.5.

[0010] In summary, the experimental results of this invention demonstrate that reducing the expression or activity of the CSRNP1 gene can significantly reduce hepatocyte apoptosis after hypoxia-reoxygenation and alleviate HIRI in mice, showing potential value for the prevention and treatment of ischemia-reperfusion injury in transplanted livers.

[0011] The beneficial effects of this invention are as follows: by deeply analyzing the changes in CSRNP1 expression during HIRI and its correlation with ischemia-reperfusion injury caused by liver resection or liver transplantation, it further clarifies that CSRNP1 transcription increases during ischemia-reperfusion, and that CSRNP1 knockdown significantly inhibits stress-activated protein kinase (SAPK) activation, thus proposing the application of CSRNP1 in the treatment of HIRI and providing a new treatment strategy for clinical practice. Attached Figure Description

[0012] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below.

[0013] Figure 1 CSRNP1 expression was upregulated after HIRI. A shows the quantitative PCR results of an in vitro hepatocyte hypoxia-reoxygenation (H / R) model; B shows the quantitative PCR results of an in vivo mouse HIRI model; C shows the quantitative PCR results of clinical liver transplant patient samples; and D shows the stained tissue sections of clinical liver transplant patient samples.

[0014] Figure 2CSRNP1 gene knockdown effectively alleviates H / R injury in in vitro hepatocytes. A is the experimental flowchart; B shows the mRNA expression level of CSRNP1 in AML-12 cells transfected with si-CSRNP1 or negative controls that experienced or did not experience H / R injury, respectively; C shows the protein expression level of CSRNP1 in AML-12 cells transfected with si-CSRNP1 or negative controls that experienced H / R injury; D shows the apoptosis status and statistical graph of AML-12 cells transfected with si-CSRNP1 or negative controls that experienced H / R injury by flow cytometry using Annexin V-FITC / PI method; E shows the expression levels and bar charts of apoptosis-related proteins Bax and cleaved caspase 3 in AML-12 cells transfected with si-CSRNP1 or negative controls that experienced H / R injury; F shows the results and bar charts of MAPK pathway-related proteins and their phosphorylation levels in AML-12 cells transfected with si-CSRNP1 or negative controls that experienced H / R injury.

[0015] Figure 3 CSRNP1 gene knockdown effectively alleviates HIRI in mice in vivo. A is the experimental flowchart; B shows the mRNA expression levels of genes such as CSRNP1, IL-1β, MMP9, and TNF-α in the liver of mice infected with AAV8-shCSRNP1 or negative control virus after HIRI or sham surgery; C shows the serum liver enzyme levels in mice infected with AAV8-shCSRNP1 or negative control virus after HIRI or sham surgery; D shows the expression levels and bar charts of apoptosis-related proteins Bax, Bcl2, and MAPK pathway-related protein SAPK and their phosphorylation in the liver of mice infected with AAV8-shCSRNP1 or negative control virus after HIRI or sham surgery; E shows HE staining and immunohistochemical staining of mouse liver tissue sections with CSRNP1, Cleaved caspase3, and P-SAPK. Detailed Implementation

[0016] Example 1: Upregulation of CSRNP1 expression during in vitro hepatocyte hemolysis / regeneration (H / R) process

[0017] Experimental groups: negative control Sham, H6 / R6 (hypoxia for 6 hours, reoxygenation for 6 hours), H12 / R12, H24 / R12.

[0018] Constructing a mouse hepatocyte line AML-12 cell H / R model: Log-phase AML-12 cells were seeded in 10cm dishes at a density of 5 × 10⁶ cells / cm². 6Cells were cultured in each dish for 24 hours, followed by hypoxia. The cell culture medium was replaced with serum-free and glucose-free medium, and the cells were cultured in a hypoxic incubator (1 vol% oxygen partial pressure) for 6, 12, and 24 hours, respectively. After that, the cells were replaced with normal medium and reoxygenated in a normal incubator for the time indicated for each group. Cells were then collected.

[0019] Total RNA was extracted from AML-12 cells used to construct the H / R model and subjected to RT-qPCR experiments to detect the mRNA expression level of CSRNP1 (primer sequences are shown in Table 1). Figure 1 A. Experimental results show that the expression level of CSRNP1 increases in AML-12 cells during H / R injury, and the increase is most significant during H24 / R12.

