Preparation method and kit for kidney organoid model of primary uric acid metabolism disorder

Abstract

The present invention discloses a preparation method and kit for a primary abnormal uric acid metabolism kidney organoid model. The present invention utilizes a gRNA-Cas9 plasmid containing a gRNA and a Cas9 gene as shown in SEQ ID NO.1, and a primer as shown in SEQ ID NO.2-7, and constructs a pluripotent stem cell containing SLC2A9 rs16890979 based on CRISPR / Cas9 gene homology repair technology, and differentiates it into kidney organoids, and obtains a primary abnormal uric acid metabolism kidney organoid model. The kidney organoid obtained by the method of the present invention can achieve phenotypic and functional simulation of abnormal uric acid metabolism, and can be used as a good kidney organoid model for in vitro study of the pathogenesis of uric acid metabolism renal injury and drug screening.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a method for preparing a primary uric acid metabolism abnormal kidney organoid model and a kit. Background Art

[0002] Kidneys are the organs where uric acid is most commonly deposited. Both increases and decreases in serum uric acid levels are closely related to kidney diseases. Hyperuricemia renal damage is a common complication of hyperuricemia (HUA). Serum uric acid (SUA) is a complex trait with a high degree of heritability, which is regulated by multiple alleles that increase and decrease serum uric acid. Unlike rare diseases such as hypouricemia caused by single gene mutations, hyperuricemia and gout are common diseases, most of which are complex diseases inherited from multiple genes, and their genetic susceptibility is composed of a series of susceptibility genes.

[0003] The kidney is a complex solid organ, containing at least 26 different cells, which have the functions of maintaining acid-base and electrolyte balance, excreting metabolites, and secreting toxins. It is currently believed that an important cause of hyperuricemia and hyperuricemia renal damage is the reduction of uric acid excretion, which is caused by the enhanced renal reabsorption of urate. However, due to the lack of an ideal in vitro model to support the study of hyperuricemia renal damage, most experimental studies are currently limited to animal experiments and in vitro HK-2 cell line studies. Animal experiments mainly use mice and rats as experimental subjects, and exogenous factors such as potassium oxonate are used to inhibit the activity of uricase in mice, reduce the decomposition of uric acid, and cause uric acid accumulation in the test animals, thereby causing hyperuricemia and hyperuricemia renal damage. This is not entirely similar to the pathogenesis of hyperuricemia renal damage in humans. Although HK-2 cells are human renal tubular epithelial cells, a single cell line is difficult to simulate the kidney's transport, excretion and reabsorption of uric acid in the body. Therefore, for a long time, there have been limitations in the study of the mechanism of hyperuricemia and hyperuricemia renal damage.

[0004] SLC2A9 is located on chromosome 4p15.3-p16 and contains 13 exons. The GLUT9 it encodes has two splice isoforms: GLUT9L (long form, or GLUT9a) and GLUT9S (short form, or GLUT9b). GLUT9 is expressed at the apical and basolateral sides of the collecting ducts. Its main function is to reabsorb secreted UA into renal tubular epithelial cells and transmit it to the blood. SLC2A9 has multiple independent pathogenic genetic effects, and its gene polymorphism is associated with SUA levels. rs16890979 is located in exon 8 of SLC2A9. Multiple studies have reported that rs16890979 is associated with blood uric acid levels. In some regions, such as South Korea, this SNP is believed to cause hyperuricemia; however, in studies of European populations, it is believed that this SNP causes hypouricemia. SLC2A9rs16890979 is a missense mutation located in exon 8, which causes the valine at position 253 in the conserved domain to be replaced by isoleucine (Val253lle), which may lead to changes in protein function and affect uric acid absorption. However, due to the lack of an ideal in vitro system for studying UA absorption, the effect and mechanism of this SNP on UA ​​absorption are still unclear. Therefore, there is currently controversy as to whether this SNP is a risk factor or a low-risk factor for hyperuricemia. Summary of the invention

[0005] The purpose of the present invention is to provide a method for preparing a primary uric acid metabolism abnormal kidney organoid model. The kidney organoid prepared by the method of the present invention can achieve phenotypic and functional simulation of uric acid metabolism abnormalities, and can be used as a good kidney organoid model for in vitro research on the pathogenesis of uric acid metabolism-induced renal injury and drug screening.

