Engineered mucosal-associated invariant t (MAIT) cells and methods of making and using thereof

Engineering MAIT cells using PBMCs, HSPCs, or PSCs with specific gene modifications addresses the challenges of yield and heterogeneity, providing a scalable and effective off-the-shelf cancer therapy with enhanced antitumor efficacy.

WO2025208050A2PCT designated stage Publication Date: 2025-10-02RGT UNIV OF CALIFORNIA
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
PCT/US2025/022061
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-28
Filing Date
2025-03-28
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

Current methods for generating mucosal-associated invariant T (MAIT) cells for cancer therapy are hindered by low yields and heterogeneity, making it difficult to produce therapeutic quantities of functionally homogenous MAIT cells for allogeneic use.

Method used

Methods are developed to engineer MAIT cells using peripheral blood mononuclear cells (PBMCs), CD34+ hematopoietic stem and progenitor cells (HSPCs), or pluripotent stem cells (PSCs) to produce monoclonal MAIT cells with specific gene modifications, including transgenic MAIT TCRs and immune modulatory transgenes, using gene delivery vectors and editing tools, and culturing techniques to achieve high purity and stability.

Benefits of technology

The engineered MAIT cells demonstrate enhanced antitumor efficacy in vitro and in vivo, offering a scalable and reliable off-the-shelf therapeutic option with reduced risk of graft-versus-host disease and improved treatment availability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025022061_02102025_PF_FP_ABST
    Figure US2025022061_02102025_PF_FP_ABST
Patent Text Reader

Abstract

Embodiments of the invention include compositions and methods related to engineered human mucosal-associated invariant T (eMAIT) cells for off-the-shelf use for clinical therapy for cancer, infectious, and autoimmune diseases. In some embodiments, the eMAIT cells are produced from healthy human donor peripheral blood, cord blood, or G-CSF mobilized peripheral blood. In particular embodiments, the eMAIT cells are produced from a pluripotent stem cell line and therefore can be of unlimited supply. In some embodiments, the eMAIT cells are engineered to express chimeric antigen receptors (CARs), or / and immune regulatory molecules, or / and allorejection resistance molecules. Embodiments of the invention also include compositions of matter comprising polynucleotides encoding mucosal-associated invariant T cell receptor alpha chain polypeptides and / or mucosal-associated invariant T cell receptor beta chain polypeptides.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] ENGINEERED MUCOSAL-ASSOCIATED INVARIANT T (MAIT) CELLS AND METHODS OF MAKING AND USING THEREOF CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. Section 119(e) of co- pending and commonly-assigned U.S. Provisional Patent Application No.63 / 570,902, filed March 28, 2024, entitled “ENGINEERED MUCOSAL-ASSOCIATED INVARIANT T (MAIT) CELLS AND METHODS OF MAKING AND USING THEREOF”, the contents of which is incorporated by reference herein. TECHNICAL FIELD Embodiments of the disclosure concern at least the fields of immunology, cell biology, molecular biology, and medicine, including at least cancer medicine. BACKGROUND Cancer affects tens of millions of people worldwide and is a leading threat to public health in the United States. In 2024, over 2 million new cancer cases and over 600,000 cancer deaths are projected to occur in the United States. Despite the existing therapies, cancer patients still suffer from the ineffectiveness of these treatments, their toxicities, and the risk of relapse. Novel therapies for cancer are therefore in desperately needed. Over the past decade, immunotherapy has become the new-generation cancer medicine. In particular, cell-based cellular therapies have shown great promise. An outstanding example is the chimeric antigen receptor (CAR)-engineered adoptive T cells therapy, which targets certain blood cancers at impressive efficacy. However, most of the current protocols for treatment consist of autologous adoptive cell transfer, wherein immune cells collected from a patient are manufactured and used to treat this single patient. Such an approach is costly, manufacture labor intensive, and difficult to broadly deliver to all patients in need. Allogenic immune cellular products that can be manufactured at a large-scale and can be readily distributed to treat a higher number of patients therefore are in great demand. Despite existing therapies, cancer patients still suffer from the ineffectiveness of these treatments, their toxicities, and the risk of relapse. Novel therapies for diseases, such as cancer and autoimmune diseases, are therefore in desperate demand. The present disclosure provides solutions to a long-felt need for these therapies, but also therapies that can be delivered or distributed more widely. Mucosal-associated invariant T (MAIT) cells are a small subpopulation of T lymphocytes with the ability to bridge innate and adaptive immunity (Li et al., (2023). Mucosal-associated invariant T cells for cancer immunotherapy. Molecular therapy : the journal of the American Society of Gene Therapy, 31(3), 631–646). The majorityof MAIT cells in adult human blood exhibit V 7.2 semi-invariant TCR and respond tomicrobe-derived small metabolites, for instance riboflavin derivatives. Unlike conventional T cells, MAIT cells do not recognize the polymorphic classical major histocompatibility complex (MHC) molecules and are therefore free of GvHD risk when adoptively transferred into allogeneic host. Additionally, MAIT cells have several other unique features that make them ideal cellular carriers for developing off-the-shelf cellular therapy for cancer: 1) they have roles in cancer immunosurveillance; 2) they have the remarkable capacity to target tumors independent of tumor antigen- and major histocompatibility complex (MHC)-restrictions; 3) they can employ multiple mechanisms to attack tumor cells through direct killing and adjuvant effects. However, the development of an allogeneic off-the-shelf MAIT cellular product is greatly hindered by the sparsity of MAIT cells in humans (~1-5% T cells in human blood), making it very difficult to produce therapeutic numbers of MAIT cells from blood cells of allogeneic human donors. The current method of generating MAIT cells, for adoptive therapy involves ex vivo expansion of peripheral blood mononuclear cell (PBMC)-derived MAIT cells using 5-(2-oxopropylideneamino)-6-d-ribitylaminouracil (5-OP-RU), a synthetic MAIT cell agonist (Parrot et al., (2021). Expansion of donor- unrestricted MAIT cells with enhanced cytolytic function suitable for TCR redirection. JCI insight, 6(5), e140074. However, this method generates low yields and MAIT cells with heterogenous functionalities depending on PBMC donors. There is a need in the art for novel methods and materials that can reliably generate a functionally homogenous population of MAIT cells at large quantities is thus pivotal to developing an off-the-shelf MAIT cell therapy. The invention disclosed herein meets this need. BRIEF SUMMARY Embodiments of the invention disclosed herein address the need for new therapies, more particularly, the need for cellular therapies that are not hampered by the challenges posed for individualizing therapy using autologous cells. Embodiments of the invention include methods designed to use mucosal-associated invariant T (MAIT) cells to generate populations of selected immune cells for “off-the-shelf” uses. The ability to manufacture a therapeutic cell population or a cell population that can be used to create a therapeutic cell population “off-the-shelf” increases the availability and usefulness of new cellular therapies. In this context, embodiments of the invention include methods of using peripheral blood mononuclear cells (PBMCs), CD34+hematopoietic stem and progenitor cells (HSPCs or HSCs; both terms are alternatively used herein), for example such cells isolated from cord blood or G-CSF-mobilized peripheral blood, or pluripotent stem cells (PSCs) to produce engineered MAIT cells, denoted asPBMCMAIT,HSCMAIT, orPSCMAIT, respectively, immune cells which are useful in a wide variety of therapeutic contexts. Embodiments of the invention include engineered MAIT cells produced by the methods disclosed herein. In certain embodiments of the invention, the engineered MAIT cell comprises a gene expression profile characterized as being monoclonal MAIT TCR-positive CD3- postive; HLA-I-low / negative; HLA-II-low / negative; expression of a transgenic MAIT TCR and / or immune modulatory and / or suicide / marker transgene(s); and / or disrupted expression of endogenous immune modulatory gene(s). In certain embodiments of the invention, the transgene(s) delivered into the engineered MAIT cells can encode any of the following: immune targeting molecules (e.g., chimeric antigen receptors, CARs; T- cell receptors, TCRs; native or synthetic receptor / ligands), immune regulatory molecules (e.g., IL-2, IL-4, IL-7, IL-10, IL-12, IL-15, IL-18, IL-21, IFN-g, TNF-a, TL1A, CD27, CD28, 4-1BB, OX40, ICOS, DAP10, Bcl11b, Batf3, ThPOK, FOXP3,Runx3, dominant negative (DN) form of the TGF- receptor 2 (TGFBR2-DN)),immune allorejection resistance molecules (e.g., HLA-C, HLA-E, HLA-G, CD47), and / or suicide control and imaging marker molecules (e.g., sr39TK, iCasp9, CD20). In certain embodiments of the invention, the endogenous gene(s) disrupted in the engineered MAIT cells can encode any of the following: immune checkpoint molecules (e.g., PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, TIGIT, B7-H3 / B7-H4, BTLA, VISTA, NKG2A, A2aR, PVRIG, IDO, CD73, CD39, CD96, CD161), immune regulatorymolecules (e.g., TET2, PI3K / , DGK, DNMT3a, Suv39h1, TGFBR2, CBLB, SOCS1,SOCS2, SOCS3, CISH, FAS, REGNASE-1, PTPN2, CUL5), or / and immune allorejection molecules (e.g., HLA-I / II, B2M, CIITA). In the methods of the invention, a single transgene or multiple transgenes can be incorporated into an engineered MAIT cell product via any of a wide variety of gene delivery vectors (e.g., lentivector, retrovector, adenovector, AAV) and / or vector-free systems (e.g., CRISPR, TALEN, Zinc-Finger), while a single endogenous gene or multiple endogenous genes of an engineered MAIT cell product can be disrupted from expression via any of a wide variety of gene editing tools (e.g., CRISPR, TALEN, Zinc- Finger). In some embodiments of the invention, an All-in-One engineering (AO- Engineering) strategy can be employed when all the desired gene modifications intended for a designated engineered MAIT cell product are integrated in a master PSC line. In some embodiments of the invention, an Assembly-Line engineering (AL- Engineering) strategy can be employed when all the desired gene modifications intended for a designated engineered MAIT cell product occur stepwise on a master PSC line as well as its progeny CD34+hematopoietic stem and progenitor cells (HSPCs or HSCs; both terms are alternatively used herein). In some methods of the invention, human MAIT cells are sorted from PBMCs (e.g., via MR1 tetramer or anti-Va7.2 antibody labeling), gene-engineered and cultured in an Ex Vivo PBMC-MAIT Cell Culture to produce engineered MAIT cells (denoted asPBMCMAIT cells). In certain embodiments of the invention, the culture can be feeder- free and / or serum-free, while in other embodiments of the invention, the culture can contain feeder cells (e.g., irradiated PBMCs, artificial antigen presenting cells; aAPCs). In certain embodiments of the invention, the cell culture media can comprise a base medium supplemented with one or more factors selected to facilitate thePBMCMAIT cell gene-engineering, expansion, and sublineage commitment. In certain embodiments of the invention, the ex vivo culture can achieve high purity, eliminating the need for in-process purification steps. In certain embodiments of the invention, thePBMCMAIT intermediate cell product(s) can be cultured freshly or cryopreserved and then thawed for continued culture. In some methods of the invention, human CD34+HSCs are isolated from cord blood (CB) or G-CSF-mobilized peripheral blood (e.g., via anti-CD34 microbeads), gene-engineered and cultured in an Ex Vivo HSC-MAIT Cell Culture to produce engineered MAIT cells (denoted asHSCMAIT cells). In certain embodiments of the invention, the ex vivo culture can be divided into two stages: Stage 1 (ex vivoHSCMAIT cell differentiation), and Stage 2 (ex vivoHSCMAIT cell expansion). In certain embodiments of the invention, an additional “CD4-Induction Step” can be added between the Stage 1 and Stage 2 cultures to enable the generation of CD4+ HSCMAIT cells, and another additional “TH-Polarization Step” can be further added in Stage 2 culture to enable the generation of TH-polarized CD4+ HSCMAIT cells. In certain embodiments of the invention, all three culture Stages can be feeder-free and / or serum- free, while in other embodiments of the invention, the Stage 2 culture can contain feeder cells (e.g., artificial antigen presenting cells; aAPCs). In certain embodiments of the invention, the cell culture media can comprise a base medium supplemented with one or more factors selected to facilitate theHSCMAIT cell differentiation, expansion, and sublineage commitment. In certain embodiments of the invention, all three stages (Stages 1, 2, and 3) of ex vivo culture can achieve high purity, eliminating the need for in-process purification steps. In certain embodiments of the invention, theHSCMAIT intermediate cell product(s) can be cultured freshly or cryopreserved and then thawed for continued culture. In certain methods of the invention, human PSCs are cultured in an Ex Vivo PSC-HSC Culture to differentiate into CD34+HSCs, that are then cultured in an Ex Vivo HSC-MAIT Cell Culture to produce engineered MAIT cells (denoted asPSCMAIT cells); gene engineering can occur all at once on PSCs or step-wise also on the PSC- derived HSCs (All-in-One vs. Assembly-Line engineering strategy, denoted as AO- Engineering vs. AL-Engineering strategy). In certain embodiments of the invention, the ex vivo culture can be divided into three stages: Stage 0 (PSC master cell bank generation and maintenance), Stage 1 (ex vivoPSCHSC differentiation), Stage 2 (ex vivoPSCMAIT cell differentiation), and Stage 3 (ex vivoPSCMAIT cell expansion). In certain embodiments of the invention, an additional “CD4-Induction Step” can be added between the Stage 2 and Stage 3 cultures to enable the generation of CD4+PSCMAIT cells, and another additional “TH-Polarization Step” can be further added in Stage 3 culture to enable the generation of TH-polarized CD4+PSCMAIT cells. In certain embodiments of the invention, all three culture Stages can be feeder-free and / or serum- free, while in other embodiments of the invention, the Stage 3 culture can contain feeder cells (e.g., artificial antigen presenting cells; aAPCs). In certain embodiments of the invention, the cell culture media can comprise a base medium supplemented with one or more factors selected to facilitate thePSCMAIT cell differentiation, expansion, and sublineage commitment. In certain embodiments of the invention, all three stages (Stages 1, 2, and 3) of ex vivo culture can achieve high purity, eliminating the need for in-process purification steps. In certain embodiments of the invention, the PSC-derived HSPC and / or HSPC-derivedPSCMAIT cell intermediate cell product(s) can be cultured freshly or cryopreserved and then thawed for continued culture. In