[0020] Table 1. Primer sequences

[0021]

[0022]

[0023] Example 2: Upregulation of CSRNP1 expression in the liver of mice after HIRI in vivo

[0024] Experimental groups: negative control Sham, HIRI (liver ischemia for 1.5 hours, reperfusion for 6 hours).

[0025] Establishing a mouse HIRI model: In a laminar flow operating room, mice were anesthetized by intraperitoneal injection of 1 wt% sodium pentobarbital solution (60 mg / kg body weight). The mice were fixed on a clean operating table, and the upper 1 / 3 of the abdomen was accessed via the linea alba to fully expose the hepatic hilum. The portal vein and hepatic artery supplying the liver were isolated, and a non-invasive vascular clip was placed to block blood flow. 0.5 mL of normal saline was added, and the abdominal cavity was temporarily closed with warm, moistened gauze and placed in an incubator. After 90 minutes, the abdomen was reopened, the vascular clip was removed, blood supply to the liver was restored, the abdominal cavity was sutured closed, and the mice were placed in an incubator. This group was designated as the HIRI group. The Sham group underwent the same laparotomy and was placed in an incubator, but without vascular clip placement.

[0026] Total RNA was extracted from liver tissues of Sham group and mice used to construct the HIRI model for RT-qPCR experiments (primer sequences are shown in Table 1). Figure 1 B. Experimental results showed that the mRMA expression level of CSRNP1 in the liver of mice was significantly increased after HIRI.

[0027] Example 3: Upregulation of CSRNP1 expression in liver samples from clinical liver transplant recipients

[0028] Experimental groups: Before liver transplantation (Before LT) and After liver transplantation (After LT).

[0029] Clinical sample collection: Before the transplanted liver was implanted into the recipient, a liver tissue sample about the size of a grain of rice was taken as the Before LT group; about 2 hours after the transplanted liver was implanted into the recipient and blood flow was opened, a liver tissue sample about the size of a grain of rice was taken again before the abdomen was closed as the After LT group.

[0030] Liver tissue samples were collected before and after clinical liver transplantation, and total RNA was extracted for RT-qPCR experiments (primer sequences are shown in Table 1). Figure 1 C. Experimental results showed that the mRMA expression level of CSRNP1 in the liver of mice was significantly increased after ischemia-reperfusion of transplanted liver. Liver histological experiments were performed on some liver samples according to the following detailed steps:

[0031] 1. Paraffin embedding of liver tissue:

[0032] 1) Fixation: Fresh liver tissue was fixed in 4wt% paraformaldehyde for 12-24 hours.

[0033] 2) Dehydration: The liver tissue is removed from the fixative and placed in a dehydration box. The dehydration box is then placed in a basket and placed in a dehydrator for sequential dehydration and paraffin impregnation in a gradient of alcohols: 75 vol% alcohol for 4 hours - 85 vol% alcohol for 2 hours - 90 vol% alcohol for 2 hours - 95 vol% alcohol for 1 hour - anhydrous ethanol I for 30 minutes - anhydrous ethanol II for 30 minutes - benzene for 5-10 minutes - xylene I for 5-10 minutes - xylene II for 5-10 minutes - wax I for 1 hour - wax II for 1 hour - wax III for 1 hour.

[0034] 3) Embedding: The wax-impregnated liver tissue is embedded in an embedding machine. First, the molten wax is placed in the embedding frame, and the tissue is placed and labeled before the wax solidifies. It is then cooled on a -20℃ freezing stage. After the wax solidifies, the wax block is removed and trimmed.

[0035] 4) Sectioning: Place the trimmed wax block on a paraffin microtome and section it to a thickness of 4μm. Flatten the section in 40℃ warm water, lift it with a glass slide, and place it in a 60℃ oven to bake until the water dries and the wax melts. Then remove it and store it at room temperature for later use.