[0006] Another object of the present invention is to provide a kit for preparing a primary uric acid metabolism abnormality kidney organoid model.

[0007] According to one aspect of the present invention, a kit for preparing a primary uric acid metabolism abnormal kidney organoid model is provided, the components of which include:

[0008] A gRNA-Cas9 plasmid containing a gRNA targeting a mutation point of the SLC2A9 rs16890979 gene and a Cas9 gene, wherein the nucleotide sequence of the gRNA is shown in SEQ ID NO.1;

[0009] PCR primers for amplifying a repair template containing SLC2A9 rs16890979, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3;

[0010] A primer set for constructing a PCR template for amplifying a repair template containing SLC2A9 rs16890979, wherein the primer set includes a primer for amplifying an upstream homology arm and a primer for amplifying a downstream homology arm; among the primers for amplifying the upstream homology arm, the nucleotide sequence of the forward primer is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5; among the primers for amplifying the downstream homology arm, the nucleotide sequence of the forward primer is shown in SEQ ID NO.6, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.7.

[0011] In some embodiments, the gRNA-Cas9 plasmid may also contain a P2A sequence and a Puromycin gene.

[0012] In some embodiments, when used to prepare a primary uric acid metabolism disorder kidney organoid model, the molar ratio of the gRNA-Cas9 plasmid to the repair template containing SLC2A9 rs16890979 can be 1:2-5.

[0013] According to another aspect of the present invention, there is provided a method for preparing a primary uric acid metabolism abnormal kidney organoid model based on the above-mentioned kit, comprising the following steps:

[0014] (1) Construction of a PCR template for amplifying a repair template containing SLC2A9 rs16890979:

[0015] Using DNA of pluripotent stem cells as a template, PCR is performed using the nucleotide sequences shown in SEQ ID NOs. 3 to 4 and the nucleotide sequences shown in SEQ ID NOs. 5 to 6 as primers to obtain upstream homology arms and downstream homology arms, respectively;

[0016] The upstream homology arm and the downstream homology arm are connected to the vector to obtain a PCR template for amplifying a repair template containing SLC2A9rs16890979;

[0017] (2) Construction of a repair template containing SLC2A9 rs16890979:

[0018] Using the PCR template prepared in step (1) as a template and the nucleotide sequences shown in SEQ ID NOs. 2 to 3 as primers, PCR is performed to obtain a repair template containing SLC2A9 rs16890979;

[0019] (3) Construction of pluripotent stem cells containing SLC2A9 rs16890979:

[0020] The gRNA-Cas9 plasmid and the repair template containing SLC2A9 rs16890979 were co-transfected into pluripotent stem cells, and the transfected cells were screened for resistance, and then the resistance marker gene was knocked out, and monoclonal cells with SLC2A9 rs16890979 mutation were selected for expansion culture, and pluripotent stem cells with heterozygous mutation and homozygous mutation of SLC2A9 rs16890979 were obtained respectively;

[0021] The gRNA-Cas9 plasmid contains gRNA and Cas9 gene targeting the SLC2A9 rs16890979 gene mutation point, and the nucleotide sequence of the gRNA is shown in SEQ ID NO.1;

[0022] (4) Preparation of kidney organoid model of primary uric acid metabolism disorder:

[0023] The pluripotent stem cells with the SLC2A9 rs16890979 mutation prepared in step (3) are induced to differentiate into kidney organoids.

[0024] In some embodiments, in step (1), the vector is selected from at least one of pBluescript KS(-)-FRB (addgene, #104475), pBluescript KS(-)-FRBx2 (#104476), pBluescript-PB (addgene, #133885), and pBlue-TAL (addgene, #49401).

