Use of a reagent for increasing RAB11A expression in preparing a drug for treating hepatitis B virus infection

Through reagents that overexpress RAB11A protein, the expression level of RAB11A protein was improved, and the problem of difficulty in reducing the surface antigen and core antigen levels of hepatitis B in HBV infection was solved, and the effect of significantly reducing the levels of HBsAg and HBcAg and inhibiting HBV replication was achieved, providing new potential targets and treatment plans for the treatment of hepatitis B.

CN117281907BActive Publication Date: 2025-06-06CHONGQING MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311416628.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-27
Publication Date
2025-06-06
Estimated Expiration
2043-10-27

AI Technical Summary

Technical Problem

There is currently no effective treatment method for RAB11A protein related to hepatitis B virus (HBV). The levels of surface antigen and core antigens caused by HBV infection are difficult to effectively reduce, and HBV replication is also difficult to inhibit.

Method used

By overexpressing the RAB11A protein reagent, the recombinant plasmid Myc-RAB11A plasmid was used to increase the expression level of RAB11A protein, reduce the production level of hepatitis B surface antigen and core antigen, and inhibit HBV DNA replication.

Benefits of technology

Overexpression of RAB11A protein significantly reduced the levels of HBsAg and HBcAg and significantly inhibited the replication of HBV, providing new potential targets and treatment options for the treatment of hepatitis B.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117281907B_ABST
    Figure CN117281907B_ABST
Patent Text Reader

Abstract

The present invention provides use of a reagent for improving RAB11A expression in preparing a drug for treating hepatitis B, belonging to the field of biomedicine. The present invention verifies through experiments that overexpression of RAB11A can significantly reduce the levels of secreted HBsAg and HBcAg, significantly inhibit HBV replication, provides a new potential target for treating hepatitis B, provides more effective treatment options for clinical treatment, and has broad application prospects and market potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and particularly relates to use of a reagent for improving RAB11A expression in preparing a medicine for treating hepatitis B virus infection. Background Art

[0002] Hepatitis B virus (HBV) infection is one of the most common chronic viral infections, which can lead to a series of serious liver diseases, such as chronic hepatitis B, cirrhosis and hepatocellular carcinoma.

[0003] RAB protein is the largest subfamily of the conservative small GTPase family in eukaryotes, and is closely related to multiple processes in the HBV life cycle. RAB11A belongs to the RAB GTPase family, regulates exocytosis and recycling processes, and can direct proteins and membranes to the cell surface. RAB11A plays a regulatory role in many important life activities such as receptor recycling, cytokinesis, protein secretion, phagocytosis, cell autophagy, and signal transduction.

[0004] However, there are no reports on the association of RAB11A protein with HBV. Summary of the invention

[0005] The object of the present invention is to provide a use of a reagent for improving RAB11A expression in preparing a medicine for treating hepatitis B virus infection.

[0006] The present invention provides use of a reagent for improving the expression level of RAB11A protein in preparing a medicine for treating hepatitis B virus infection.

[0007] Furthermore, the reagent for increasing the expression level of RAB11A protein is a reagent for overexpressing RAB11A.

[0008] Furthermore, the drug is a drug that reduces the level of hepatitis B surface antigen production.

[0009] Furthermore, the drug is a drug that inhibits the replication of hepatitis B virus DNA.

[0010] Furthermore, the reagent for overexpressing the RAB11A protein is a recombinant plasmid obtained by inserting a gene encoding the human RAB11A protein into an expression vector.

[0011] Furthermore, the recombinant plasmid is a Myc-RAB11A plasmid.

[0012] Furthermore, the reagent is a recombinant vector comprising the sequence shown in SEQ ID NO.1.

[0013] Furthermore, the drug includes a pharmaceutically acceptable carrier.

[0014] In summary, the present invention provides a use of an agent for increasing the expression of RAB11A in the preparation of a drug for treating hepatitis B. Experiments have verified that overexpression of RAB11A protein can significantly reduce the level of secreted HBsAg and intracellular HBcAg, and significantly inhibit HBV replication, which provides a new potential target for the treatment of hepatitis B and more effective treatment options for clinical treatment, and has broad application prospects and market potential.