[0036] 2. Liver tissue section:

[0037] 1) Dewaxing of paraffin sections: The liver tissue sections were placed in a basket and dewaxed sequentially in a gradient of alcohols: xylene I for 10 minutes - xylene II for 10 minutes - anhydrous ethanol I for 5 minutes - anhydrous ethanol II for 5 minutes - 95 vol% ethanol for 5 minutes - 90 vol% ethanol for 5 minutes - 80 vol% ethanol for 5 minutes - 70 vol% ethanol for 5 minutes - distilled water.

[0038] 3. Liver tissue sections stained with hematoxylin and eosin (HE):

[0039] 1) Hematoxylin staining of cell nuclei: Immerse the slides in hematoxylin for 3-8 minutes, rinse with tap water, return to blue with 0.6 vol% ammonia solution, and rinse with tap water.

[0040] 2) Eosin staining of cytoplasm: Immerse the slide in eosin staining solution for 1-3 minutes.

[0041] 3) Dehydration and mounting: Place the sections in 95 vol% ethanol I for 5 minutes, 95 vol% ethanol II for 5 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, xylene I for 5 minutes, and xylene II for 5 minutes to dehydrate and clear them. Remove the sections from the xylene and let them dry slightly before mounting them with neutral resin.

[0042] Microscopic scanning of liver tissue sections stained with hematoxylin and eosin (HE), such as... Figure 1 As shown in D, after the transplanted liver undergoes ischemia-reperfusion injury, there is significant intrahepatic cell necrosis, partial capillary obstruction, and increased local immune cell infiltration.

[0043] 4. Immunochemical staining of liver tissue:

[0044] 1) Antigen retrieval: Place tissue slides in a retrieval box filled with citrate antigen retrieval buffer (pH 6.0) and microwave on medium heat for 8 minutes until boiling, then turn off the heat and keep warm for 8 minutes, then turn to medium-low heat for 7 minutes. During this process, prevent excessive evaporation of the buffer and do not dry the slides. After natural cooling, place the slides in PBS (pH 7.4) and wash three times on a decolorizing shaker for 5 minutes each time.

[0045] 2) Blocking endogenous peroxidase: Place the slide in 3 vol% hydrogen peroxide solution and incubate at room temperature in the dark for 25 min. Then place the slide in PBS (pH 7.4) and wash it three times on a decolorizing shaker for 5 min each time.

[0046] 3) Serum blocking: Add 3 vol% BSA to the histochemistry zone, evenly covering the tissue, and block at room temperature for 30 min. (Use rabbit serum for primary antibody derived from goat, and BSA for primary antibody derived from other sources.)

[0047] 4) Add primary antibody: Gently shake off the blocking solution, and add the prepared primary antibody (CSRNP1: ABclonal#A7130, 1:100; P-SAPK: ServiceBio#GB13019, 1:100) to the slide in PBS. Incubate the slide flat in a humidified chamber at 4°C overnight. (Add a small amount of water to the humidified chamber to prevent antibody evaporation.)

[0048] 5) Add secondary antibody: Place the slide in PBS (pH 7.4) and wash three times on a decolorizing shaker for 5 minutes each time. After slightly drying the sections, add the secondary antibody (HRP-labeled) of the corresponding species to the primary antibody to cover the tissue and incubate at room temperature for 50 minutes.

[0049] 6) DAB staining: Place the slide in PBS (pH 7.4) and wash it three times on a decolorizing shaker for 5 minutes each time. After slightly drying the slide, add freshly prepared DAB staining solution to the circle. Control the staining time under a microscope. A positive result is brownish-yellow. Rinse the slide with tap water to stop the staining process.

[0050] 7) Counterstaining cell nuclei: Counterstain with hematoxylin for about 3 minutes, wash with tap water, differentiate with hematoxylin differentiation solution for a few seconds, rinse with tap water, re-blue with hematoxylin blue solution, and rinse with running water.

[0051] 8) Dehydration and mounting: Place the sections in 75 vol% alcohol for 5 min, 85 vol% alcohol for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, n-butanol for 5 min, and xylene I for 5 min in sequence to dehydrate and clear them. Remove the sections from the xylene and let them dry slightly before mounting with mounting adhesive.

[0052] Microscopic scanning of immunochemically stained sections of liver tissue, such as... Figure 1 As shown in Figure D, the expression levels of CSRNP1 and P-SAPK in the transplanted liver were significantly increased after ischemia-reperfusion injury.