[0025] In some embodiments, in step (3), the gRNA-Cas9 plasmid is mainly prepared by connecting the gRNA to the Cas9-P2A plasmid.

[0026] In some embodiments, the Cas9-P2A plasmid can be CROPseq-Guide-EFS-SpCas9-P2A-EGFP (addgene, #99248).

[0027] In some embodiments, in step (3), the molar ratio of the gRNA-Cas9 plasmid to the repair template containing SLC2A9rs16890979 can be 1:2-5.

[0028] In some embodiments, the pluripotent stem cells may be selected from at least one of embryonic stem cells and induced pluripotent stem cells.

[0029] In some embodiments, the pluripotent stem cells are embryonic stem cells.

[0030] In some embodiments, the method of inducing embryonic stem cells with SLC2A9 rs16890979 mutation to differentiate into kidney organoids comprises the following steps:

[0031] (1) Embryonic stem cells with the SLC2A9 rs16890979 mutation were digested and resuspended in BPEL medium containing 3.0-3.5 mM Y27632, 5-10 μM CHIR99021, and 0.1-2 mM β-mercaptoethanol, and then inoculated in ultra-low concentration attachment plates for culture;

[0032] (2) On the second day of culture, half of the culture medium was replaced with BPEL medium containing 5-10 μM CHIR99021 and the cells were cultured until they formed embryoid bodies;

[0033] (3) The embryoid bodies were washed with DMEM and then resuspended in Stage II medium and cultured until they differentiated into kidney organoids.

[0034] In some embodiments, the Stage II medium is based on a medium obtained by mixing IMDM medium and Ham's F-12 nutrient mixture in a volume ratio of 1:1, and its composition also includes: 10% BSA, 3.0-3.5mM Y27632, 5-10μM CHIR99021, 0.1-2mMβ-mercaptoethanol, 0.5-2% Pencillin-Streptomycin, and 2-3μg / mL Plasmocin.

[0035] The kit and preparation method provided by the present invention utilize CRISPR / Cas9 gene homology repair technology to achieve a missense mutation of a single nucleotide in exon 8 of the SLC2A9 gene in pluripotent stem cells, thereby simulating the gene sequence of the single nucleotide polymorphism rs16890979, constructing a pluripotent stem cell line with heterozygous and homozygous mutations of the SLC2A9 gene locus rs16890979, and further inducing the differentiation of these pluripotent stem cell lines into three-dimensional miniaturized organ cultures, i.e., kidney organoids, that can simulate the structure and function of human kidneys under specific in vitro culture conditions.

[0036] The renal organoids differentiated from embryonic stem cells with SLC2A9 rs16890979 mutations have no significant phenotype difference from the renal organoids differentiated from the cell line with wild-type SLC2A9. However, under urate culture conditions, it can be observed that the uric acid absorption level of renal organoids with homozygous mutations at the SLC2A9 gene locus rs16890979 is significantly lower than that of renal organoids with wild-type SLC2A9. In addition, after culture in a uric acid environment, renal organoids with rs16890979 mutations at the SLC2A9 gene locus show an epithelial-mesenchymal degeneration (EMT) phenotype, which can simulate the main pathological manifestations of uric acid kidney damage. Thus, it can be proved that the kit and method provided by the present invention can successfully construct a renal organoid model with primary abnormal uric acid metabolism. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 A technical roadmap for inducing H9 cells to differentiate into kidney organoids.

[0038] Figure 2 hESC-SLC2A9 W / T The early and mature morphologies of cells, embryoid bodies, and kidney organs on days 0, 3, 8, and 14 after cell differentiation induction culture. Scale bar = 100 μm.

[0039] Figure 3 Immunofluorescence detection of GLUT9 in kidney organoids W / T The results of the expression of ESC / iPSC-specific proteins TRA-1-81 and OCT4.

[0040] Figure 4 H&E staining of GLUT9 in kidney organoids on day 14 of differentiation culture W / T Slice diagram of .