certain embodiments of the invention, an All-in-One engineered (AO-Engineered) master PSC line is cultured ex vivo to produce a designatedPSCMAIT cell product, without the need for additional gene engineering steps; in other embodiments, an Assembly-Line engineered (AL-Engineered) master PSC line is cultured ex vivo to make a designatedPSCMAIT cell product, requiring additional gene engineering step(s) on the PSC-derived HSPCs and / or otherPSCMAIT cell progenitors. In certain embodiments of the invention, an engineered MAIT cell product produced by the methods described herein can be cryopreserved. In some embodiments, the cryo-recovered cell product can be stable at room temperature for at least one hour. In some embodiments, the cryo-recovered cell product is stable at room temperature for at least 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 24, 30, or 48 hours (or any derivable range therein). In certain embodiments, a cell product contains a solution comprising dextrose, one or more electrolytes, albumin, dextran, and / or DMSO. In further embodiments, a cell product is in a solution that is sterile, nonpyogenic, and isotonic. Methods of treating patients with an engineered MAIT cell product are also provided. In certain embodiments, the patient has a cancer. In other embodiments, the patient has a viral, bacterial, fungal or parasitic infection. In some embodiments, the patient has a disease or condition involving inflammation, which, in some embodiments, excludes cancer. In specific embodiments, the patient has an autoimmune disease or condition. In some embodiments, the engineered MAIT cell product is allogeneic with respect to the patient. In additional embodiments, the patient does not exhibit signs of rejection or depletion of the engineered MAIT cells. Some therapeutic methods further include administering to the patient a stimulatory reagent that activates engineered MAIT cells, or a reagent that triggers the suicide gene kill- switch. In some embodiments of the invention, an engineered MAIT cell product produced by the methods described herein can be used as a singular treatment or in combined with immune checkpoint blockades (e.g., Pembrolizumab, Nivolumab, Cemiplimab, Atezolizumab, Lpilimumab, Relatimab). In some embodiments, an engineered MAIT cell product produced by the methods described herein can be used as a singular treatment or in combined with chemotherapy drugs (e.g., Capecitabine, Paclitaxel, Fluorouracil, Carboplatin, Chlorambucil, Methotrexate, Gemcitabine, Daunorubicin, Altretamine). Embodiments of the invention also include compositions of matter comprising a polynucleotide encoding a selected MAIT alpha or beta receptor polypeptide such as those shown in Table 1 or Table 2 below (e.g., such a polynucleotide disposed within a mammalian expression vector). For example, embodiments of the invention include compositions of matter comprising a polynucleotide encoding a mucosal-associated invariant T (MAIT) cell alpha chain polypeptide and / or beta chain polypeptide; wherein: the polynucleotide is disposed in a vector, and when the vector is transduced into a CD34+T cell, the alpha chain polypeptide and / or the beta chain polypeptide encoded by the polynucleotide can form a mucosal-associated invariant T cell receptor on the surface of the T cell transduced with the vector: and the mucosal-associated invariant cell alpha chain polypeptide and / or beta chain polypeptide comprises at least one polypeptide sequence shown in Table 1 or Table 2. The foregoing has outlined rather broadly the features and technical advantages of the present disclosure in order that the detailed description that follows may be better understood. Additional features and advantages will be described hereinafter which form the subject of the claims herein. It should be appreciated by those skilled in the art that the conception and specific embodiments disclosed may be readily utilized as a basis for modifying or designing other structures for carrying out the same purposes of the present designs. It should also be realized by those skilled in the art that such equivalent constructions do not depart from the spirit and scope as set forth in the appended claims. The novel features which are believed to be characteristic of the designs disclosed herein, both as to the organization and method of operation, together with further objects and advantages will be better understood from the following description when considered in connection with the accompanying figures. It is to be expressly understood, however, that each of the figures is provided for the purpose of illustration and description only and is not intended as a definition of the limits of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS For a more complete understanding of the present disclosure, reference is now made to the following descriptions taken in conjunction with the accompanying drawings. Figure 1. Overview of the gene-engineered MAIT (eMAIT) cell invention. (A) Schematics showing the generation of allogeneic human PBMC-derived eMAIT cell products (denoted asPBMCMAIT cell products). PBMC, healthy donor peripheral blood mononuclear cell. (B) Schematics showing the generation of allogeneic human HSC-derived eMAIT cell products (denoted asHSCMAIT cell products). HSC (or HSPC), CD34+ hematopoietic stem and progenitor cell. Human CD34+ HSCs (or HSPCs) can be isolated from healthy donor cord blood (CB) or G-CSF-mobilized peripheral blood. (C) Schematics showing the generation of allogeneic human PSC- derived eMAIT cell products (denoted asPSCMAIT cell products). PSC, pluripotent stem cell. Human PSCs can originate from commercially available or proprietary (homemade) sources. These sources encompass embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs) derived from CD34+hematopoietic stem and progenitor cells (HSPC-iPSCs or HSC-iPSCs), iPSCs derived from mature MAIT cells (MAIT- iPSCs), as well as iPSCs derived from other non-T hematopoietic or non-hematopoietic cells (non-T iPSCs). Gene engineering can occur all at once on PSCs or step-wise also on the PSC-derived HSCs (All-in-One vs. Assembly-Line engineering strategy). “All- in-One" Engineering (AO-Engineering) strategy: all gene engineering operations occur at the PSC stage to generate designated PSC master cell lines that can be banked and used to produce designated MAIT cell products via a streamlined PSC-MAIT differentiation culture without further gene engineering needs. "Assembly-Line" Engineering (AL-Engineering) strategy: genetic engineering operations can occur at the PSC stage as well as at the PSC-derived CD34+HSPC stage in a step-wise manner, allowing flexible "plug-in" of various genetic manipulations to generate an array of designated MAIT cell products. (D) Table showing the gene engineering designs. Various gene engineering tools can be used to either overexpress or disrupt selected target gene(s), that can encode molecules spanning disease targeting, immune modulation, allorejection resistance, suicide control, imaging. (Note: Figures 2-11 present data related to the generation and evaluation ofPBMCMAIT cell products.) Figure 2. Generation and characterization of allogeneic human PBMC- derived MAIT (PBMCMAIT) cells. (A) Experimental design. Human MAIT cells sorted from healthy donor PBMCs were expanded ex vivo, either with irradiated human PBMCs loaded with a MAIT cell agonist antigen 5-(2-oxopropylideneamino)-6-d- ribitylaminouracil (5-OP-RU), or with irradiated human K562-based artificial antigen presenting cells (aAPCs). Cytokines such as IL-2 (10 ng / mL), IL-7 (10 ng / mL), and IL- 15 (10 ng / mL) were supplemented in the culture to supportPBMCMAIT cell expansion. (B) Yields ofPBMCMAIT cells expanded with aAPC or PBMC+5-OP-RU (n = 7; n indicates different biological replicates). (C) FACS analysis of CD4 and CD8 co- receptors, memory markers (CD45RO, CD45RA, and CD27), and NK markers (CD161, NKG2D, and DNAM1) expression onPBMCMAIT cells before and after expansion (with either aAPC or PBMC+5-OP-RU). (D) Quantification of NKG2D expression from C (n = 4; n indicates different biological replicates). MFI, mean fluorescence intensity. Data are presented as the mean ± SEM. ****P < 0.0001 by Student’s t test (B). ns, not significant; *P < 0.05, **P < 0.01, by one-way ANOVA (D). Figure 3. In vitro antitumor efficacy of PBMC+5-OP-RU-expandedPBMCMAIT cells versus aAPC-expandedPBMCMAIT cells. (A) Experimental design. HepG2-FG: HepG2 human hepatocellular carcinoma cell line engineered to express the firefly luciferase and green fluorescence protein (FG) dual reporters. Real-time tumor viability was measured using an IncuCyte imager. In each experiment, 10,000 tumor cells were co-cultured with either 50,000 (B) or 100,000 (C)PBMCMAIT cells. Tumor cell viability was monitored over time (n = 3; n indicates different technical replicates). Data are presented as the mean ± SEM. ns, not significant, ****P < 0.0001 by two-way ANOVA (B and C). Figure 4. Generation, characterization, and in vitro antitumor functional studies of PBMC-derived CAR / IL-15-armored eMAIT cells (PBMC15CAR-MAIT cells). (A) Experimental design. Generation of PBMC-derived CAR or CAR / IL-15- engineered MAIT cells (denoted asPBMCCAR-MAIT orPBMC15CAR-MAIT cells, respectively). (B) Schematic depicting the tri-modal tumor targeting mechanisms employed byPBMC15CAR-MAIT cells. (C) FACS analysis of the indicated cells,showing surface CAR expression and intracellular cytokine (i.e., IFN- , TNF- , IL-2)and cytotoxic molecule (i.e., Perforin, Granzyme B) production.PBMCMCAR-MAIT, PBMC-derived MAIT cells armored with a mesothelin-targeting CAR (MCAR);PBMC15MCAR-MAIT, PBMC-derived MAIT cells armored with the same MCAR and a soluble IL-15; MCAR-T, PBMC-derived conventional T cells armored with the same MCAR as a benchmark control. (D-G) In vitro anti-tumor efficacy studies. (D) Experimental design. OVCAR8-FG, OVCAR8 human ovarian carcinoma line engineered to express the FG dual reporters; Capan2-FG, Capan2 human pancreatic adenocarcinoma line engineered to express the FG dual reporters. (E) FACS analysis of MR1, mesothelin, and NK stress ligands (i.e., MIC-A / B, ULBP-1, CD155, and CD112) expression on OVCAR8-FG and Capan 2-FG tumor cells. (F-G) IncyCyte measurements of tumor cell viability. (F) Capan 2-FG cells were co-cultured with either MCAR-T cells,PBMCMCAR-MAIT cells, orPBMC15MCAR-MAIT cells. Total of three rounds of Capan 2-FG tumor cells were added sequentially at various time points (0 hour, 46 hours, and 98 hours). In each experiment, 10,000 cancer cells were co-cultured with 50,000 therapeutic cells (E:T ratio = 5:1). Tumor viability was monitored over time (n = 3; n indicates different technical replicates). (G) OVCAR8-FG cells were co- cultured with either MCAR-T cells orPBMC15MCAR-MAIT cells with or without 5-OP- RU (1 M). Total of three rounds of OVCAR8-FG tumor cells were added sequentially at time points = 0 hour, 24 hours, and 96 hours. In each experiment, 10,000 cancer cells were co-cultured with either 50,000 therapeutic cells (E:T ratio = 5:1). Tumor viability was monitored over time (n = 3; n indicates different technical replicates). Data are presented as the mean ± SEM. ****P < 0.0001 by two-way ANOVA (F and G). Figure 5. In vivo antitumor efficacy study-PBMC15MCAR-MAIT cells. Donor-matched PBMC-derived MCAR-T cells were included as a benchmark control. (A) Experimental design. An orthotopic ovarian cancer (OC) patient-derived xenograft (GODL.S1) NSG mouse model was used. BLI: live animal bioluminescence imaging. GODL.S1-FG: human ovarian cancer patient-derived cell line GODL.S1 engineered to express the FG dual reporters. (B) BLI images showing the presence of tumor cells in experimental mice over time. (C and D) Quantification of B shown as the average tumor load in all experimental mice of each treatment group over time (C) or shown as the tumor load in individual experimental mice of each treatment group (D). N = 5. TBL, total body luminescence. Data are presented as the mean ± SEM. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001; < 0.0001, by one-way ANOVA (C) or by log rank (Mantel-Cox) test adjusted for multiple comparisons (D). Figure 6. In vivo antitumor efficacy study-PBMC15MCAR-MAIT cells. Donor-matched PBMC-derived MCAR-T cells were included as a benchmark control. (A) Experimental design. An orthotopic AsPC-1-FG human pancreatic cancer xenograft NSG mouse model was used. BLI: live animal bioluminescence imaging. AsPC-1-FG: human pancreatic cancer cell line AsPC-1 engineered to express the FG dual reporters. (B) BLI images showing the presence of tumor cells in experimental mice over time. (C and D) Quantification of B shown as the average tumor load in all experimental mice of each treatment group over time (C) or shown as the tumor load in individual experimental mice of each treatment group (D). n = 5. TBL, total body luminescence. Data are presented as the mean ± SEM. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001, by one-way ANOVA (C) or by log rank (Mantel-Cox) test adjusted for multiple comparisons (D). (Note: Figures 12-18 present data related to the generation and evaluation ofHSCMAIT cell products.) Figure 7. Pathway analysis reveals enhanced anti-tumor potential comparing aAPC-expanded versus 5-OP-RU-expanded PBMC-MAIT cells. Healthy donor PBMCs were enriched for MAIT cells using MR1 tetramer-labeled MACS beads, followed by expansion via either artificial antigen-presenting cells (aAPCs) or 5-OP-RU stimulation. Bulk RNA-sequencing was performed on the resulting PBMC-MAIT cells, and differentially expressed genes (p-value < 0.05) between aAPC-expanded and 5-OP-RU-expanded cells were identified. Gene ontology (GO) enrichment analysis was conducted for pathway analysis, with results visualized in a bar graph. Upregulated pathways enriched in aAPC-expanded PBMC-MAIT cells are shown in red, while those downregulated are in blue. Figure 8. Successful generation of PBMC-CAR-MAIT cells armed with various CARs. (A) Schematics of indicated lentivectors. LTR, self-inactivating long- term repeats; MNDU3c, internal promoter derived from the MND retroviral LTR U3 region; , packaging signal with the splicing donor and splicing acceptor sites; RRE, reverse-responsive element; cPPT, central polypurine tract; WPRE, woodchuck responsive element. (B) FACS analyses showing high levels of CAR expression on the engineered PBMC-derived MAIT and T cells (denoted as PBMC-CAR-MAIT cell and PBMC-CAR-T cells, respectively). CAR molecules were stained using an anti-mouse IgG F(ab’)2 antibody. Mock, no CAR engineering; PSMA-CAR, CAR targeting prostate-specific membrane antigen (PSMA); EGFRvIII-CAR, CAR targeting epidermal growth factor receptor variant III (EGFRvIII); GD2-CAR, CAR targeting GD2 disialoganglioside; GPC3-CAR, CAR targeting Glypican-3 (GPC-3). Healthy donor PBMCs were enriched for MAIT cells using MR1 tetramer-labeled MACS beads and expanded via aAPC stimulation. The resulting PBMC-MAIT cells underwent lentivirus-mediated CAR transduction, and CAR surface expression was assessed by flow cytometry. Donor-matched conventional T cells transduced with the same lentivectors served as benchmark controls. Figure 9. PBMC-MCAR15-MAIT cells exhibit superior in vivo antitumor efficacy in an OVCAR8-FG human ovarian cancer xenograft model. (A) Experimental design. Five experimental groups were included: Vehicle, experimental mice receiving no therapeutical cell treatment; PBMC-MCAR-T, experimental mice receiving PBMC-MCAR-T cell treatment; PBMC-15MCAR-T, experimental mice receiving PBMC-15MCAR-T cell treatment; PBMC-MCAR-MAIT, experimental mice receiving PBMC-MCAR-MAIT cell treatment; PBMC-15MCAR-MAIT, experimental mice receiving PBMC-15MCAR-MAIT cell treatment. (B) BLI images showing tumor loads of primary challenge in experimental mice over time. (C) Quantification of B (n = 5). (D) Survival curve (n = 5). (E) Experimental design. Two experimental groups were included: Vehicle, experimental mice receiving no therapeutical cell treatment; PBMC-15MCAR-MAIT, experimental mice receiving PBMC-15MCAR-MAIT cell treatment. (F) BLI images showing tumor loads of rechallenge in experimental mice over time. (G) Quantification of E (n = 3-5). (H) Survival curve (n = 3-5). Data are presented as the mean ± SEM. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by one-way ANOVA (C and G) or log rank (Mantel-Cox) test adjusted for multiple comparisons (D and H). Healthy donor PBMCs were enriched for MAIT cells using MR1 tetramer-labeled MACS beads and expanded via aAPC stimulation. The resulting PBMC-MAIT cells were transduced with lentivirus encoding mesothelin-targeting CAR (MCAR), denoted as PBMC- MCAR-MAIT, or mesothelin-targeting CAR / human IL-15 (MCAR15), denoted as PBMC-MCAR15-MAIT, and infused into experimental mice as outlined in (A). Donor- matched conventional T cells transduced with the same lentivectors served as controls. Figure 10. PBMC-MCAR15-MAIT cells exhibit superior in vivo antitumor efficacy in a H226-FG human lung cancer xenograft model. (A) Experimental design. Five experimental groups were included: Vehicle, experimental mice receiving no therapeutical cell treatment; PBMC-MCAR-T, experimental mice receiving PBMC- MCAR-T cell treatment; PBMC15-MCAR-T, experimental mice receiving PBMC- 15MCAR-T cell treatment; PBMC-MCAR-MAIT, experimental mice receiving PBMC-MCAR-MAIT cell treatment; PBMC-15MCAR-MAIT, experimental mice receiving PBMC-15MCAR-MAIT cell treatment. (B) BLI images showing tumor loads in experimental mice over time. (C) Quantification of B (n = 5). (D) Survival curve (n = 5). Data are presented as the mean ± SEM. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by one-way ANOVA (C) or log rank (Mantel-Cox) test adjusted for multiple comparisons (D). Healthy donor PBMCs were enriched for MAIT cells using MR1 tetramer-labeled MACS beads and expanded via aAPC stimulation. The resulting PBMC-MAIT cells were transduced with lentivirus encoding mesothelin- targeting CAR (MCAR), denoted as PBMC-MCAR-MAIT, or mesothelin-targeting CAR / human IL-15 (MCAR15), denoted as PBMC-MCAR15-MAIT, and infused into experimental mice as outlined in (A). Donor-matched conventional T cells transduced with the same lentivectors served as controls. Figure 11. PBMC-MCAR15-MAIT cell in vivo anti-tumor efficacy is further enhanced by combining with immune checkpoint blockade in an OVCAR8-FG human ovarian cancer xenograft model. (A) Experimental design. Four experimental groups were included: PBMC-15MCAR-MAIT + Isotype, experimental mice receiving PBMC-15MCAR-MAIT cell treatment and human IgG4 isotype control; PBMC-15MCAR-MAIT + anti-PD-1, experimental mice receiving PBMC-15MCAR-MAIT cell treatment and anti human PD-1 treatment; PBMC- 15MCAR-MAIT + anti-CD39 (POM-1), experimental mice receiving PBMC- 15MCAR-MAIT cell treatment and anti-CD39 treatment; PBMC-15MCAR-MAIT + anti-LAG3, experimental mice receiving PBMC-15MCAR-MAIT cell treatment and anti human LAG3 treatment; (B) BLI quantification of tumor loads in experimental mice over time (n = 5). Data are presented as the mean ± SEM. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by one-way ANOVA (B). Healthy donor PBMCs were enriched for MAIT cells using MR1 tetramer-labeled MACS beads and expanded via aAPC stimulation. The resulting PBMC-MAIT cells were transduced with lentivirus encoding mesothelin-targeting CAR / human IL-15 (MCAR15), denoted as PBMC-MCAR15-MAIT, and infused into experimental mice as outlined in (A). Note, combining with anti-LAG3 blockade exhibits the most significant synergistic effects followed by combing with anti-CD39 and anti-PD1. Figure 12. Cloning of human MAIT TCR genes. (A) FACS sorting of single human MAIT cells from healthy donor PBMCs (defined as MR1 tetramer-5-OP- RU+Va7.2+CD161+). (B) Schematic of the Lenti / MAIT vector used to deliver the transgenic MAIT TCR. A pMNDW lentiviral vector designated for HSC-based gene therapy was chosen to deliver the MAIT TCR gene. (C) Table showing the amino acid sequences of the representative cloned MAIT TCR CDR3 regions and the specific V, D, and J regions utilized by the cloned MAIT TCRs. The MAIT TCR2 gene was used in the presented proof-of-concept studies. Figure 13. Schematics of the Lentiviral vectors used in the studies. A pMNDW lentiviral vector designated for HSC-based gene therapy was chosen to deliver the MAIT TCR gene. MCAR, mesothelin (MSLN)-targeting CAR; BCAR, BCMA-targeting CAR; DLTR, self-inactivating long-term repeats; MNDU3, internal promoter derived from the MND retroviral LTR U3 region; RRE, rev-responsive element; cPPT, central polypurine tract; WPRE, woodchuck responsive element. (A) A Lenti / MAIT-eGFP vector encoding a selected MAIT TCR gene and an enhanced GFP gene. (B) Lenti / MAIT-sr39TK, lentiviral vector encoding a MAIT TCR gene and a sr39TK suicide / positron emission tomography (PET) imaging gene. (C) Lenti / MAIT- BCAR, lentiviral vector encoding a MAIT TCR gene and an anti-BCMA CAR gene. (D) Lenti / MAIT-BCAR-IL15, lentiviral vector encoding a MAIT TCR gene, an anti- BCMA CAR gene and a soluble human IL-15 gene. (E) Lenti / MAIT-MCAR-IL15, lentiviral vector encoding a MAIT TCR gene, an anti-mesothelin CAR gene, and a soluble human IL-15 gene. Figure 14. Functional characterization of the cloned MAIT TCRs. (A) Experimental design. Healthy donor PBMC-derived conventional T (Tc) cells were transduced with each of the 8 Lenti / MAIT vectors encoding each of the 8 MAIT TCR clones described in Figure 7C. (B) Experimental design. In vitro tumor killing of A375- FG by Lenti / MAIT vector transduced Tc cells (Tc-MAIT) with or without the addition of 5-OP-RU. Mock transduced Tc cells were included as a control. A375-FG: A375 human melanoma cell line engineered to express the FG dual reporters. (C) Tumor cell killing data from B at 24 h (n = 3). E:T, effector to target ratio. Data are presented as the mean SEM. ns, not significant, ****P < 0.0001, by Student’s t test. Figure 15. Generation ofHSC15CAR-MAIT cells in an ex vivo xenogeneic feeder-free culture. (A) Schematics showing the generation ofHSC15CAR-MAIT cells. HSPC (or HSC), CD34+ hematopoietic stem and progenitor cell; CAR, chimeric antigen receptor. (B) FACS monitoring of the generation ofHSC15MAIT,HSCBCAR- MAIT,HSC15BCAR-MAIT, andHSC15MCAR-MAIT cells. MAIT TCRs were stained using an anti-TCR Va7.2 monoclonal antibody. (C) Yields ofHSC15MCAR-MAIT andHSC15BCAR-MAIT cells (n = 3-5; n indicates different biological donors). Data are presented as the mean ± SEM. ns, not significant, by Student's t test. Figure 16. Characterization ofHSC15MAIT,HSCBCAR-MAIT,HSC15BCAR- MAIT, andHSC15MCAR-MAIT cells. (A) Pharmacology study.HSC15MCAR-MAIT cells were studied as the therapeutic candidate; healthy donor PBMC-derived conventional MCAR-T cells were included as a control. Representative FACS plots are presented. (B) FACS detection of the MAIT TCR and CAR onHSC15MAIT,HSCBCAR- MAIT,HSC15BCAR-MAIT, andHSC15MCAR-MAIT cells. CAR was stained using an anti-mouse IgG F(ab’)2 antibody. (C) Single cell TCR sequencing analysis ofHSC15MCAR-MAIT cells. Healthy donor peripheral blood mononuclear cell (PBMC)- derived conventional T (PBMC-Tc) cells were included as controls. Figure 17. In vitro antitumor efficacy / MOA study ofHSC15MCAR-MAIT cells. PBMC-derived T and MCAR-T cells were included as controls. (A) Experimental design of the in vitro tumor cell killing assay. (B) Schematic of the human multiple myeloma, ovarian cancer, pancreatic cancer, and colorectal cancer cell lines used for the study. (C) Tumor cell killing data at 24 h (n = 4; n indicates technical replicates). (D-F) Studying the tumor killing mechanism ofHSC15MCAR-MAIT cells mediated by NKRs (i.e., NKG2D and DNAM-1). (D) Experimental design. (E) Tumor cell killing data at 24 h (E:T ratio = 0.2:1; n = 4). (F) Schematic showing the CAR / TCR / NKR triple-targeting mechanisms utilized by theHSC15MCAR-MAIT cells to attack tumor cells. Data are presented as the mean SEM. ns, not significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, by one-way ANOVA (C and E). Figure 18. In vivo antitumor efficacy study-HSC15MCAR-MAIT cells. PBMC-derived MCAR-T cells were included as a benchmark control. (A) Experimental design. An orthotopic OVCAR3-FG human ovarian cancer xenograft NSG mouse model was used. BLI: live animal bioluminescence imaging. OVCAR3- FG: OVCAR3 human ovarian cancer cell line engineered to express the FG dual reporters. (B) BLI images showing the presence of tumor cells in experimental mice over time. (C) Quantification of B shown as the average tumor load in all experimental mice of each treatment group over time. (D) Kaplan-Meier survival curves of experimental mice over time (n = 6). Data are presented as the mean ± SEM. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001, by one-way ANOVA (C) or by log rank (Mantel-Cox) test adjusted for multiple comparisons (D). Figure 19. Generation and characterization of MAIT reprogrammed iPSC (MAIT-iPSC) lines. (A) Schematics showing the experimental design to generate MAIT-iPSC lines. MAIT cells were isolated from healthy donor peripheral blood mononuclear cells (PBMCs) via MR1-5-OP-RU tetramer staining followed by magnetic activated cell sorting (MACS). The isolated PBMC-derived MAIT (PBMC- MAIT) cells were enriched from ~5% to over 90%. The isolated PBMC-MAIT cells were then subjected to reprogramming using a CytoTune™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher Scientific, A16517). Following successful reprogramming, individual MAIT-iPSC clones were selected for further verification and characterization, including assessments of iPSC pluripotency, confirmation of MAIT TCR rearrangement, evaluation of tri-lineage differentiation potential (ectoderm, mesoderm, and endoderm), elimination of Sendai viral vectors, mycoplasma testing, and karyotyping analysis. (B) Fluorescence-activated cell sorting (FACS) plotsshowing the enrichment of PBMC-MAIT cells (gated as CD3+ V 7.2+) after MR1-5-OP-RU tetramer-mediated MACS sorting. (C) Microscopic image showing the morphology of a representative MAIT-iPSC line. Three previously established PSC lines were included as controls: H1 ESC (WiCell, WA01) is a human embryonic stem cell line, iPS21 (ALSTEM) is a human fibroblast-reprogrammed iPSC line, and T-iPSC (UCLA) is a human T cell-reprogrammed iPSC line. (D) FACS plots showing the pluripotency markers (i.e., EpCAM, SSEA-4, TRA-1-81, TRA-1-60) expressed on a representative MAIT-iPSC line. (E) DNA gel image showing the detection ofrecombined MAIT TCR (V 7.2 chain) PCR products from nine reprogrammed singleMAIT-iPSC clones. L: DNA ladder; Samples #1 and #2: PBMC-MAIT cells as positive controls; Sample #3: H1 ESC as a negative control; Samples #4-#12: MAIT-iPSC single clones. The expected PCR product size is 312 bp. Figure 20. Characterization of PSC-derived T cells (without gene engineering). (A) Schematics showing the generation of PSC-derived T cells in a scalable Feeder-free / Serum-Free Ex Vivo Culture, highlighting the characterization of the resultingPSCT cell products. Three cell products were characterized: a H1 ESC- derived conventional T cell (PSCTc) product, a T-iPSC-derived conventional T cell (PSCTc) product, and a MAIT-iPSC-derived MAIT cell (PSCMAIT) product. (B and C) The PSC-derived T cell products were stimulated with 1 μg / ml anti-CD3 / CD28 (forPSCTc) or 1 μM MAIT-activating ligand, 5-(2-oxopropylideneamino)-6-D- ribitylaminouracil (5-OP-RU; forPSCMAIT) in the presence of irradiated healthy donor PBMCs as antigen-presenting cells (APCs) for 14 days, followed by analyses of the antigen response of these PSC-derived T cell products. (B) FACS plots showing the expression of TCR (conventional TCR or MAIT TCR) and co-receptors (dominantlyCD4-CD8 +) on the indicated PSCT cell products. (C) Quantification of the antigen-stimulated expansion of the indicatedPSCT cell products (n = 3-5; n indicates biological replicates). All the testedPSCT cell products mounted significant expansion in response to TCR antigen stimulation, supporting the functionality of these PSC-derived T cells. Data are presented as the mean SEM. **P < 0.01, ****P < 0.0001, by Student’s t test. Figure 21. Generation of PSC-derived MAIT cells and their CAR / IL-15- armed derivatives (AO-Engineering strategy). (A) Schematics showing the experimental design to generate PSC-derived MAIT cells and their CAR / IL-15-armed derivatives using an “All-in-One” Engineering (AO-Engineering) strategy. A selected PSC line is engineered with a designated lentivector delivering all genes of interests (MAIT TCR gene together with / out additional CAR and IL15 genes) to establish a master engineered PSC line, followed by a streamlined 3-Stage Ex Vivo Culture to generate a designated PSC-derived MAIT cell product. A master PSC line engineered with a Lenti / MAIT vector encoding a human MAIT TCR gene can give rise to regular MAIT cells (denoted asPSCMAIT cells, a master PSC line engineered with a Lenti / MAIT-BCAR vector encoding a human MAIT TCR gene together with a BCAR gene can give rise to BCAR-armed MAIT cells (denoted asPSCBCAR-MAIT cells), while a master PSC line engineered with a Lenti / MAIT-BCAR-IL15 vector encoding a human MAIT TCR gene together with a BCAR gene and a IL-15 gene can give rise to BCAR / IL-15-armed MAIT cells (denoted asPSC15BCAR-MAIT cells). BCAR, a BCMA-targeting chimeric antigen receptor. Note the Lentivectors contain a promoter (e.g., Ubiquitin promoter) suitable for PSC gene engineering. (B) FACS monitoring ofPSCMAIT cell development over time. An H1 ESC line engineered with the Lenti / MAIT vector was used to initiate the Ex Vivo culture. (C) FACS monitoring ofPSC15BCAR- MAIT cell development over time. An H1 ESC line engineered with the Lenti / MAIT- BCAR-IL15 vector was used to initiate the Ex Vivo culture. (D) Estimated yield of the H1 ESC derivedPSCMAIT,PSCBCAR-MAIT, andPSC15BCAR-MAIT cell products based on fold expansion (n = 5; n indicates biological replicates). Data are presented as the mean SEM. Note the robust and high yield of all three cell products. Figure 22. Characterization of PSC-derived MAIT cells and their CAR / IL- 15-armed derivatives (AO-Engineering strategy).PSCMAIT andPSC15BCAR-MAIT cell products derived from H1 ESC via an AO-Engineering strategy were studied for their in vitro anti-tumor efficacy and mechanism of action (MOA). Killing of OVCAR3-FG (BCMA-), a human ovarian cancer cell line, and MM.1S-FG (BCMA+), a human multiple myeloma cell line, were studied. (A and B) In vitro killing of OVCAR3-FG and MM.1S-FG tumor cells byPSCMAIT cells. (A) Experimental design. (B) Tumor cell killing data collected at 24 hrs post co-culture with / out the addition of 5-OP-RU. Healthy donor PBMC derived T (denoted as T) cells were included as a control (n = 3). (C and D) In vitro killing of MM.1S-FG tumor cells byPSCMAIT andPSC15BCAR-MAIT cells. (C) Experimental design. (D) Tumor cell killing data collected at 24 hrs post co-culture. Healthy donor PBMC derived non-engineered T and BCAR- engineered T cells (denoted as T and BCAR-T cells, respectively) were included as controls (n = 3). (E and F) In vitro killing of OVCAR3-FG and