[0053] Example 4: CSRNP1 gene knockdown effectively reduces in vitro hepatocyte H / R damage.

[0054] Experimental groups: Sham+siNC, Sham+siCSRNP1, H / R+siNC, H / R+siCSRNP1.

[0055] Log-phase AML-12 cells were seeded into four wells of 6-well plates. After 24 hours, two groups were transfected with siCSRNP1, and two groups were transfected with the negative control siNC. After another 24 hours, the H / R+siNC and H / R+siCSRNP1 groups underwent H / R treatment, and cells were collected for subsequent experiments. The procedure is as follows: Figure 2 As shown in Figure A, the siCSRNP1 sequence is sense (SEQ ID NO.1): 5'-CGAGUGGAAUUCAAU-CAGA-3', antisense (SEQ ID NO.2): 5'-UCUGAUUGAAUUCCACUCG-3'; the siNC sequence is sense (SEQ ID NO.3): UUCUCCGAACGUGUCACGUTT, and anti-sense (SEQ ID NO.4): ACGUGACACGUUCGGAGAATT.

[0056] 1. Total RNA was extracted and reverse transcribed into cDNA for RT-qPCR to detect the mRNA level of CSRNP1 (primer sequences are shown in Table 1). Figure 2 B. Transfection with siCSRNP1 significantly reduced the intracellular CSRNP1 mRNA level;

[0057] 2. Total protein was extracted and subjected to Western blot analysis to detect the expression level of CSRNP1 protein. For example... Figure 2 C, transfection with siCSRNP1 significantly reduced the intracellular protein level of CSRNP1;

[0058] 3. Detection of apoptosis in AML-12 cells

[0059] 1) Collect the cell culture medium and wash once with PBS;

[0060] 2) Digest the cells with trypsin, stop the digestion with culture medium, and collect them together with the previous culture medium;

[0061] 3) Centrifuge at 1000×g for 5 minutes, discard the supernatant, and wash once with PBS;

[0062] 4) Resuspend the cells in 1x binding buffer, centrifuge at 1000×g for 5 minutes, and discard the supernatant;

[0063] 5) Resuspend the cells in 100 μl binding buffer, add 3 μL PI and FITC dye, and let stand at room temperature for 15-30 minutes;

[0064] 6) Add 400 μL of binding buffer to each cell tube to resuspend the cells, filter them through a 200-mesh filter into a flow cytometer, and perform analysis within 1 hour.

[0065] Cell apoptosis was detected using flow cytometry. Data were recorded and analyzed with FITC on the x-axis and PI on the y-axis. Figure 2 The results showed that knocking down CSRNP1 significantly reduced H / R-induced apoptosis.

[0066] 4. Collect cells and extract total protein for Western blot analysis to detect the expression levels of apoptosis-related proteins such as Bax and Cleaved-caspase 3. Figure 2 As shown in E, knocking down CSRNP1 significantly reduced the level of apoptosis.

[0067] 5. Collect cells to extract total protein, perform Western blot experiments, and detect the expression levels of MAPK pathway-related proteins, such as... Figure 2The results of the F experiment showed that knocking down CSRNP1 reduced the expression levels of MAPK pathway-related proteins and their phosphorylated proteins.

[0068] Example 5: CSRNP1 gene knockdown effectively alleviates HIRI in mice in vivo.

[0069] Experimental groups: Sham+AAV8-shNC, HIRI+AAV8-shNC, HIRI+AAV8-shCSRNP1.

[0070] Eighteen C57 mice, approximately 4 weeks old, were randomly divided into three groups and injected with 1.5 × 10⁻⁶ ppm via the tail vein. 11 The virus (dissolved in approximately 200 μL of PBS) was used. The Sham+AAV8-shNC and HIRI+AAV8-shNC groups received the virus containing the shNC sequence, while the HIRI+AAV8-shCSRNP1 group received the virus containing the shCSRNP1 sequence. Four weeks later, mice in the HIRI+AAV8-shNC and HIRI+AAV8-shCSRNP1 groups underwent HIRI (1.5 h ischemia, 6 h reperfusion) model construction. Blood and liver tissue samples were collected from each group for subsequent experiments. The experimental procedure is as follows: Figure 3 As shown in Figure A, the shCSRNP1 sequence (SEQ ID NO.5) is: CTGTACAAGGCTAGCGGTACCTAACTGGAGGCTTGCTGAAGGCTGTATGCTGTTCTGTAACCGGCTCAGACAGGTTTTGGCCACTGACTGACCTGTCTGACGGTTACAGAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCTCTAGAGGATCCTAACCGCGG, and the shNC insertion sequence (SEQ ID NO.6) is: TTCTCCGAACGTGTCACGT.