[0041] Figures 5-6 For hESC-SLC2A9 W / T Results of qRT-PCR analysis of differentiation marker expression on days 0, 3, 8, and 14 of cell differentiation induction culture, n=3. * P<0.05, *** P<0.001.

[0042] Figures 7-8 To observe GLUT9 in organoids using TEM W / T The slice diagram, where fp represents the primitive foot process, p represents the podocyte, te represents the tubular epithelium, bb represents the brush border structure, Figure 7 Scale scale = 2 μm; Figure 8 Scale scale = 500nm.

[0043] Fig. 9 Immunofluorescence detection of GLUT9 in kidney organoids W / T GLUT9 Val253lle and GLUT9 lle253lle Expression results of CD31, GATA3, MEIS1 / 2 / 3, UMOD and GLUT9 in the mouse model.

[0044] Fig.10 The figure shows the results of flow cytometry analysis of the expression of glomerular cell-specific protein NPHS1 and tubular cell-specific protein CDH1.

[0045] Figures 11-12 To analyze GLUT9 in kidney organoids by qRT-PCR W / T GLUT9 Val253lle and GLUT9 lle253lle The results of the expression of differentiation markers in the rats were shown in Table 1, where ns indicates no significant difference.

[0046] Fig.13 The results of UA concentration detection in kidney organoids cultured in high-concentration UA ​​medium for 1, 2, 3, and 24 hours.

[0047] Figures 14-15 The results of Masson staining of kidney organoids cultured in high-concentration UA ​​medium for 1 hour and 24 hours, n = 3. * P<0.05.

[0048] Figures 16-17 The results of Western blotting of kidney organoids cultured in high-concentration UA ​​medium for 1 hour and 24 hours, n=3. * P<0.05, ** P<0.01, *** P<0.001. DETAILED DESCRIPTION

[0049] The present invention is further described in detail below in conjunction with the embodiments. The examples are only for explanation and are not intended to limit the present invention in any way. Unless otherwise specified, the raw materials and reagents used in the examples are conventional products that can be purchased through conventional commercial channels; the experimental methods in the examples where specific conditions are not specified are usually carried out according to conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0050] Example 1: Kit for preparing a kidney organoid model of primary uric acid metabolism disorder

[0051] The components of the kit include gRNA-Cas9 plasmid and primers with nucleotide sequences as shown in SEQ ID NO.2 to 7:

[0052] SLC2A9 rs16890979-F(5'to 3'):

[0053] CGTTTCTTGGGTAAAGCAGACaTTTCCCAAGAGTAGAGGAG(SEQ ID NO.2)

[0054] SLC2A9 rs16890979-R(5'to 3'):

[0055] CTCTCCTACCTCTGTGGGAAAtGTTCTGCTTTACCCAAGACG(SEQ ID NO.3)

[0056] SLC2A9-uparm-F(5' to 3'):

[0057] ATAGCGCCGCTAAACAAGGGCTTGGACT(NotI, SEQ ID NO.4)

[0058] SLC2A9-uparm-R(5' to 3'):

[0059] CCGGAATTCAACAGCATAGAGTTTTGTGGC (EcoRI, SEQ ID NO.5)

[0060] SLC2A9-downarm-F(5' to 3'):

[0061] CCGCTCGAGAGGTAACCATGTAACTTG (XhoI, SEQ ID NO.6)

[0062] SLC2A9-downarm-R(5' to 3'):

[0063] CGGGGTACCCTTCTGACTTCCTAATATC (KpnI, SEQ ID NO.7)

[0064] Among them, the preparation method of gRNA-Cas9 plasmid includes the following steps:

[0065] (1) Based on the gene sequence of human SLC2A9 rs16890979 given in Gene Bank (Gene ID: 56606), multiple gRNAs were designed. Through comparison and screening, a specific gRNA that can effectively identify the mutation point of the SLC2A9 rs16890979 gene was finally obtained, and its nucleotide sequence is: GCCACAAACTCTATGCTGTTAGG (SEQ ID NO.1).