MM.1S-FG byPSCMAIT cells with / out the addition of NKG2D / DNAM-1 blocking antibody (10 g / ml). (E) Experimental design. (F) OVCAR3-FG (E:T ratio = 0.5:1; n = 3) and MM.1S-FG (E:T ratio = 5:1; n = 3) killing data collected at 24 hrs post co-culture. Data are presented as the mean SEM. ns, not significant, *P < 0.05, ***P < 0.001, ****P < 0.0001, by one-way ANOVA (F). Figure 23. Generation of diverse PSC-derived CAR / IL-15-armed MAIT and conventional T cell products (AL-Engineering strategy). (A) Schematics showing the experimental design to generate diverse PSC-derived T cell products using various PSC sources and an “Assembly-Line” engineering (AL-Engineering) strategy, wherein the gene engineering can occur at both the PSC and CD34+ HSPC stages. Examples shown include the generation of H1 ESC derivedPSC15BCAR-MAIT cells, iPS21 derivedPSC15BCAR-MAIT cells, MAIT-iPSC derivedPSC15BCAR-MAIT cells, and T-iPSC derivedPSC15BCAR-Tc cells. Note in these examples, a single lentivector was used to deliver all transgenes at the CD34+ HSPC stage; such a lentivector can contain a promotor (e.g., MNDU3 promoter) suitable for HSPC gene engineering. PSC- derived CD34+ HSPCs were premade and cryopreserved, then thawed for lentivector transduction followed by continued culture. (B) FACS plots showing the characteristics of the indicatedPSCT cell products. (C) Estimated yield of the indicatedPSCT cell products based on fold expansion (n = 5; n indicates biological replicates). Data are presented as the mean SEM. Figure 24. Pharmacology study-PSC15BCAR-MAIT cells (AL-Engineering strategy).PSC15BCAR-MAIT cells derived from the H1 ESC using an AL-Engineering strategy (as shown in Figure 23A) were studied. Healthy donor PBMC-derived conventional T cells and MAIT cells, as well as conventional T cells engineered to express the same BCMA-targeting CAR (denoted as PBMC-T, BCAR-T, and PBMC- MAIT cells, respectively) were included as controls. Representative FACS plots are presented. Note thatPSC15BCAR-MAIT cells display a phenotype (e.g., expression of CD28 co-stimulatory molecule, mixed T / NK markers, and high levels of effector molecules like cytokines and cytotoxic molecules) similar to that of thePBMC15BCAR- MAIT cells, with heightened memory features (e.g., enhanced expression of memory markers like CD45RA and CD62L). Figure 25. In vitro antitumor efficacy and mechanism of action (MOA) study-PSC15BCAR-MAIT cells (AL-Engineering strategy).PSC15BCAR-MAIT cells derived from H1 ESC using an AL-Engineering strategy (as shown in Figure 23A) were studied. Healthy donor PBMC-derived conventional T cells with or without engineering to express the same BCMA-targeting CAR (denoted as T and BCAR-T cells, respectively) were included as controls. Tumor cell lines used in this study include: MM.1S-FG (BCMA+), a human multiple myeloma (MM) cell line engineered to express the firefly luciferase and green fluorescent protein (FG) dual-reporters;BCMA-KOMM.1S-FG (BCMA-), MM.1S-FG tumor cell line knocked-out of BCMA gene via CRISPR; and K562-FG, a human chronic myeloid leukemia (CML) cell line engineered to express the FG dual reporters. (A and B) Studying the in vitro antitumor efficacy ofPSC15BCAR-MAIT cells against the MM.1S-FG tumor cells, alongside other PSC- derived T cell products generated using the AL-Engineering strategy including iPS21 derivedPSC15BCAR-MAIT, T-iPSC derivedPSC15BCAR-Tc, and MAIT-iPSC derivedPSC15BCAR-MAIT cells (as shown in Figure 24A). (A) Experimental design. (B) Tumor cell killing data at 24 h (E:T ratio = 0.5:1; n = 4). Note that all PSC-derived BCAR- armed T cell products, despite their diverse PSC sources, exhibit potent antitumor efficacy comparable to that of the conventional BCAR-T cells. (C and D) Studying the in vitro antitumor efficacy ofPSC15BCAR-MAIT cells again the MM.1S-FG tumor cells under repeating tumor challenge. (C) Experimental design.PSC15BCAR-MAIT cells were mixed with MM.1S-FG (E:T ratio = 1:1) and re-challenged every 2 days. Tumor cell killing data were collected on the day of re-challenge. (D) Tumor cell killing data (n = 4). Note that thePSC15BCAR-MAIT cells exhibit potent and durable antitumor efficacy comparable to that of the conventional BCAR-T cells. (E and F) Studying the tumor targeting mechanism ofPSC15BCAR-MAIT cells mediated by TCR and CAR. (E) Experimental design.5-OP-RU is an agonist antigen recognized by the MAIT TCR. (F) Tumor cell killing data at 24 h (n = 3). (G and H) Studying the tumor targeting mechanism ofPSC15BCAR-MAIT cells mediated by NKRs (i.e., NKG2D and DNAM- 1). (G) Experimental design. (H) Tumor cell killing data at 24 h (E:T ratio = 5:1 forBCMA-KOMM.1S-FG and 2:1 for K562-FG; n = 4). (I) Schematic showing the CAR / TCR / NKR triple-targeting mechanisms utilized by thePSC15BCAR-MAIT cells to attack the BCMA+ tumor cells. Data are presented as the mean SEM. ns, not significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, by one-way ANOVA (A, H). Figure 26. In vivo antitumor efficacy study-PSC15BCAR-MAIT cells (AL- Engineering strategy).PSC15BCAR-MAIT cells derived from E1 HSC using an AL- Engineering strategy (as shown in Figure 23A) were studied. Healthy donor PBMC- derived conventional T cells engineered to express the same BCMA-targeting CAR (denoted as BCAR-T cells) were included as a benchmark control. (A) Experimental design. An MM.1S-FG human MM xenograft NSG mouse model was used. BLI: live animal bioluminescence imaging. (B) BLI images showing the presence of tumor cells in experimental mice over time. (C and D) Quantification of B shown as the average tumor load in all experimental mice of each treatment group over time (C) or shown as the tumor load in individual experimental mice of each treatment group (D). N = 5. TBL, total body luminescence. Data are presented as the mean SEM. ****P < 0.0001, by one-way ANOVA (C). Note thatPSC15BCAR-MAIT cells exhibit potent in vivo antitumor efficacy, comparable to that of the conventional BCAR-T cells. Figure 27. Safety & immunogenicity study-PSC15BCAR-MAIT cells (AL- Engineering strategy).PSC15BCAR-MAIT cells derived from E1 HSC using an AL- Engineering strategy (as shown in Figure 23A) were studied. Healthy donor PBMC- derived conventional T cells engineered to express the same BCMA-targeting CAR (denoted as BCAR-T cells) were included as a benchmark control. (A and B) Studying the graft-versus-host (GvH) response ofPSC15BCAR-MAIT cells using an In Vitro Mixed Lymphocyte Reaction (MLR) Assay. Irradiated PBMCs from random mismatched healthy donors were used as stimulator cells. Data from 3 representativedonors are presented. (A) Experimental design. (B) ELISA analyses of IFN-production on day 4 (n = 3). N, no addition of stimulator PBMCs. (C-E) Studying the host-versus-graft (HvG) response ofPSC15BCAR-MAIT cells using an In Vitro Mixed Lymphocyte Reaction (MLR) Assay. PBMCs from random mismatched healthy donors were used as responder cells. Data from one of three representative donors are presented.(C) Experimental design. (D) ELISA analyses of IFN- production on day 4 (n = 3).None, no addition of stimulator therapeutic cells. (E) FACS measurements of HLA-I and HLA-II expression on the indicated therapeutic cells. MFI, mean fluorescence intensity. Data are presented as the mean SEM. ns, not significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, by one-way ANOVA (B, D). Note thatPSC15BCAR-MAIT cells induced no GvH response, in sharp contrast to the control conventional BCAR-T cells, likely attributed to the monoclonal MAIT TCR expressed on thesePSC15BCAR-MAIT cells that recognizes non-polymorphic MHC-I like molecule called MR1. Also note thatPSC15BCAR-MAIT cells triggered significantly reduced HvG response, compared to that triggered by the conventional BCAR-T cells, likely attributed to their significant surface expression of HLA-I / II molecules. These “low-GvHD risk” and “low immunogenicity” features may renderPSC15BCAR-MAIT cells safety as well as resistance to allorejection by the host T cells, and therefore can be attractive for an allogeneic “off-the-shelf” application of thesePSC15BCAR-MAIT cells. Figure 28. Tumor microenvironment (TME) targeting study-PSC15BCAR- MAIT cells (AL-Engineering strategy).PSC15BCAR-MAIT cells derived from E1 HSC using an AL-Engineering strategy (as shown in Figure 23A) were studied. Primary bone marrow (BM) samples collected from multiple myeloma (MM) patients were used as tumor samples in the study. (A) Experimental design to study TME targeting by therapeutic cells. Primary BM samples collected from MM patients were co-cultured with the therapeutic cells (i.e.,PSC15BCAR-MAIT cells) for 24 hours. (B) FACS measurements of surface MR1 expression on the indicated TME component cells in the MM patient BM samples. TAM, tumor associated macrophages; MDSC, myeloid- derived suppressor cell; T, T cell; B, B cell; NK, natural killer cell. MFI, mean fluorescence intensity. (C) Killing of the indicated TME component cells byPSC15BCAR-MAIT cells at 24 hours (n = 4; n indicates different MM patient BM samples). Data are presented as the mean SEM. ns, not significant, ****P < 0.0001, by Student’s t test (C). Note thatPSC15BCAR-MAIT cells effectively and selectively depleted the immunosuppressive TAMs and MDSCs but spared other immune cells in the TME of primary MM patient BM samples, likely attributed to the high surface expression of MR1 on these TAMs and MDSCs that is recognized by the MAIT TCR. The immunosuppressive TME, largely mediated by TAMs and MDSCs, is considered a critical hurdle limiting cancer immunotherapy. The capacity of PSC-engineered CAR- MAIT cells to target and alter the immunosuppressive TME is attractive, offering these cells a unique opportunity for cancer therapy applications especially against solid tumors. Figure 29. Generation and characterization of CD4 single-positive (CD4 SP) and CD8 single-positive (CD8 SP)PSC15BCAR-MAIT cells (AL-Engineering strategy). (A) Schematics showing the experimental design to generate H1 ESC derivedPSC15BCAR-MAIT cells that are either CD4 single-positive (CD4 SP) or CD8 single-positive (CD8-SP), using an AL-Engineering strategy. Note that a “CD4 Induction” step is added between Stage 2 (Ex Vivo T Cell Differentiation) and Stage 3 (Ex Vivo T Cell Expansion) cultures to dictate the CD4 SP vs. CD8 SPPSC15BCAR- MAIT cell product. (B) FACS monitoring of the transition of week 4PSC15BCAR- MAIT cells from CD4 / CD8 double positive (DP) to CD4 SP following inducer treatment, or their retention as CD4 / CD8 DP in the absence of inducer treatment by week 5 of T cell differentiation. The week 4 cell culture was treated with CD4 inducer for 16 hours, followed by changed back to fresh media devoid of CD4 inducer and further cultured for an additional 6 days. Note, the CD4 SP lineage commitment transcription factor ThPOK was detected in CD4 SPPSC15BCAR-MAIT cells. (C) FACS plots showing the characteristics of CD4 SP and CD8 SPPSC15BCAR-MAIT final cell products. (D) Estimated yield of CD4 SP and CD8 SPPSC15BCAR-MAIT cell products based on fold expansion (n = 3; n indicates biological replicates). Figure 30. Generation and characterization of Th0 / Th1-like and Th2-like CD4 SPPSC15BCAR-MAIT cells (AL-Engineering strategy). (A) Schematics showing the experimental design to generate H1 ESC derived CD4 SPPSC15BCAR- MAIT cells that are Th0 / Th1-like or Th2-like, using an AL-Engineering strategy. Note that a “CD4 Induction” step is added between Stage 2 (Ex Vivo T Cell Differentiation) and Stage 3 (Ex Vivo T Cell Expansion) to dictate the CD4 SPPSC15BCAR-MAIT lineage commitment, and an optional “Th2 Polarization” step is added in Stage 3 to dictate the Th0 / Th1-like or Th2-like function of the final CD4 SPPSC15BCAR-MAIT cell product. Stage 3 CD4 SPPSC15BCAR-MAIT cells were stimulated with 1 μg / ml anti-CD3 / CD28 antibodies for 7 days in the presence of human IL-2 and irradiated healthy donor PBMCs as antigen presenting cells, resulting in a Th0 / Th1-like CD4 SPPSC15BCAR-MAIT final cell product. For Th2 polarization, Stage 3 CD4 SPPSC15BCAR-MAIT cells were stimulated under the same condition but with the addition of ImmunoCult Human Th2 Differentiation Supplement (StemCell Technologies)containing human IL-4 and anti-human IFN- , resulting in a Th2-like CD4 SPPSC15BCAR-MAIT final cell product. (B) FACS analyses of intracellular production of cytokines and effector molecules by the indicated cells. Various H1 ESC-derivedPSC15BCAR-MAIT cell products were analyzed, including those induced to be CD8 SP, Th0 / Th1-like CD4 SP, and Th2-like CD4 SP. Healthy donor PBMC-derived CD8 SP and CD4 SP conventional BCAR-T cells were included as controls. Note Th2-polarized CD4 SPPSC15BCAR-MAIT cells exhibit a typical Th2-like function, evidenced by theirreduced production of Th1 cytokines like IFN- while enhanced production of Th2cytokines line IL-4, in sharp contrast to the non-Th2-polarized CD4 SPPSC15BCAR-MAIT cells that exhibit a typical Th0 / Th1-like function (high production of IFN- whilelow production of IL-4). On the other hand, the CD8 SPPSC15BCAR-MAIT cells exhibit a typical cytotoxic function similar to that of the CD8 SP BCAR-T cells (highproduction of IFN- as well as cytotoxic molecules like Perforin and Granzyme B). Figure 31. iPSC-MCAR15-MAIT cells exhibit superior in vivo antitumor efficacy in a H226-FG human lung cancer xenograft model. (A) Experimental design. Three experimental groups were included: Vehicle, experimental mice receiving no therapeutical cell treatment; MCAR-T, experimental mice receiving MCAR-T cell treatment; iPSC-MCAR-MAIT, experimental mice receiving iPSC- MCAR-MAIT cell treatment. (B) BLI images showing tumor loads of primary challenge in experimental mice over time. (C) Quantification of B (n = 5). (D) Survival curve (n = 5). Data are presented as the mean ± SEM. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by one-way ANOVA (C). Human MAIT-iPSCs were differentiated into CD34+ HSPCs and transduced with a lentivector encoding both a mesothelin-targeting CAR and a human secreting IL-15 (MCAR15) using the AL engineering strategy. The resulting iPSC-MCAR-MAIT cells were then tested in a H226-FG human lung cancer xenograft model. Conventional T cells from healthy donor PBMCs, transduced with the same lentivectors, served as controls. DETAILED DESCRIPTION Unless otherwise defined, all terms of art, notations, and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings may be defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer defined protocols and / or parameters unless otherwise noted. T cells play a central role in mediating and orchestrating immune responses against cancer; therefore they are attractive therapeutic targets for treating cancer and other diseases (see, e.g., Couzin-Frankel, J. 2013. Breakthrough of the year 2013. Cancer immunotherapy. Science 342:1432-1433. Lim, W.A., and C.H. June.2017. The Principles of Engineering Immune Cells to Treat Cancer. Cell 168:724-740 ; Rosenberg, S.A., and N.P. Restifo. 