[0071] 1. Total RNA was extracted from mouse liver tissue and reverse transcribed into cDNA for RT-qPCR to detect the mRNA level of CSRNP1 (primer sequences are shown in Table 1). Figure 3 B. Infection with AAV8-shCSRNP1 significantly reduced the mRNA level of CSRNP1 in the liver of mice.

[0072] 2. Total RNA was extracted from mouse liver tissue and reverse transcribed into cDNA. RT-qPCR was then used to detect the mRNA levels of tissue inflammation-related genes such as IL-1β, MMP9, and TNF-α (primer sequences are shown in Table 1). Figure 3B. Infection with AAV8-shCSRNP1 significantly reduced intrahepatic inflammatory damage in mice after HIRI.

[0073] 3. Liver function tests: serum ALT and AST tests

[0074] Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were determined using a fully automated biochemical analyzer (Chemray 800, Reto, Shenzhen, China) according to the manufacturer's instructions. Results are as follows: Figure 3 As shown in Figure C, ALT and AST levels in mice were significantly elevated after ischemia-reperfusion.

[0075] 4. Total protein was extracted from mouse liver tissue and subjected to Western blot analysis to detect the expression levels of apoptosis-related proteins Bax and Bcl2, and SAPK, a protein related to the MAPK pathway, and their phosphorylation. Figure 3 D. Infection with AAV8-shCSRNP1 significantly reduced the level of intrahepatic cell apoptosis in mice after HIRI and decreased the level of phosphorylation activation of the MAPK pathway.

[0076] 5. The procedure for liver histological examination is the same as above, and the results are as follows: Figure 3 E and HE staining showed that knocking down the CSRNP1 gene in the liver significantly reduced hepatic cell necrosis and vascular obstruction in mice after HIRI. Immunochemical staining showed that after CSRNP1 gene knockdown and HIRI, the apoptosis-related protein Cleaved-caspase 3 in the liver of mice was significantly reduced, suggesting that hepatocyte apoptosis was reduced. Immunochemical staining also showed that the level of P-SAPK in the liver was significantly reduced after CSRNP1 gene knockdown, suggesting that inhibiting CSRNP1 may reduce hepatocyte apoptosis caused by ischemia-reperfusion injury by inhibiting phosphorylation of the MAPK pathway.

[0077] In summary, this invention proposes the application of CSRNP1 inhibitors in the preparation of drugs for treating hepatic ischemia-reperfusion injury. By deeply analyzing the changes in CSRNP1 expression during HIRI and its correlation with ischemia-reperfusion injury in liver transplantation, this invention elucidates the molecular mechanism by which CSRNP1 transcription increases during ischemia-reperfusion, and how knocking down CSRNP1 reduces hepatocyte damage by inhibiting the phosphorylation of SAPK, a protein related to the MAPK pathway. This provides a new therapeutic strategy for the clinical treatment of hepatic ischemia-reperfusion injury.

[0078] Finally, it should be noted that the above embodiments are only for illustrating the present invention and not for limiting the scope of protection of the present invention. Furthermore, after reading the technical content of this invention, those skilled in the art can make various modifications, alterations, or variations to the present invention, and all such equivalent forms also fall within the scope of protection claimed in this application.

Claims

1. The application of CSRNP1 inhibitors in the preparation of drugs for treating hepatic ischemia-reperfusion injury, characterized in that, The CSRNP1 inhibitor is: The sense sequence of siCSRNP1 is shown in SEQ ID NO.1, and the antisense sequence is shown in SEQ ID NO.

2. Or shCSRNP1, the sequence of which is shown in SEQ ID NO.5.