[0066] (2) Synthesize gRNA and connect it to the CROPseq-Guide-EFS-SpCas9-P2A-EGFP (addgene, #99248) plasmid to obtain the gRNA-Cas9 plasmid.

[0067] Example 2 Preparation of a primary uric acid metabolism abnormal kidney organoid model

[0068] In this embodiment, the pluripotent stem cells are selected from hESC-H9 cell lines, and the culture system thereof is a feeder-free culture system based on mTeSR (STEMCELL, #85850) culture medium.

[0069] The method for preparing a primary uric acid metabolism abnormal kidney organoid model using the primary uric acid metabolism abnormal kidney organoid model preparation kit of Example 1 comprises the following steps:

[0070] 1. Construction of wild-type SLC2A9 repair template (SLC2A9 WT -Template)

[0071] (1) Using DNA from H9 cells as a template and SLC2A9-uparm-F and SLC2A9-uparm-R as primers, PCR was performed using a PCR kit (Vazyme, Phanta Max Super-Fidelity DNA Polymerase, #P505-d2) to amplify the upstream homology arm (uparm) fragment (481 bp) containing the mutation point. Similarly, using DNA from H9 cells as a template and SLC2A9-downarm-F and SLC2A9-downarm-R as primers, PCR was performed to amplify the downstream homology arm (downarm) fragment (202 bp).

[0072] (2) The vector pBluescript KS(-)-FRB (addgene, #104475) was double-digested with NotI and EcoRI, and the 2900 bp band was recovered by gel recovery. At the same time, uparm was double-digested with NotI and EcoRI, and uparm and pBluescriptKS were ligated using T4 ligase. The ligation product was named uparm-pBluescriptKS.

[0073] (3) Use XhoI and KpnI to double-digest uparm-pBluescriptKS and downarm, respectively, and use T4 ligase to connect uparm-pBluescriptKS and downarm to obtain the repair template of SLC2A9 wild type, which is named SLC2A9 WT-Template.

[0074] 2. Construction of a repair template containing SLC2A9 rs16890979 (SLC2A9 MT -Template)

[0075] (1) SLC2A9 WT -Template was used as template, SLC2A9rs16890979-F and SLC2A9rs16890979-R were used as primers, and PCR was performed using a high-fidelity enzyme (PCR kit: Takara, HS (Premix), R040A);

[0076] (2) The PCR reaction product was digested with Dpnl (NEB, #R0176S) to remove the methylated plasmid, and then transformed into DH5α. A single clone was selected for sequencing. The sequencing primers were SLC2A9-uparm-F and SLC2A9-uparm-R. The clone with the correct sequencing result was selected for expansion culture and plasmid extraction, thus obtaining a repair template containing SLC2A9 rs16890979, which was named SLC2A9 MT -Template.

[0077] 3. Construction of pluripotent stem cells containing SLC2A9 rs16890979

[0078] (1) Using gRNA-Cas9 plasmid and SLC2A9 MT -Template was transfected into H9 cells in good cell condition at a molar ratio of 1:3, co-transfected into H9 cells by electrofection of LONZA-4D, screened using 0.5 μg / mL Puromycin, single clones were picked, and then the DNA of the monoclonal cells was extracted as a PCR template, and PCR was performed using SLC2A9-uparm-F and SLC2A9-uparm-R, SLC2A9-downarm-F and SLC2A9-downarm-R, SLC2A9-uparm-F and SLC2A9-downarm-R as primers, respectively, to detect the presence of uparm, downarm and Puro fragments, and to infer the success of homology repair.

[0079] (2) The loxP puro-loxP fragment of the monoclonal cell was knocked out by transfection with pDZ416 (24PP7SL loxP-Kan-loxP) plasmid (addgene, #45163), and the correctness of the sequence was verified by PCR sequencing. The site where the SNP existed was amplified by PCR, and PCR was performed using SLC2A9-uparm-F and SLC2A9-uparm-R, SLC2A9-downarm-F and SLC2A9-downarm-R, SLC2A9-uparm-F and SLC2A9-downarm-R as primers to detect the presence of uparm and downarm and the removal of the Puro fragment. The SNP site was in the uparm, and Sanger sequencing was performed. The monoclonal cell with the correct sequencing result, that is, the presence of the SLC2A9 rs16890979 mutation, was selected for expansion culture. At this time, H9 cell lines with heterozygous and homozygous mutations of rs16890979 were obtained and named hESC-SLC2A9, respectively. G / A and hESC-SLC2A9 A / A .