2015. Adoptive cell transfer as personalized immunotherapy for human cancer. Science 348:62-68; Vivier, E., Ugolini, S., Blaise, D., Chabannon, C. & Brossay, L. Targeting natural killer cells and natural killer T cells in cancer. Nat Rev Immunol 12, 239-52 (2012); Meraviglia S., Lo Presti E., Dieli F., Stassi G. 2015. T cell-based anticancer immunotherapy: progress and possibilities. Immunotherapy 7:949-951; and Godfrey D.I., Le Nours J., Andrew D.M., Uldrich A.P., and Rossjohn J. 2018. Unconventional T cell targets for cancer immunotherapy. Immunity 48, March 20, 2018). T cells recognize antigens through their surface T cell receptor (TCR) molecules (e.g. an TCR; a TCR; an invariant NK TCR, a non- invariant NKT TCR, and / or a mucosal associated invariant TCR). Typically, TCR polypeptide molecules displayed by a T cell are encoded by a single TCR gene (comprising two genes encoding two subunits of a TCR molecules; referred to as a TCR gene in this material). The TCR gene of a T cell can be generated through a random genomic V / D / J recombination process during T cell development, and therefore is unique for each T cell. As discussed in detail below, we have discovered that gene-engineered human mucosal-associated invariant T (eMAIT) cell products can be produced from human donor peripheral blood mononuclear cells (PBMCs), or from CD34+ hematopoietic stem and progenitor cells (HSCs or HSPCs; both terms are alternatively herein), or from pluripotent stem cells (PSCs), thereby providing “off-the-shelf” eMAIT cell therapies. As is known in the art, human CD34+ HSPCs can be isolated from cord blood or G- CSF mobilized peripheral blood. Also as is known in the art, PSCs include, for example, embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). For review of current stages of PSC-based cell therapies, see, e.g., Zhou Y, Li M, Zhou K, Brown J, Tsao T, Cen X, Husman T, Baipai A, Dunn ZS, and Yang L. Engineering Induced Pluripotent Stem Cells for Cancer Immunotherapy. Cancers.2022, 14:2266. DEFINITIONS For clarity, a number of terms are defined herein. The term “exogenous TCR” refers to a TCR gene or TCR gene derivative that is transferred (i.e. by way of gene transfer / transduction / transfection techniques) into the cell or is the progeny of a cell that has received a transfer of a TCR gene or gene derivative. The exogenous TCR genes are inserted into the genome of the recipient cell. In some embodiments, the insertion is random insertion. Random insertion of the TCR gene is readily achieved by methods known in the art. In some embodiments, the TCR genes are inserted into an endogenous loci (such as an endogenous TCR gene loci). In some embodiments, the cells comprise one or more TCR genes that are inserted at a loci that is not the endogenous loci. In some embodiments, the cells further comprise heterologous sequences such as a marker or resistance gene. The term “chimeric antigen receptor” or “CAR” refers to engineered receptors, which graft an arbitrary specificity onto an immune effector cell. These receptors are used to graft the specificity of a monoclonal antibody onto a T cell; with transfer of their coding sequence facilitated by retroviral or lentiviral vectors. The receptors are called chimeric because they are composed of parts from different sources. The most common form of these molecules are fusions of single-chain variable fragments (scFv) derived from monoclonal antibodies, fused to CD3-zeta transmembrane and endodomain; CD28 or 41BB intracellular domains, or combinations thereof. Such molecules result in the transmission of a signal in response to recognition by the scFv of its target. An example of such a construct is 14g2a-Zeta, which is a fusion of a scFv derived from hybridoma 14g2a (which recognizes disialoganglioside GD2). When T cells express this molecule (as an example achieved by oncoretroviral vector transduction), they recognize and kill target cells that express GD2 (e.g. neuroblastoma cells). To target malignant B cells, investigators have redirected the specificity of T cells using a chimeric immunoreceptor specific for the B-lineage molecule, CD19. The variable portions of an immunoglobulin heavy and light chain are fused by a flexible linker to form a scFv. This scFv is preceded by a signal peptide to direct the nascent protein to the endoplasmic reticulum and subsequent surface expression (this is cleaved). A flexible spacer allows the scFv to orient in different directions to enable antigen binding. The transmembrane domain is a typical hydrophobic alpha helix usually derived from the original molecule of the signaling endodomain which protrudes into the cell and transmits the desired signal. The term “antigen” refers to any substance that causes an immune system to produce antibodies against it, or to which a T cell responds. In some embodiments, an antigen is a peptide that is 5-50 amino acids in length or is at least, at most, or exactly 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, or 300 amino acids, or any derivable range therein. The term “allogeneic to the recipient” is intended to refer to cells that are not isolated from the recipient. In some embodiments, the cells are not isolated from the patient. In some embodiments, the cells are not isolated from a genetically matched individual (such as a relative with compatible genotypes). The term “inert” refers to one that does not result in unwanted clinical toxicity. This could be either on-target or off-target toxicity. “Inertness” can be based on known or predicted clinical safety data. The term “xeno-free (XF)” or “animal component-free (ACF)” or “animal free,” when used in relation to a medium, an extracellular matrix, or a culture condition, refers to a medium, an extracellular matrix, or a culture condition which is essentially free from heterogeneous animal-derived components. For culturing human cells, any proteins of a non-human animal, such as mouse, would be xeno components. In certain aspects, the xeno-free matrix may be essentially free of any non-human animal-derived components, therefore excluding mouse feeder cells or Matrigel™. Matrigel™ is a solubilized basement membrane preparation extracted from the Engelbreth-Holm- Swarm (EHS) mouse sarcoma, a tumor rich in extracellular matrix proteins to include laminin (a major component), collagen IV, heparin sulfate proteoglycans, and entactin / nidogen. The term “defined,” when used in relation to a medium, an extracellular matrix, or a culture condition, refers to a medium, an extracellular matrix, or a culture condition in which the nature and amounts of approximately all the components are known. A “chemically defined medium” refers to a medium in which the chemical nature of approximately all the ingredients and their amounts are known. These media are also called synthetic media. Examples of chemically defined media include TeSR™. Cells are “substantially free” of certain reagents or elements, such as serum, signaling inhibitors, animal components or feeder cells, exogenous genetic elements or vector elements, as used herein, when they have less than 10% of the element(s), and are “essentially free” of certain reagents or elements when they have less than 1% of the element(s). However, even more desirable are cell populations wherein less than 0.5% or less than 0.1% of the total cell population comprise exogenous genetic elements or vector elements. A culture, matrix or medium are “essentially free” of certain reagents or elements, such as serum, signaling inhibitors, animal components or feeder cells, when the culture, matrix or medium respectively have a level of these reagents lower than a detectable level using conventional detection methods known to a person of ordinary skill in the art or these agents have not been extrinsically added to the culture, matrix or medium. The serum-free medium may be essentially free of serum. Embodiments of the invention use pluripotent stem “cell lines”. As is known in the art, a cell line is a cell culture that is derived from one cell or set of cells of the same type and in which under certain conditions the cells proliferate indefinitely in the laboratory. In this way, cell lines differ from primary cells isolated from individuals in that they are immortalized. Cell lines further differ from primary cells isolated from individuals in that they are clonal (e.g. monoclonal or polyclonal). Because the physiology of cell lines is different from the physiology of primary cells, those of skill in the art cannot predict how cell lines will act solely from studies of primary cells. In some embodiments of the invention, the pluripotent stem cell line is H1 (see, e.g., Getachew et al., Stem Cell Res. 2021 Jul;54:102401. In other embodiments of the invention, the pluripotent stem cell line is the UCLA DMD1001R; UCLA iPS-21 stem cell line. Other illustrative stem cell lines are disclosed, for example, in Sullivan et al., Regen Med. 2018 Oct;13(7):859-866. doi: 10.2217 / rme-2018-0095; Capowski et al., Development. 2019 Jan 9;146(1); Ortman et al., Curr Opin Genet Dev. 2017 Oct;46:179-185; Kattman et al., Cell Stem Cell. 2011 Feb 4;8(2):228-40; Yu et al., Genes Dev. 2008 Aug 1;22(15):1987-97; Chhabra Stem Cell Rev Rep. 2017 Dec;13(6):757-773; Stacey et al., Nucleic Acids Res. 2016 Jan 4;44; and US Patent Application Publications: 20210310020, 20190153386, 20170226482, 20140154800, 20120083032, 20080311625, 20080267874, 20060160215, 20050095703 and 20030003088. A "vector" or "construct" (sometimes referred to as gene delivery or gene transfer "vehicle") refers to a macromolecule, complex of molecules, or viral particle, comprising a polynucleotide to be delivered to a host cell, either in vitro or in vivo. The polynucleotide can be a linear or a circular molecule. A “plasmid”, a common type of a vector, is an extra-chromosomal DNA molecule separate from the chromosomal DNA which is capable of replicating independently of the chromosomal DNA. In certain cases, it is circular and double-stranded. By "expression construct" or "expression cassette" is meant a nucleic acid molecule that is capable of directing transcription. An expression construct includes, at the least, a promoter or a structure functionally equivalent to a promoter. Additional elements, such as an enhancer, and / or a transcription termination signal, may also be included. The term "exogenous," when used in relation to a protein, gene, nucleic acid, or polynucleotide in a cell or organism refers to a protein, gene, nucleic acid, or polynucleotide which has been introduced into the cell or organism by artificial means, or in relation a cell refers to a cell which was isolated and subsequently introduced to other cells or to an organism by artificial means. An exogenous nucleic acid may be from a different organism or cell, or it may be one or more additional copies of a nucleic acid which occurs naturally within the organism or cell. An exogenous cell may be from a different organism, or it may be from the same organism. By way of a non-limiting example, an exogenous nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The term "corresponds to" is used herein to mean that a polynucleotide sequence is homologous (i.e., is identical, not strictly evolutionarily related) to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is identical to a reference polypeptide sequence. In contradistinction, the term "complementary to" is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence. A "gene," "polynucleotide," "coding region," "sequence," "segment," "fragment," or "transgene" which "encodes" a particular protein, is a nucleic acid molecule which is transcribed and optionally also translated into a gene product, e.g., a polypeptide, in vitro or in vivo when placed under the control of appropriate regulatory sequences. The coding region may be present in either a cDNA, genomic DNA, or RNA form. When present in a DNA form, the nucleic acid molecule may be single-stranded (i.e., the sense strand) or double-stranded. The boundaries of a coding region are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A gene can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the gene sequence. The term "cell" is herein used in its broadest sense in the art and refers to a living body which is a structural unit of tissue of a multicellular organism, is surrounded by a membrane structure which isolates it from the outside, has the capability of self- replicating, and has genetic information and a mechanism for expressing it. Cells used herein may be naturally-occurring cells or artificially modified cells (e.g., fusion cells, genetically modified cells, etc.). As used herein, the term "stem cell" refers to a cell capable of self-replication and pluripotency or multipotency. Typically, stem cells can regenerate an injured tissue. Stem cells herein may be, but are not limited to, embryonic stem (ES) cells, induced pluripotent stem cells or tissue stem cells (also called tissue-specific stem cell, or somatic stem cell). “Embryonic stem (ES) cells” are pluripotent stem cells derived from early embryos. An ES cell was first established in 1981, which has also been applied to production of knockout mice since 1989. In 1998, a human ES cell was established, which is currently becoming available for regenerative medicine. “Induced pluripotent stem cells,” commonly abbreviated as iPS cells or iPSCs, refer to a type of pluripotent stem cell artificially prepared from a non-pluripotent cell, typically an adult somatic cell, or terminally differentiated cell, such as fibroblast, a hematopoietic cell, a myocyte, a neuron, an epidermal cell, or the like, by introducing certain factors, referred to as reprogramming factors. “Pluripotency” refers to a stem cell that has the potential to differentiate into all cells constituting one or more tissues or organs, or particularly, any of the three germ layers: endoderm (interior stomach lining, gastrointestinal tract, the lungs), mesoderm (muscle, bone, blood, urogenital), or ectoderm (epidermal tissues and nervous system). “Pluripotent stem cells” used herein refer to cells that can differentiate into cells derived from any of the three germ layers, for example, direct descendants of totipotent cells or induced pluripotent cells. By "operably linked" with reference to nucleic acid molecules is meant that two or more nucleic acid molecules (e.g., a nucleic acid molecule to be transcribed, a promoter, and an enhancer element) are connected in such a way as to permit transcription of the nucleic acid molecule. "Operably linked" with reference to peptide and / or polypeptide molecules is meant that two or more peptide and / or polypeptide molecules are connected in such a way as to yield a single polypeptide chain, i.e., a fusion polypeptide, having at least one property of each peptide and / or polypeptide component of the fusion. The fusion polypeptide is particularly chimeric, i.e., composed of heterologous molecules. As used herein, “isolated” for example, with respect to cells and / or nucleic acids means altered or removed from the natural state through human intervention. The invention disclosed herein has a number of embodiments. Embodiments of the invention include compositions of matter comprising a polynucleotide encoding a MAIT alpha or beta receptor polypeptide shown in Table 1 or Table 2 below. For example, embodiments of the invention include, compositions of matter comprising a polynucleotide encoding a mucosal-associated invariant T (MAIT) cell alpha chain polypeptide and / or beta chain polypeptide; wherein: the polynucleotide is disposed in a vector, and when the vector is transduced into a CD34+T cell, the alpha chain polypeptide and / or the beta chain polypeptide encoded by the polynucleotide can form a mucosal-associated invariant T cell receptor on the surface of the T cell transduced with the vector: and the mucosal-associated invariant cell alpha chain polypeptide and / or beta chain polypeptide comprises at least one polypeptide sequence shown in Table 1 or Table 2. Typically in these compositions, the polynucleotide is disposed in a mammalian cell such as a human leukocyte. In illustrative embodiments of the invention, the cell is a mucosal-associated