[0015] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0016] The following is a further detailed description of the above contents of the present invention through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies implemented based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The statistical graphs show the effect of silencing RAB11A on HBV replication in HBV-transfected Huh7 cells (A and B: the effect of silencing RAB11A on the level of hepatitis B virus core antigen (HBcAg) in Huh7 cells; C: the effect of silencing RAB11A on the secretion of hepatitis B surface antigen (HBsAg) by Huh7 cells; D: the effect of silencing RAB11A on the level of HBV DNA in Huh7 cells)

[0018] Figure 2 Statistical graphs showing the effect of overexpression of RAB11A on HBV replication in HBV-transfected Huh7 cells (A and B: Effect of overexpression of RAB11A on HBcAg levels in Huh7 cells; C: Effect of overexpression of RAB11A on HBsAg secretion by Huh7 cells; D: Effect of overexpression of RAB11A on HBV DNA levels in Huh7 cells)

[0019] Figure 3 The statistical graph of the research data on the effect of silencing RAB11A on HBV replication in HBV-infected HepG2-NTCP cells (A: The effect of silencing RAB11A on the level of HBcAg in HepG2-NTCP cells; B: The effect of silencing RAB11A on the secretion of HBsAg by HepG2-NTCP cells; C: The effect of silencing RAB11A on the level of HBV DNA in HepG2-NTCP cells)

[0020] Figure 4This is a statistical graph of the research data on the effect of overexpression of RAB11A on HBV replication levels in HBV-infected HepG2-NTCP cells (A: Effect of overexpression of RAB11A on HBcAg levels in HepG2-NTCP cells; B: Effect of overexpression of RAB11A on HBsAg secretion by HepG2-NTCP cells; C: Effect of overexpression of RAB11A on HBV DNA levels in HepG2-NTCP cells) DETAILED DESCRIPTION

[0021] The raw materials and equipment used in the present invention are all known products, which are obtained by purchasing commercially available products.

[0022] ** represents p < 0.01.

[0023] The gene fragment sequence of overexpressed RAB11A SEQ ID NO.1: GCTAGCATGGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATGGAGGAGGAGGCAGCATGGGCACCAGGGATGATGAGTACGACTACCTGTTTAAGGTGGTGCTGATCGGCGACTCCGGCGTGGGCAAGTCCAACCTGCTGTCCAGGTTCACAAGGAATGAGTTTAATCTGGAGTCCAAGAGCACAATCGGCGTGGAGTTTGCCACAAGGTCCATCCAGGTGGACGGCAAGACCATCAAGGCCCAGATCTGGGATACAGCCGGCCAGGAGAGATACAGGGCCATCACAAGCGCCTACTACAGGGGCGCCGTGGGCGCTCTGCTGGTGTACGATATTGCCAAGCACCTGACATACGAGAACGTGGAGAGATGGCTGAAGGAGCTGAGGGACCACGCCGACAGCAATATCGTGATCATGCTGGTGGGCAATAAGAGCGACCTGAGACACCTGAGAGCCGTGCCTACCGACGAGGCCAGGGCCTTTGCCGAGAAGAATGGCCTGAGCTTTATCGAGACCAGCGCCCTGGATTCCACCAACGTGGAGGCCGCCTTTCAGACCATCCTGACAGAGATCTACAGGATCGTGAGCCAGAAGCAGATGAGCGACAGGAGAGAGAACGACATGAGCCCTTCCAATAATGTGGTGCCCATCCACGTGCCCCCCACCACCGAGAACAAGCCTAAGGTGCAGTGTTGCCAGAATATCTGAAAGCTT。

[0024] The gene fragment sequence of silenced RAB11A:

[0025] SEQ ID NO.2: sence, AAAUGAGUUUAAUCUGCAATT;

[0026] SEQ ID NO.3: anti-sence, UUGCAGAUUAAACUCAU UUCG。

[0027] The gene sequence of negative control siNC:

[0028] SEQ ID NO.4: scene,UUCUCCGAACGUGUCACGUTT;

[0029] SEQ ID NO.5: anti-sence,ACGUGACACGUUCGGAG AATT.