[0080] Similarly, SLC2A9 WT -Template was used as a repair template to generate a SLC2A9 wild-type H9 cell line, named hESC-SLC2A9 W / T .

[0081] 4. Preparation of a renal organoid model of primary uric acid metabolism abnormalities

[0082] hESC-SLC2A9 W / T , hESC-SLC2A9 G / A and hESC-SLC2A9 A / A Differentiation into kidney organoids, including the following steps:

[0083] (1) The cells were cultured until the cells were in good condition. On day 0, the cells were washed with PBS and dissociated with 1 mg / mL TrypLE (Gibco), scraped and resuspended in BPEL medium (supplemented with 3.3 mM Y27632, 8 μM CHIR99021, and 1 mM β-mercaptoethanol), and then the cell suspension was inoculated and cultured in a 6-well ultra-low concentration attachment plate (Corning, NY, United States).

[0084] The formula of BPEL medium (BPEL medium, Bovine Serum Albumin (BSA) Polyvinylalchohol Essential Lipids) (taking about 200 mL as an example) is shown in Table 1:

[0085] Table 1 BPEL medium formula

[0086]

[0087]

[0088] (2) On day 2, half of the culture medium was replaced with BPEL medium supplemented with CHIR99021 (8 μM).

[0089] (3) On day 3, cells form embryoid bodies (EBs). Subsequently, all EBs are transferred to a 50 mL test tube and washed with DMEM; the EBs are then resuspended in Stage II Medium for differentiation. During differentiation, half of the Stage II Medium is replaced every 2 days. After 14 days of culture, mature kidney organoids can be obtained.

[0090] The composition of Stage II culture medium: 1×IMDM (ThermoFisher #12440053), 1×Ham's F-12 nutrient mixture, 10% BSA, 3.3 mM Y27632, 8 μM CHIR99021, 1 mM β-mercaptoethanol, 1% penicillin / streptomycin, 2.5 μg / mL Plasmocin.

[0091] Technical roadmap for inducing H9 cells to differentiate into kidney organoids Figure 1 shown.

[0092] The early and mature morphologies of H9 cells, embryoid bodies, and kidney organs on days 0, 3, 8, and 14 when differentiation induction culture began, such as Figure 2 shown.

[0093] hESC-SLC2A9 W / T , hESC-SLC2A9 G / A and hESC-SLC2A9 A / A The differentiated kidney organoids were named GLUT9 W / T GLUT9 Val253lle and GLUT9 lle253lle .

[0094] Experimental Example 1: Validation of kidney organoid structure

[0095] The morphology of kidney organoids was observed using phase contrast microscopy (TEM), and the expressions of kidney-specific proteins CDH1 (distal tubules), MEIS1 / 2 / 3 (renal interstitium), NPHS1 (podocytes), LRP2 (proximal tubules), CD31 (endothelial cells), and GATA3 (collecting duct cells) were detected using qPCR and immunofluorescence techniques (the qPCR-related primers are shown in Table 2). The specific structures of each renal tissue in kidney organoids were further observed using H&E-stained pathological sections and electron microscopy.

[0096] Table 2 qPCR related primers

[0097]

[0098] The results are as follows Figures 3 to 12 shown.

[0099] according to Figures 3 to 8 The results show that, through the method provided by the present invention, pluripotent stem cells can be induced to differentiate into three-dimensional kidney organoids that can simulate the structure and function of human kidney.