invariant T cell. In certain embodiments of the invention, the vector comprises a promoter selected for its ability to resist silencing in leukocytes (e.g., a human ubiquitin promoter). In some embodiments of the invention, the cell comprises a vector encoding a polypeptide that stimulates T cells and / or a polypeptide that disrupts T cell inhibitory factors. In certain embodiments of the invention, the cell comprises a vector encoding a polypeptide comprising a further receptor, for example a chimeric antigen receptor. Embodiments of the invention include methods of making gene-engineered MAIT (“eMAIT”) cells expressing a monoclonal MAIT TCR gene as well as other optional gene modifications. For example, embodiments of the invention include methods of making eMAIT cells comprising (a) selecting pluripotent stem cells comprising a monoclonal MAIT T cell receptor (TCR) gene as an endogenous TCR gene when a T cell-reprogrammed induced PSC (T-iPSC) line is used to make the eMAIT cells, or (b) introducing into eMAIT cells a selected monoclonal MAIT TCR gene as an exogeneous TCR transgene when a non-T-iPSC PSC line is used to make the eMAIT cells. Certain embodiments of the invention include methods of making eMAIT cells by disposing the transduced pluripotent stem cells in a serum-free, feeder free PSC culture media comprising at least one of 5-(2-oxopropylideneamino)-6-D- ribitylaminouracil (5-OP-RU) and 5-(2-oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino-2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, IL-18. Embodiments of the invention include monoclonal gene- engineered MAIT (“eMAIT”) cells made by the methods disclosed herein. In certain embodiments of the invention, the eMAIT cell comprises a gene expression profile characterized as being at least one of: monoclonal TCR-positive CD3-postive; HLA-I-low / negative; HLA-II-low / negative; expression of immune modulatory and / or suicide / marker transgene(s); and / or disrupted expression of endogenous immune modulatory gene(s). In certain embodiments of the invention, the transgene(s) delivered into the eMAIT cells can encode any of the following: immune targeting molecules (e.g., chimeric antigen receptors, CARs; T-cell receptors, TCRs; native or synthetic receptor / ligands), immune regulatory molecules (e.g., IL-2, IL-4,IL-7, IL-10, IL-12, IL-15, IL-18, IL-21, IFN- , TNF- , TL1A, CD27, CD28, 4-1BB,OX40, ICOS, DAP10, Bcl11b, Batf3, ThPOK, FOXP3, Runx3, dominant negative(DN) form of the TGF- receptor 2 (TGFBR2-DN)), immune allorejection resistancemolecules (e.g., HLA-C, HLA-E, HLA-G, CD47), and / or suicide control and imaging marker molecules (e.g., sr39TK, iCasp9, CD20). In certain embodiments of the invention, the endogenous gene(s) disrupted in the eMAIT cells can encode any of the following: immune checkpoint molecules (e.g., PD-1, PD-L1, CTLA-4, LAG-3, TIM- 3, TIGIT, B7-H3 / B7-H4, BTLA, VISTA, NKG2A, A2aR, PVRIG, IDO, CD73, CD39,CD96, CD161), immune regulatory molecules (e.g., TET2, PI3K / , DGK, DNMT3a,Suv39h1, TGFBR2, CBLB, SOCS1, SOCS2, SOCS3, CISH, FAS, REGNASE-1, PTPN2, CUL5), or / and immune allorejection molecules (e.g., HLA-I / II, B2M, CIITA). In the methods of the invention, a single transgene or multiple transgenes can be incorporated into an eMAIT cell product via any of a wide variety of gene delivery vectors (e.g., lentivector, retrovector, adenovector, AAV) and / or vector-free systems (e.g., CRISPR, TALEN, Zinc-Finger), while a single endogenous gene or multiple endogenous genes of an eMAIT cell product can be disrupted from expression via any of a wide variety of gene editing tools (e.g., CRISPR, TALEN, Zinc-Finger). In some embodiments of the invention, an All-in-One engineering (AO-Engineering) strategy can be employed when all the desired gene modifications intended for a designated eMAIT cell product are integrated in a master PSC line. In some embodiments of the invention, an Assembly-Line engineering (AL-Engineering) strategy can be employed when all the desired gene modifications intended for a designated eMAIT cell product occur stepwise on a master PSC line as well as its progeny hematopoietic stem and progenitor cells (HSPCs or HSCs). PSCs refer to human pluripotent stem cells, that can be embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs). iPSCs can be reprogrammed from T cells (resulting in T-iPSCs) or from non-T cells such as CD34+ HSPCs (resulting in HSPC-iPSCs) and others (e.g., fibroblasts, NK cells, macrophages). Genetically engineered PSCs (as well as their derived HSPCs) can be used to establish master cell banks, as an unlimited supply to generate the intended “off-the-shelf” immune cell products via Ex Vivo culture. As noted above, the invention disclosed herein has a number of embodiments. One illustrative embodiment of the invention comprises a method of making monoclonal Gene-Engineered T (eMAIT) cells comprising: transducing pluripotent stem cells with at least one exogenous nucleic acid molecule encoding a MAIT T cell receptor (TCR) such that the cells transduced by the at least one exogenous nucleic acid molecule express a functional TCR encoded by the exogenous nucleic acid molecule, for example an exogenous nucleic acid molecule that encodes at least one MAIT T cell receptor selected from a mucosal associated invariant TCR alpha chain Va7.2- Ja33 / Ja20 / Ja12 and / or a restricted TCR beta chain; and differentiating the transduced cells so as to generate the monoclonal Gene-Engineered T (eMAIT) cells. See, e.g., Li et al., Mol Ther. 2023 Mar 1;31(3):631-64. In certain of these embodiments, the transduced cells are cultured in a medium selected to contain certain factors such as one comprising one or more of: vitamin B2 or a vitamin B2 precursor (e.g., 5-(2- oxopropylideneamino)-6-D-ribitylaminouracil (5-OP-RU) and 5-(2- oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino- 2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, and / or IL-18. Related embodiments of the invention include methods of using peripheral blood mononuclear cells (PBMCs), CD34+hematopoietic stem and progenitor cells (HSPCs or HSCs) isolated from cord blood or G-CSF-mobilized peripheral blood, or pluripotent stem cells (PSCs) to produce engineered MAIT cells, denoted asPBMCMAIT,HSCMAIT, orPSCMAIT, respectively, immune cells which are useful in a wide variety of therapeutic contexts. In certain embodiments of the invention, the engineered MAIT cell comprises a gene expression profile characterized as being: monoclonal MAIT TCR-positive CD3-postive; HLA-I-low / negative; HLA-II-low / negative; expression of a transgenic MAIT TCR and / or immune modulatory and / or suicide / marker transgene(s); and / or disrupted expression of endogenous immune modulatory gene(s). In certain embodiments of the invention, the transgene(s) delivered into the engineered MAIT cells can encode any of the following: immune targeting molecules (e.g., chimeric antigen receptors, CARs; T-cell receptors, TCRs; native or synthetic receptor / ligands), immune regulatory molecules (e.g., IL-2, IL-4, IL-7, IL-10, IL-12, IL-15, IL-18, IL-21, IFN-g, TNF-a, TL1A, CD27, CD28, 4-1BB, OX40, ICOS, DAP10, Bcl11b, Batf3,ThPOK, FOXP3, Runx3, dominant negative (DN) form of the TGF- receptor 2(TGFBR2-DN)), immune allorejection resistance molecules (e.g., HLA-C, HLA-E, HLA-G, CD47), and / or suicide control and imaging marker molecules (e.g., sr39TK, iCasp9, CD20). In certain embodiments of the invention, the endogenous gene(s) disrupted in the engineered MAIT cells can encode any of the following: immune checkpoint molecules (e.g., PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, TIGIT, B7-H3 / B7- H4, BTLA, VISTA, NKG2A, A2aR, PVRIG, IDO, CD73, CD39, CD96, CD161),immune regulatory molecules (e.g., TET2, PI3K / , DGK, DNMT3a, Suv39h1, TGFBR2, CBLB, SOCS1, SOCS2, SOCS3, CISH, FAS, REGNASE-1, PTPN2, CUL5), or / and immune allorejection molecules (e.g., HLA-I / II, B2M, CIITA). In the methods of the invention, a single transgene or multiple transgenes can be incorporated into an engineered MAIT cell product via any of a wide variety of gene delivery vectors (e.g., lentivector, retrovector, adenovector, AAV) and / or vector-free systems (e.g., CRISPR, TALEN, Zinc-Finger), while a single endogenous gene or multiple endogenous genes of an engineered MAIT cell product can be disrupted from expression via any of a wide variety of gene editing tools (e.g., CRISPR, TALEN, Zinc- Finger). In some embodiments of the invention, an All-in-One engineering (AO- Engineering) strategy can be employed when all the desired gene modifications intended for a designated engineered MAIT cell product are integrated in a master PSC line. In some embodiments of the invention, an Assembly-Line engineering (AL- Engineering) strategy can be employed when all the desired gene modifications intended for a designated engineered MAIT cell product occur stepwise on a master PSC line as well as its progeny CD34+hematopoietic stem and progenitor cells (HSPCs or HSCs). In some methods of the invention, human MAIT cells are sorted from PBMCs (e.g., via MR1 tetramer or anti-Va7.2 antibody labeling), gene-engineered and culture in an Ex Vivo PBMC-MAIT Cell Culture to produce engineered MAIT cells (denoted asPBMCMAIT cells). In certain embodiments of the invention, the culture can be feeder- free and / or serum-free, while in other embodiments of the invention, the culture can contain feeder cells (e.g., irradiated PBMCs, artificial antigen presenting cells; aAPCs). In certain embodiments of the invention, the cell culture media can comprise a base medium supplemented with one or more factors selected to facilitate thePBMCMAIT cell gene-engineering, expansion, and sublineage. In certain embodiments of the invention, the ex vivo culture can achieve high purity, eliminating the need for in- process purification steps. In certain embodiments of the invention, thePBMCMAIT intermediate cell product(s) can be cultured freshly or cryopreserved and then thawed for continued culture. In some methods of the invention, human CD34+HSCs isolated from cord blood (CB) or G-CSF-mobilized peripheral blood (e.g., via anti-CD34 microbeads) are gene- engineered and cultured in an Ex Vivo HSC-MAIT Cell Culture to produce engineered MAIT cells (denoted asHSCMAIT cells). In certain embodiments of the invention, the ex vivo culture can be divided into two stages: Stage 1 (ex vivoHSCMAIT cell differentiation), and Stage 2 (ex vivoHSCMAIT cell expansion). In certain embodiments of the invention, an additional “CD4-Induction Step” can be added between the Stage 1 and Stage 2 cultures to enable the generation of CD4+ HSCMAIT cells, and another additional “TH-Polarization Step” can be further added in Stage 2 culture to enable the generation of TH-polarized CD4+ HSCMAIT cells. In certain embodiments of the invention, all three culture Stages can be feeder-free and / or serum-free, while in other embodiments of the invention, the Stage 2 culture can contain feeder cells (e.g., artificial antigen presenting cells; aAPCs). In certain embodiments of the invention, the cell culture media can comprise a base medium supplemented with one or more factors selected to facilitate theHSCMAIT cell differentiation, expansion, and sublineage commitment. In certain embodiments of the invention, all three stages (Stages 1, 2, and 3) of ex vivo culture can achieve high purity, eliminating the need for in-process purification steps. In certain embodiments of the invention, theHSCMAIT intermediate cell product(s) can be cultured freshly or cryopreserved and then thawed for continued culture. In some methods of the invention, human PSCs are cultured in an Ex Vivo PSC- HSC Culture to differentiate into CD34+HSCs, that are then cultured in an Ex Vivo HSC-MAIT Cell Culture to produce engineered MAIT cells (denoted asPSCMAIT cells); gene engineering can occur all at once on PSCs or step-wise also on the PSC- derived HSCs (All-in-One vs. Assembly-Line engineering strategy, denoted as AO- Engineering vs. AL-Engineering strategy). In certain embodiments of the invention, the ex vivo culture can be divided into three stages: Stage 0 (PSC master cell bank generation and maintenance), Stage 1 (ex vivoPSCHSC differentiation), Stage 2 (ex vivoPSCMAIT cell differentiation), and Stage 3 (ex vivoPSCMAIT cell expansion). In certain embodiments of the invention, an additional “CD4-Induction Step” can be added between the Stage 2 and Stage 3 cultures to enable the generation of CD4+PSCMAIT cells, and another additional “TH-Polarization Step” can be further added in Stage 3 culture to enable the generation of TH-polarized CD4+PSCMAIT cells. In certain embodiments of the invention, all three culture Stages can be feeder-free and / or serum- free, while in other embodiments of the invention, the Stage 3 culture can contain feeder cells (e.g., artificial antigen presenting cells; aAPCs). In certain embodiments of the invention, the cell culture media can comprise a base medium supplemented with one or more factors selected to facilitate thePSCMAIT cell differentiation, expansion, and sublineage commitment. In certain embodiments of the invention, all three stages (Stages 1, 2, and 3) of ex vivo culture can achieve high purity, eliminating the need for in-process purification steps. In certain embodiments of the invention, the PSC-derived HSPC and / or HSPC-derivedPSCMAIT cell intermediate cell product(s) can be cultured freshly or cryopreserved and then thawed for continued culture. In certain embodiments of the invention, an All-in-One engineered (AO-Engineered) master PSC line is cultured ex vivo to produce a designatedPSCMAIT cell product, without the need for additional gene engineering steps; in other embodiments, an Assembly-Line engineered (AL-Engineered) master PSC line is cultured ex vivo to make a designatedPSCMAIT cell product, requiring additional gene engineering step(s) on the PSC-derived HSPCs and / or otherPSCMAIT cell progenitors. In some embodiments, an eMAIT cell product produced by the methods described herein can be cryopreserved. In some embodiments, the cryo-recovered cell product can be stable at room temperature for at least one hour. In some embodiments, the cryo-recovered cell product is stable at room temperature for at least 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 24, 30, or 48 hours (or any derivable range therein). In certain embodiments, a cell product contains a solution comprising dextrose, one or more electrolytes, albumin, dextran, and / or DMSO. In further embodiments, a cell product is in a solution that is sterile, nonpyoenic, and isotonic. Embodiments of the invention include methods of making monoclonal Gene- Engineered T (eMAIT) cells comprising (a) selecting T cell-reprogrammed induced PSC (T-iPSC) cells comprising an endogenous T cell receptor (TCR); or (b) transducing pluripotent stem cells (e.g. from a PSC cell line) with at least one exogenous nucleic acid molecule encoding a TCR such that the cells transduced by the at least one exogenous nucleic acid molecule express a functional TCR encoded by the exogenous nucleic acid molecule; and differentiating the cells of (a) or (b) so as to generate the monoclonal Gene-Engineered T (eMAIT) cells. Embodiments of the invention further include monoclonal Gene-Engineered T (eMAIT) cells made by the methods disclosed herein. In certain embodiments, the methods include disposing cells in selected media condition, for example medias comprising at least one of: 5-(2- oxopropylideneamino)-6-D-ribitylaminouracil (5-OP-RU) and 5-(2- oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino- 