[0030] Example 1: Study on the effect of silencing RAB11A on HBV replication in HBV-transfected Huh7 cells

[0031] 1. Experimental Methods

[0032] Huh7 cells were co-transfected with 1 μg of HBV expression plasmid pHBV1.3 (containing 1.3 copies of HBV genome (Genbank accession NO.AY220698.1), donated by Researcher Chen Xinwen from Wuhan Institute of Virology, Chinese Academy of Sciences) and 40 nM siRAB11A (siRNA targeting inhibition of RAB11A gene expression, containing SEQ ID NO.2 or SEQ ID NO.3 sequence, custom synthesized by Shanghai Jima) or its negative control siNC (siRNA of non-specific target, custom synthesized by Shanghai Jima).

[0033] 2. Experimental Results

[0034] 72h after transfection, the total HBcAg expression level in the cell lysate was detected by Western blot using anti-HBc (Dako, B0586); 48h after transfection, the intracellular HBcAg expression level was detected by confocal microscopy. Figure 1 A and Figure 1 As shown in B, it can be seen that silencing RAB11A can significantly increase the level of HBcAg in cells.

[0035] The cell supernatant was collected and the HBsAg level secreted in the cell supernatant was detected using a hepatitis B virus surface antigen (HBsAg) diagnostic kit (enzyme-linked immunosorbent assay; Shanghai Kehua, SI0910113). Figure 1 As shown in C, it can be seen that silencing RAB11A can significantly promote HBsAg secretion.

[0036] Realtime qPCR (TB Premix Ex Taq TMII (Tli RNaseH Plus, TaKaRa, RR820) and Southern blot methods (DIG-High Prime DNA Labeling and Detection Starter Kit II, Roche, 11585614910) were used to detect the effect of silencing RAB11A on the level of HBV DNA encapsidated in cells. Figure 1 As shown in D, it can be seen that silencing RAB11A can significantly increase the intracellular HBV DNA level.

[0037] Experimental results showed that in the HBV-transfected cell system, silencing RAB11A promoted HBV replication and the expression of related genes in vitro.

[0038] Example 2 Study on the effect of overexpression of RAB11A on HBV replication in HBV-transfected Huh7 cells

[0039] 1. Experimental Methods

[0040] Huh7 cells were co-transfected with 1 μg of HBV expression plasmid pHBV1.3 and 1 μg of Myc-RAB11A plasmid (expressing human RAB11A gene transcript NM_004663, containing SEQ ID NO.1 sequence, purchased from General Biotechnology (Anhui)) or its empty control pcDNA3.1-Myc (purchased from General Biotechnology (Anhui)).

[0041] 2. Experimental Results

[0042] 72h after transfection, the total HBcAg expression level in the cell lysate was detected by Western blot; 48h after transfection, the intracellular HBcAg expression level was detected by confocal microscopy. Figure 2 A and Figure 2 As shown in B, it can be seen that overexpression of RAB11A can significantly reduce the intracellular HBcAg level.

[0043] The cell supernatant was collected and the HBsAg level secreted in the cell supernatant was detected using a hepatitis B virus surface antigen diagnostic kit. Figure 2 As shown in C, it can be seen that overexpression of RAB11A can significantly reduce the level of secreted HBsAg.

[0044] Realtime qPCR and Southern blot were used to detect the effect of overexpression of RAB11A on the level of HBV DNA encapsidated in cells. Figure 2 As shown in D, it can be seen that overexpression of RAB11A can significantly reduce the level of intracellular HBV DNA.

[0045] Experimental results showed that in the HBV-transfected cell system, overexpression of RAB11A inhibited HBV replication in vitro and the expression of related genes.