[0100] And by Figures 9 to 12 The results showed that hESC-SLC2A9G / A and hESC-SLC2A9A / A could differentiate into renal organoids normally, and the differentiation results were not significantly different from those of hESC-SLC2A9W / T.

[0101] In summary, the present invention has successfully constructed a method system for ESC / iPSC differentiation of kidney organoids. The present invention constructed an ESC-H9 cell line with rs16890979 mutation point by gene editing, including heterozygous mutation (SLC2A9 Val253lle ) and homozygous mutations (SLC2A9 Ile253lle ), and the ESCs with rs16890979 gene mutation constructed by the present invention can normally differentiate into kidney organoids, and have no significant difference with the wild-type SLC2A9 in differentiating kidney organoids.

[0102] Experimental Example 2 Study on the absorption of uric acid (UV) by kidney organoids

[0103] Using Stage II Medium as the basal medium, weigh 16.81 mg of urate and dissolve it in 100 mL of basal medium. Shake at 37°C for about 30 minutes to dissolve all the urate, and then filter with a 0.1 μm filter membrane to obtain Stage II medium containing 1000 μmol / L UA. Use this medium to culture kidney organoids, and detect the concentration of UA in kidney organoids at 1 hour, 2 hours, 3 hours, and 24 hours of culture.

[0104] Method for detecting UA concentration in renal organoids in vivo: The renal organoids were removed from the culture medium containing UA, washed once with PBS, and the PBS was removed. The equal amount of organoids (5 organoids of the same size) was resuspended in 100 μL PBS, sonicated, and centrifuged at 12000×g and 4°C for 5 minutes. The precipitate at the bottom of the centrifuge tube was removed to obtain the supernatant for UA detection. 5 μL of the supernatant was placed in 300 μL of buffer containing 50 mM Tris (pH 7.5, Sigma Aldrich Chemical Co.) and 1 mM sodium phosphate (Wako Pure Chemical Industries, Ltd.), and the uric acid level was determined by the uricase method (Uric acid C-test Wako, Wako Pure Chemical Industries, Ltd.).

[0105] The results are as follows Fig.13 shown.

[0106] Depend on Fig.13 The results showed that when incubated in high-concentration UA ​​medium (the concentration of urate was 1000 μmol / L, which is considered as the concentration of hyperuricemia in humans) for 1 hour, GLUT9 lle253lle The concentration of UA in the body is significantly lower than that of GLUT9 W / T ;GLUT9 Val253lle The concentration of UA in the body is relatively high compared to GLUT9 WT There is a downward trend; and GLUT9 lle253lle The concentration of UA in the Val253lle , indicating that kidney organoids containing SLC2A9 rs16890979 have a weakened absorption of UA, which may manifest as hypouricemia in humans. This data also shows that SLC2A9 plays an important role in the absorption of UA in kidney organoids and that the kidney organoid model was successfully constructed.

[0107] Test Example 3 Masson staining test

[0108] The kidney organoids were cultured in Stage II medium containing 1000 μmol / L UA. After 1 hour and 24 hours of culture, the kidney organoids were harvested for Masson staining.

[0109] The results are as follows Figures 14-15 shown.

[0110] Masson staining showed that kidney organoids cultured for 24 h showed larger blue areas compared to those cultured for 1 h in high-concentration UA ​​medium ( Fig.14), that is, there is more collagen fibrillin expression, reflecting the trend of epithelial myofibroblast transdifferentiation (EMT) in kidney organoids. The proportion of blue area was quantified using ImageJ software, and the results showed that the increase in blue area of ​​kidney organs at 24h was significantly different compared with 1h ( Fig.15 ).

[0111] Experimental Example 4: Western blotting test

[0112] The kidney organoids were cultured in Stage II medium containing 1000 μmol / L UA. After 1 hour and 24 hours of culture, the kidney organoids were harvested and the total protein of the kidney organoids was extracted. The expression of EMT-related specific proteins vimentin and E-cadherin was analyzed by Western blotting.

[0113] The results are as follows Figures 16-17 shown.