2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, and IL-18. As noted above, in certain embodiment of the invention, pluripotent stem cells are gene-engineered via an All-in-One engineering (AO-Engineering) strategy where all gene modifications are integrated in a master PSC line. In alternative embodiments, pluripotent stem cells are gene-engineered via an Assembly-Line engineering (AL- Engineering) strategy when the desired gene modifications occur stepwise on the master PSC line as well as its progeny hematopoietic stem and progenitor cells. In some embodiments of the invention, the PSC comprises a T cell-reprogrammed induced PSC (T-iPSC) and the TCR comprises an endogenous TCR. In some embodiments of the invention, the genetic modifications are made prior to disposing PSC cells in a differentiation media. In certain embodiments of the invention, the genetic modifications are made after disposing PSC cells in a differentiation media. Assembly line embodiments of the invention include methods of making Gene- Engineered T (eMAIT) cells by: (a) disposing the pluripotent stem cells in a serum- free, feeder free PSC culture media comprising at least one of 5-(2- oxopropylideneamino)-6-D-ribitylaminouracil (5-OP-RU) and 5-(2- oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino-2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, IL-18, bFGF, TGF ,FLT3L, Noggin, activin and Bio for at least 3, 6 or 12 hours; (b) combining the pluripotent stem cells from (a) with the at least one exogenous nucleic acid molecule disposed in an expression vector, culturing the PSC cells for at least 3, 6 or 12 hours, and identifying pluripotent stem cells transduced with the expression vector; (c) disposing pluripotent stem cells transduced with the expression vector from (b) that are dissociated to single cells into a serum-free, feeder free HSC differentiation culture media A comprising at least one of: 5-(2-oxopropylideneamino)-6-D- ribitylaminouracil (5-OP-RU) and 5-(2-oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino-2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, IL-18, glutamax, ascorbic acid, monothioglycerol, Insulin- Transferrin-Selenium, Activin A, BMP-4, bFGF, VEGF, SB431542, CHIR99021, and a ROCK inhibitor for at least 3, 6 or 12 hours such that the cells form embryonic bodies; (d) disposing the embryonic bodies of (c) in a serum-free, feeder free cell PSC differentiation culture media B comprising at least one of 5-(2-oxopropylideneamino)- 6-D-ribitylaminouracil (5-OP-RU) and 5-(2-oxoethylideneamino)-6-D- ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino-2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, IL-18, BMP-4, FGF, SCF, TPO, FLT3L, IL-6, IL- 11, IGF-1, SB203580, and EPO for at least 2, 4 or 6 days so as to form CD34+ hematopoietic stem cells; (e) collecting and / or enriching CD34+hematopoietic stem cells obtained from (d); (f) disposing the CD34+hematopoietic stem cells obtained from (e) in a serum-free, feeder free eMAIT expansion cell culture media comprising at least one of 5-(2-oxopropylideneamino)-6-D-ribitylaminouracil (5-OP-RU) and 5-(2- oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino- 2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, IL-18, serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, SCF, TPO, IL-3, IL-6, Flt3 ligand, human LDL, and UM171 for at least 1, 2 or 3 days; and (g) disposing the CD34+hematopoietic stem cells obtained from (f) in a serum-free, feeder free cell eMAIT maturation culture media comprising at least one of 5-(2- oxopropylideneamino)-6-D-ribitylaminouracil (5-OP-RU) and 5-(2- oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino- 2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, IL-18, serum albumin, recombinant human insulin, human transferrin, 2-mercaptoethanol, SCF, TPO, IL-3, IL-6, IL-7, IL-15, Flt3 ligand, and ascorbic acid; such that the monoclonal Gene- Engineered T (eMAIT) cells are made. Some embodiments of the invention further comprise disposing the monoclonal Gene-Engineered T (eMAIT) cells into a target cell expansion media comprising at least one of a TCR cognate antigen or a non-specific TCR stimulatory reagent. Optionally, the target cell expansion media comprises feeder cells (e.g. a media comprising at least one of 5-(2-oxopropylideneamino)-6-D- ribitylaminouracil (5-OP-RU) and 5-(2-oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino-2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, IL-18, IL-2, IL-7 and IL-15). In some embodiments of this methodology, the methods further comprise cryopreserving cells used in the methodology, for example the CD34+ hematopoietic stem cells made in step (d). In certain embodiments of the invention, the method generates eMAIT cells expressing at least 2,000 exogenous TCR polypeptides on the surface of the cell. In some embodiments of the invention, the exogenous nucleic acid molecule encoding a T cell receptor comprises a promoter selected for its ability to resist silencing in the eMAIT cells, for example a human ubiquitin promoter. In some embodiments of the invention, the exogenous nucleic acid molecule is contained in a lentiviral expression vector; and / or the exogenous nucleic acid molecule further encodes a polypeptide that stimulates T cells, a polypeptide that disrupts T cell inhibitory factors, and / or a polypeptide comprising a further receptor. Optionally the polypeptide encoded by the exogenous nucleic acid comprises at least one of a chimeric antigen receptor (CAR),IL-2, IL-7, IL-15, IFN- , TNF- , CD28, 4-1BB, OX40, ICOS, and FOXP3.Methods of treating patients with an eMAIT cell product are also provided. In certain embodiments, the patient has a cancer. In other embodiments, the patient has a viral, bacterial, fungal or parasitic infection. In some embodiments, the patient has a disease or condition involving inflammation, which, in some embodiments, excludes cancer. In specific embodiments, the patient has an autoimmune disease or condition. In some embodiments, the eMAIT cell product is allogeneic with respect to the patient. In additional embodiments, the patient does not exhibit signs of rejection or depletion of the eMAIT cells. Some therapeutic methods further include administering to the patient a stimulatory reagent that activates eMAIT cells, or a reagent that triggers the suicide gene kill-switch. Embodiments of the invention concern cells from a pluripotent stem cell line engineered to function as eMAIT cells with a T cell receptor (TCR) and that also have imaging and suicide targeting capabilities and are resistant to host immune cell-targeted depletion. Such cells are generated in a scalable PSC-T ex vivo culture system that supports the production of an eMAIT cell product from a pluripotent stem cell line at high-efficiency, high yield, and high purity. In some embodiments, the engineered cell is a functional eMAIT cell. In some embodiments, the engineered cell is capable of producing one or more cytokines and / or chemokines such as IFN-gamma, TNF-alpha, TGF-beta, GM-CSF, IL-2, IL-4, IL-5, IL-6, IL-10, IL-13, IL-17, IL-21, RANTES, Eotaxin, MIP-1-alpha, MIP-1-beta, and the like. In some embodiments, the eMAIT cell from which the TCR-alpha chain is obtained and the eMAIT cell from which the TCR-beta chain is obtained are from the same donor. In some embodiments, the donor of the eMAIT cell from which the TCR- alpha chain is obtained is different from the donor of the eMAIT cell from which the TCR-beta chain is obtained. In some embodiments, the sequence encoding the TCR- alpha chain and / or the sequence encoding the TCR-beta chain of a TCR clone is modified. In some embodiments, the modified sequence may encode the same polypeptide sequence as the unmodified TCR clone, e.g., the sequence is codon optimized for expression. In some embodiments, the modified sequence may encode a polypeptide that has a sequence that is different from the unmodified TCR clone, e.g., the modified sequence encodes a polypeptide sequence having one or more amino acid substitutions, deletions, and / or truncations. In particular embodiments, eMAIT cells produced from pluripotent stem cell lines cells are further modified to have one or more characteristics, including to render the cells suitable for allogeneic use or more suitable for allogeneic use than if the cells were not further modified to have one or more characteristics. The present disclosure encompasses eMAIT cells that are suitable for allogeneic use, if desired. In some embodiments, the eMAIT cells are non-alloreactive and express an exogenous iNTK TCR. These cells are useful for “off the shelf” cell therapies and do not require the use of the patient’s own eMAIT or other cells. Therefore, the current methods provide for a more cost-effective, less labor-intensive cell immunotherapy. In specific embodiments, eMAIT cells are engineered to be HLA-negative to achieve safe and successful allogeneic engraftment without causing graft-versus-host disease (GvHD) and being rejected by host immune cells (HvG rejection). In specific embodiments, allogeneic eMAIT cells do not express endogenous TCRs and do not cause GvHD, because the expression of the transgenic eMAIT TCR gene blocks the recombination of endogenous TCRs through allelic exclusion. In particular embodiments, allogeneic eMAIT cells do not express HLA-I and / or HLA-II molecules on cell surface and resist host CD8+and CD4+T cell-mediated allograft depletion and sr39TK immunogen-targeting depletion. Thus, in certain embodiments the eMAIT cells do not express surface HLA-I or -II molecules, achieved through disruption of genes encoding proteins relevant to HLA- I / II expression, including but not limited to beta-2-microglobulin (B2M), major histocompatibility complex II transactivator (CIITA), or HLA-I / II molecules. In some cases, the HLA-I or HLA-II are not expressed on the surface of eMAIT cells because the cells were manipulated by gene editing, which may or may not involve CRISPR- Cas9. In cases wherein the eMAIT cells have been modified to exhibit one or more characteristics of any kind, the eMAIT cells may comprise nucleic acid sequences from a recombinant vector that was introduced into the cells. The vector may be a non-viral vector, such as a plasmid, or a viral vector, such as a lentivirus, a retrovirus, an adeno- associated virus (AAV), a herpesvirus, or adenovirus. As noted above, the eMAIT cells of the disclosure may or may not have been exposed to one or more certain conditions before, during, or after their production. In specific cases, the cells are not or were not exposed to media that comprises animal serum. The cells may be frozen. The cells may be present in a solution comprising dextrose, one or more electrolytes, albumin, dextran, and / or DMSO. Any solution in which the cells are present may be a solution that is sterile, nonpyogenic, and isotonic. The cells may have been activated and expanded by any suitable manner, such asactivated with alpha-galactosylceramide ( -GC), for example.Aspects of the disclosure relate to a human cell comprising: i) an exogenous expression or activity inhibitor of; or ii) a genomic mutation of: one or more of2microglobin (B2M), CIITA, TRAC, TRBC1, or TRBC2. In some embodiments, the cell comprises a genomic mutation. In some embodiments, the genomic mutation comprises a mutation of one or more endogenous genes in the cell’s genome, wherein the one or more endogenous genes comprise the B2M, CIITA, TRAC, TRBC1, or TRBC2 gene. In some embodiments, the mutation comprises a loss of function mutation. In some embodiments, the inhibitor is an expression inhibitor. In some embodiments, the inhibitor comprises an inhibitory nucleic acid. In some embodiments, the inhibitory nucleic acid comprises one or more of a siRNA, shRNA, miRNA, or an antisense molecule. In some embodiments, the cells comprise an activity inhibitor. In some embodiments, following modification the cell is deficient in any detectable expression of one or more of B2M, CIITA, TRAC, TRBC1, or TRBC2 proteins. In some embodiments, the cell comprises an inhibitor or genomic mutation of B2M. In some embodiments, the cell comprises an inhibitor or genomic mutation of CIITA. In some embodiments, the cell comprises an inhibitor or genomic mutation of TRAC. In some embodiments, the cell comprises an inhibitor or genomic mutation of TRBC1. In some embodiments, the cell comprises an inhibitor or genomic mutation of TRBC2. In some embodiments, at least 90% of the genomic DNA encoding B2M, CIITA, TRAC, TRBC1, and / or TRBC2 is deleted. In some embodiments, at least or at most 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, 99, or 100% (or any range derivable therein) of the genomic DNA encoding B2M, CIITA, TRAC, TRBC1, and / or TRBC2 is deleted. In other embodiments, a deletion, insertion, and / or substitution is made in the genomic DNA. In some embodiments, the cell is a progeny of the human stem or progenitor cell. The eMAIT cells that are modified to be HLA-negative may be genetically modified by any suitable manner. The genetic mutations of the disclosure, such as those in the CIITA and / or B2M genes can be introduced by methods known in the art. In certain embodiments, engineered nucleases may be used to introduce exogenous nucleic acid sequences for genetic modification of any cells referred to herein. Genome editing, or genome editing with engineered nucleases (GEEN) is a type of genetic engineering in which DNA is inserted, replaced, or removed from a genome using artificially engineered nucleases, or "molecular scissors." The nucleases create specific double-stranded break (DSBs) at desired locations in the genome, and harness the cell’s endogenous mechanisms to repair the induced break by natural processes of homologous recombination (HR) and nonhomologous end-joining (NHEJ). Non- limiting engineered nucleases include: Zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), the CRISPR / Cas9 system, and engineered meganuclease re-engineered homing endonucleases. Any of the engineered nucleases known in the art can be used in certain aspects of the methods and compositions. The eMAIT cells may be modified using methods that employ RNA interference. It is commonly practiced in genetic analysis that in order to understand the function of a gene or a protein function one interferes with it in a sequence-specific way and monitors its effects on the organism. However, in some organisms it is difficult or impossible to perform site-specific mutagenesis, and therefore more indirect methods have to be used, such as silencing the gene of interest by short RNA interference (siRNA). However, gene disruption by siRNA can be variable and incomplete. Genome editing with nucleases such as ZFN is different from siRNA in that the engineered nuclease is able to modify DNA-binding specificity and therefore can in principle cut any targeted position in the genome, and introduce modification of the endogenous sequences for genes that are impossible to specifically target by conventional RNAi. Furthermore, the specificity of ZFNs and TALENs are enhanced as two ZFNs are required in the recognition of their portion of the target and subsequently direct to the neighboring sequences. Meganucleases may be employed to modify eMAIT cells. Meganucleases, found commonly in microbial species, have the unique property of having very long recognition sequences (>14bp) thus making them naturally very specific. This can be exploited to make site-specific DSB in genome editing; however, the challenge is that not enough meganucleases are known, or