[0046] Example 3 Study on the effect of silencing RAB11A on HBV replication in HBV-infected HepG2-NTCP cells

[0047] 1. Experimental Methods

[0048] Two days before HBV infection, HepG2-Tet On-NTCP cells (preserved in the laboratory) treated with doxycycline (MedChemExpress, HY-N0565B) were inoculated into 12-well cell culture plates treated with type I collagen. One day before HBV infection, the cells were incubated with 700 μl of William's E complete medium (Procell, PM151221) + 4% PEG8000 + HBV virus suspension (MOI: 1000) for 24 h. 24 h after HBV infection, the cells were transfected with siRAB11A or its empty negative control siNC. 4-6 h after transfection, the old medium was replaced with 1 ml of fresh William's E complete medium. 72 h after HBV infection, the cells were washed 3 times with PBS and the old medium was replaced with 1 ml of fresh William's E complete medium.

[0049] 2. Experimental Results

[0050] On the 5th day after HBV infection, the total HBcAg expression level in the cell lysate was detected by Western blot. Figure 3 As shown in A, it can be seen that silencing RAB11A can significantly increase the intracellular HBcAg level.

[0051] The cell supernatant was collected and the HBsAg level secreted in the cell supernatant was detected using a hepatitis B virus surface antigen diagnostic kit. Figure 3 As shown in B, it can be seen that silencing RAB11A can significantly increase the level of secreted HBsAg.

[0052] The effect of silencing RAB11A on the level of HBV DNA encapsidated in cells was detected by real-time qPCR. Figure 3 As shown in C, it can be seen that silencing RAB11A can significantly upregulate the intracellular HBV DNA level.

[0053] Experimental results showed that in HBV-infected cell systems, silencing RAB11A significantly promoted HBV replication and the expression of related genes.

[0054] Example 4 Study on the effect of overexpression of RAB11A on HBV replication level in HBV-infected HepG2-NTCP cells

[0055] 1. Experimental Methods

[0056] Two days before HBV infection, HepG2-Tet On-NTCP cells treated with doxycycline were seeded in 12-well cell culture plates treated with type I collagen. One day before HBV infection, cells were incubated with 700 μl of William's E complete medium (Procell, PM151221) + 4% PEG8000 + HBV virus suspension (MOI: 1000) for 24 h. 24 h after HBV infection, the cells were transfected with Myc-RAB11A plasmid or its empty vector control pcDNA3.1-Myc. 4-6 h after transfection, the old medium was replaced with 1 ml of fresh William's E complete medium. 72 h after HBV infection, cells were washed 3 times with PBS and the old medium was replaced with 1 ml of fresh William's E complete medium.

[0057] 2. Experimental Results

[0058] On the 5th day after HBV infection, the total HBcAg expression level in the cell lysate was detected by Western blot. Figure 4 As shown in A, it can be seen that overexpression of RAB11A can significantly reduce the intracellular HBcAg level.

[0059] The cell supernatant was collected and the HBsAg level secreted in the cell supernatant was detected using a hepatitis B virus surface antigen diagnostic kit. Figure 4 As shown in B, it can be seen that overexpression of RAB11A can significantly reduce the level of secreted HBsAg.

[0060] The effect of overexpression of RAB11A on the level of HBV DNA encapsidated in cells was detected by real-time qPCR. Figure 4 As shown in C, it can be seen that overexpression of RAB11A can significantly reduce the level of intracellular HBV DNA.

[0061] Experimental results showed that in HBV-infected cell systems, overexpression of RAB11A significantly inhibited HBV replication and the expression of related genes.

[0062] In summary, the present invention provides a use of an agent for increasing the expression of RAB11A in the preparation of a drug for treating hepatitis B. Experiments have verified that overexpression of RAB11A protein can significantly reduce the level of secreted HBsAg and intracellular HBcAg, and significantly inhibit HBV replication, which provides a new potential target for the treatment of hepatitis B and more effective treatment options for clinical treatment, and has broad application prospects and market potential.

Claims

1. Use of a reagent for increasing the expression level of RAB11A protein in the preparation of a drug for treating hepatitis B virus infection; the reagent is a recombinant plasmid comprising the sequence shown in SEQ ID NO.1; the recombinant plasmid is a Myc-RAB11A plasmid.