[0114] Western blotting data showed that when cultured in high-concentration UA ​​medium for 24 h, the concentration of UA in the kidney organoids of each experimental group increased, while the expression of Vimentin protein gradually increased, while the expression of E-cadherin protein gradually decreased, indicating the presence of EMT, and the statistical data were significantly different.

[0115] The results of Masson staining and Western blotting tests showed that after culture in a high uric acid environment, the renal organoids showed an epithelial-mesenchymal degeneration (EMT) phenotype, which is consistent with the pathological characteristics of EMT in clinical hyperuricemia nephropathy, indicating that the renal organoids prepared by the present invention can simulate the main pathological manifestations of uric acid kidney damage, proving that the present invention has successfully constructed a renal organoid model of primary uric acid metabolism abnormalities.

[0116] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the creative concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A method for preparing a primary uric acid metabolism abnormal kidney organoid model, characterized in that: The steps include: (1) Construction of a PCR template for amplifying a repair template containing SLC2A9 rs16890979: Using embryonic stem cell DNA as a template, PCR was performed using the nucleotide sequences shown in SEQ ID NOs. 4-5 and SEQ ID NOs. 6-7 as primers to obtain upstream homology arms and downstream homology arms, respectively; The upstream homology arm and the downstream homology arm are connected to the vector to obtain a PCR template for amplifying a repair template containing SLC2A9 rs16890979; (2) Construction of a repair template containing SLC2A9 rs16890979: Using the PCR template prepared in step (1) as a template and the nucleotide sequence shown in SEQ ID NO. 2-3 as a primer, PCR is performed to obtain a repair template containing SLC2A9 rs16890979; (3) Construction of embryonic stem cells containing SLC2A9 rs16890979: The gRNA-Cas9 plasmid and the repair template containing SLC2A9 rs16890979 were co-transfected into embryonic stem cells, and the transfected cells were screened for resistance, and then the resistance marker gene was knocked out, and monoclonal cells with SLC2A9 rs16890979 mutation were selected for expansion culture, and embryonic stem cells with heterozygous and homozygous mutations of SLC2A9 rs16890979 were obtained respectively; among them, The molar ratio of the gRNA-Cas9 plasmid to the repair template containing SLC2A9 rs16890979 is 1:2-5; The gRNA-Cas9 plasmid contains gRNA targeting the SLC2A9 rs16890979 gene mutation point and Cas9 gene, and the nucleotide sequence of the gRNA is shown in SEQ ID NO.1; (4) Preparation of renal organoid model of primary uric acid metabolism abnormalities: The steps include: (i) digesting the embryonic stem cells with the SLC2A9 rs16890979 mutation obtained in step (3), resuspending them in BPEL medium containing 3.0-3.5 mM Y27632, 5-10 μM CHIR99021 and 0.1-2 mM β-mercaptoethanol, and then inoculating them in ultra-low concentration attachment plates for culture; (ii) On the second day of culture, half of the culture medium was replaced with BPEL medium containing 5-10 μM CHIR99021 and the cells were cultured until they formed embryoid bodies; (iii) The embryoid bodies were washed with DMEM and then resuspended in Stage II medium and cultured until they differentiated into kidney organoids; The Stage II culture medium is based on a culture medium obtained by mixing IMDM culture medium and Ham's F-12 nutrient mixture in a volume ratio of 1:1, and its composition also includes: 10% BSA, 3.0~3.5 mM Y27632, 5~10 μM CHIR99021, 0.1~2 mM β-mercaptoethanol, 0.5~2% Pencillin-Streptomycin and 2~3 μg / mL Plasmocin.

2. The preparation method according to claim 1, characterized in that: In step (1), the vector is selected from at least one of pBluescript KS(-)-FRB, pBluescriptKS(-)-FRBx2, pBluescript-PB, and pBlue-TAL.

3. The preparation method according to claim 1, characterized in that: In step (3), the gRNA-Cas9 plasmid is mainly prepared by connecting the gRNA to the CROPseq-Guide-EFS-SpCas9-P2A-EGFP vector.

Images