may ever be known, to cover all possible target sequences. To overcome this challenge, mutagenesis and high throughput screening methods have been used to create meganuclease variants that recognize unique sequences. Others have been able to fuse various meganucleases and create hybrid enzymes that recognize a new sequence. Yet others have attempted to alter the DNA interacting amino acids of the meganuclease to design sequence specific meganucelases in a method named rationally designed meganuclease (U.S. Patent 8,021,867, incorporated herein by reference). Meganuclease have the benefit of causing less toxicity in cells compared to methods such as ZFNs likely because of more stringent DNA sequence recognition; however, the construction of sequence specific enzymes for all possible sequences is costly and time consuming as one is not benefiting from combinatorial possibilities that methods such as ZFNs and TALENs utilize. So there are both advantages and disadvantages. As opposed to meganucleases, the concept behind ZFNs and TALENs is more based on a non-specific DNA cutting enzyme which would then be linked to specific DNA sequence recognizing peptides such as zinc fingers and transcription activator- like effectors (TALEs). One way was to find an endonuclease whose DNA recognition site and cleaving site were separate from each other, a situation that is not common among restriction enzymes. Once this enzyme was found, its cleaving portion could be separated which would be very non-specific as it would have no recognition ability. This portion could then be linked to sequence recognizing peptides that could lead to very high specificity. An example of a restriction enzyme with such properties is FokI. Additionally, FokI has the advantage of requiring dimerization to have nuclease activity and this means the specificity increases dramatically as each nuclease partner would recognize a unique DNA sequence. To enhance this effect, FokI nucleases have been engineered that can only function as heterodimers and have increased catalytic activity. The heterodimer functioning nucleases would avoid the possibility of unwanted homodimer activity and thus increase specificity of the DSB. Although the nuclease portion of both ZFNs and TALENs have similar properties, the difference between these engineered nucleases is in their DNA recognition peptide. ZFNs rely on Cys2-His2 zinc fingers and TALENs on TALEs. Both of these DNA recognizing peptide domains have the characteristic that they are naturally found in combinations in their proteins. Cys2-His2 Zinc fingers typically happen in repeats that are 3 bp apart and are found in diverse combinations in a variety of nucleic acid interacting proteins such as transcription factors. TALEs on the other hand are found in repeats with a one-to-one recognition ratio between the amino acids and the recognized nucleotide pairs. Because both zinc fingers and TALEs happen in repeated patterns, different combinations can be tried to create a wide variety of sequence specificities. Zinc fingers have been more established in these terms and approaches such as modular assembly (where Zinc fingers correlated with a triplet sequence are attached in a row to cover the required sequence), OPEN (low-stringency selection of peptide domains vs. triplet nucleotides followed by high-stringency selections of peptide combination vs. the final target in bacterial systems), and bacterial one-hybrid screening of zinc finger libraries among other methods have been used to make site specific nucleases. Thus, embodiments of the disclosure may or may not include the targeting of endogenous sequences to reduce or knock out expression of one or more certain endogenous sequences. In specific embodiments, disruption of one or more of the following genes may block the rearrangement of endogenous TCRs. Inhibitory nucleic acids or any ways of inhibiting gene expression of CIITA and / or B2M known in the art are contemplated in certain embodiments. Examples of an inhibitory nucleic acid include but are not limited to siRNA (small interfering RNA), short hairpin RNA (shRNA), double-stranded RNA, an antisense oligonucleotide, a ribozyme and a nucleic acid encoding thereof. An inhibitory nucleic acid may inhibit the transcription of a gene or prevent the translation of a gene transcript in a cell. An inhibitory nucleic acid may be from 16 to 1000 nucleotides long, and in certain embodiments from 18 to 100 nucleotides long. The nucleic acid may have nucleotides of at least or at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 40, 50, 60, 70, 80, 90 or any range derivable therefrom. An siRNA naturally present in a living animal is not “isolated,” but a synthetic siRNA, or an siRNA partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated siRNA can exist in substantially purified form, or can exist in a non-native environment such as, for example, a cell into which the siRNA has been delivered. Inhibitory nucleic acids are well known in the art. For example, siRNA and double-stranded RNA have been described in U.S. Patents 6,506,559 and 6,573,099, as well as in U.S. Patent Publications 2003 / 0051263, 2003 / 0055020, 2004 / 0265839, 2002 / 0168707, 2003 / 0159161, and 2004 / 0064842, all of which are herein incorporated by reference in their entirety. Particularly, an inhibitory nucleic acid may be capable of decreasing the expression of the protein or mRNA by at least 10%, 20%, 30%, or 40%, more particularly by at least 50%, 60%, or 70%, and most particularly by at least 75%, 80%, 90%, 95% or more or any range or value in between the foregoing. In further embodiments, there are synthetic nucleic acids that are protein inhibitors. An inhibitor may be between 17 to 25 nucleotides in length and comprises a 5’ to 3’ sequence that is at least 90% complementary to the 5’ to 3’ sequence of a mature mRNA. In certain embodiments, an inhibitor molecule is 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, or any range derivable therein. Moreover, an inhibitor molecule has a sequence (from 5’ to 3’) that is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein, to the 5’ to 3’ sequence of a mature mRNA, particularly a mature, naturally occurring mRNA, such as a mRNA to B2M, CIITA, TRAC, TRBC1, or TRBC2. One of skill in the art could use a portion of the probe sequence that is complementary to the sequence of a mature mRNA as the sequence for an mRNA inhibitor. Moreover, that portion of the probe sequence can be altered so that it is still 90% complementary to the sequence of a mature mRNA. In cases wherein the eMAIT cells comprise one or more suicide genes for subsequent depletion upon need, the suicide gene may be of any suitable kind. The eMAIT cells of the disclosure may express a suicide gene product that may be enzyme- based, for example. Examples of suicide gene products include herpes simplex virus thymidine kinase (HSV-TK), purine nucleoside phosphorylase (PNP), cytosine deaminase (CD), carboxypetidase G2, cytochrome P450, linamarase, beta-lactamase, nitroreductase (NTR), carboxypeptidase A, or inducible caspase 9. Thus, in specific cases, the suicide gene may encode thymidine kinase (TK). In specific cases, the TK gene is a viral TK gene, such as a herpes simplex virus TK gene. In particular embodiments, the suicide gene product is activated by a substrate, such as ganciclovir, penciclovir, or a derivative thereof. In some embodiments, the eMAIT cells are able to be imaged or otherwise detected. In particular cases, the cells comprise an exogenous nucleic acid encoding a polypeptide that has a substrate that may be labeled for imaging, and the imaging may be fluorescent, radioactive, colorimetric, and so forth. In specific cases, the cells are detected by positron emission tomography. The cells in at least some cases express sr39TK gene that is a positron emission tomography (PET) reporter / thymidine kinase gene that allows for tracking of these genetically modified cells with PET imaging and elimination of these cells through the sr39TK suicide gene function. Encompassed by the disclosure are populations of eMAIT cells. In particular aspects, eMAIT clonal cells comprise an exogenous nucleic acid encoding an eMAIT T-cell receptor (T-cell receptor) and lack surface expression of one or more HLA-I or HLA-II molecules. The eMAIT cells may comprise an exogenous nucleic acid encoding a suicide gene, including an enzyme-based suicide gene such as thymidine kinase (TK). The TK gene may be a viral TK gene, such as a herpes simplex virus TK gene. In the cells of the population the suicide gene may be activated by a substrate, such as ganciclovir, penciclovir, or a derivative thereof, for example. The cells may comprise an exogenous nucleic acid encoding a polypeptide that has a substrate that may be labeled for imaging, and in some cases a suicide gene product is the polypeptide that has a substrate that may be labeled for imaging. In specific aspects, the suicide gene is sr39TK. In certain embodiments of the eMAIT cell population, the eMAIT cells do not express surface HLA-I or -II molecules because of disrupted expression of genes encoding beta-2-microglobulin (B2M), major histocompatibility complex class II transactivator (CIITA), and / or HLA-I or HLA-II molecules, for example. The HLA-I or HLA-II molecules are not expressed on the cell surface of eMAIT cells because the cells were manipulated by gene editing, in specific cases. The gene editing may or may not involve CRISPR-Cas9. In particular cases for the eMAIT cell population, the eMAIT cells comprise nucleic acid sequences from a recombinant vector that was introduced into the cells, such as a viral vector (including at least a lentivirus, a retrovirus, an adeno-associated virus (AAV), a herpesvirus, or adenovirus). In certain embodiments, the cells of the eMAIT cell population may or may not have been exposed to, or are exposed to, one or more certain conditions. In certain of these embodiments, cells are cultured in a medium selected to contain certain factors such as one comprising one or more of: vitamin B2 or a vitamin B2 precursor (e.g., 5- (2-oxopropylideneamino)-6-D-ribitylaminouracil (5-OP-RU) and 5-(2- oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino- 2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, and / or IL-18. In certain cases, for example, the cells of the population not exposed or were not exposed to media that comprises animal serum. The cells of the population may or may not be frozen. In some cases, the cells of the population are in a solution comprising dextrose, one or more electrolytes, albumin, dextran, and / or DMSO. The solution may comprise dextrose, one or more electrolytes, albumin, dextran, and DMSO. The cells may be in a solution that is sterile, nonpyogenic, and isotonic. In specific cases the eMAIT cells have been activated, such as activated with 5-(2-oxopropylideneamino)-6-D- ribitylaminouracil (5-OP-RU). In specific aspects, the cell population comprises at least about 102-106clonal cells. The cell population may comprise at least about 106-1013total cells, in some cases. In particular embodiments there is an eMAIT cell population comprising: clonal eMAIT cells comprising one or more exogenous nucleic acids encoding an eMAIT T- cell receptor and a thymidine kinase suicide, wherein the clonal eMAIT cells have been engineered not to express functional beta-2-microglobulin (B2M), major histocompatibility complex class II transactivator (CIITA), and / or HLA-I and HLA-II molecules and wherein the cell population is at least about 106-1013total cells and comprises at least about 102-106clonal cells. In some cases, the cells are frozen in a solution. I. Formulations and Culture of the Cells In particular embodiments, the eMAIT cells and / or precursors thereto may be specifically formulated and / or they may be cultured in a particular medium at any stage of a process of generating the eMAIT cells. The cells may be formulated in such a manner as to be suitable for delivery to a recipient without deleterious effects. The medium in certain aspects can be prepared using a medium used for culturing animal cells as their basal medium, such as any of AIM V, X-VIVO-15, NeuroBasal, EGM2, TeSR, BME, BGJb, CMRL 1066, Glasgow MEM, Improved MEM Zinc Option, IMDM, Medium 199, Eagle MEM, MEM, DMEM, Ham, RPMI- 1640, and Fischer's media, as well as any combinations thereof, but the medium may not be particularly limited thereto as far as it can be used for culturing animal cells. Particularly, the medium may be xeno-free or chemically defined. The medium can be a serum-containing or serum-free medium, or xeno-free medium. From the aspect of preventing contamination with heterogeneous animal- derived components, serum can be derived from the same animal as that of the stem cell(s). The serum-free medium refers to medium with no unprocessed or unpurified serum and accordingly, can include medium with purified blood-derived components or animal tissue-derived components (such as growth factors). The medium may contain or may not contain any alternatives to serum. The alternatives to serum can include materials which appropriately contain albumin (such as lipid-rich albumin, bovine albumin, albumin substitutes such as recombinant albumin or a humanized albumin, plant starch, dextrans and protein hydrolysates), transferrin (or other iron transporters), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thiolgiycerol, or equivalents thereto. The alternatives to serum can be prepared by the method disclosed in International Publication No. 98 / 30679, for example (incorporated herein in its entirety). Alternatively, any commercially available materials can be used for more convenience. The commercially available materials include knockout Serum Replacement (KSR), Chemically-defined Lipid concentrated (Gibco), and Glutamax (Gibco). In further embodiments, the medium may be a serum-free medium that is suitable for cell development. For example, the medium may comprise B-27®supplement, xeno-free B-27®supplement (available at world wide web at thermofisher.com / us / en / home / technical-resources / media-formulation.250.html), NS21 supplement (Chen et al., J Neurosci Methods, 2008 Jun 30; 171(2): 239–247, incorporated herein in its entirety), GS21TMsupplement (available at world wide web at amsbio.com / B-27.aspx), or a combination thereof at a concentration effective for producing T cells from the 3D cell aggregate. In certain embodiments, the medium may comprise one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more of the following: Vitamins such as biotin; DL Alpha Tocopherol Acetate; DL Alpha-Tocopherol; Vitamin A (acetate); proteins such as BSA (bovine serum albumin) or human albumin, fatty acid free Fraction V; Catalase; Human Recombinant Insulin; Human Transferrin; Superoxide Dismutase; Other Components such as Corticosterone; D-Galactose; Ethanolamine HCl; Glutathione (reduced); L-Carnitine HCl; Linoleic Acid; Linolenic Acid; Progesterone; Putrescine 2HCl; Sodium Selenite; and / or T3 (triodo-I-thyronine). In some embodiments, the medium further comprises vitamins. In some embodiments, the medium comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 of the following (and any range derivable therein): biotin, DL alpha tocopherol acetate, DL alpha-tocopherol, vitamin A, choline chloride, calcium pantothenate, pantothenic acid, folic acid nicotinamide, pyridoxine, riboflavin, thiamine, inositol, vitamin B12, or the medium includes combinations thereof or salts thereof. In some embodiments, the medium comprises or consists essentially of biotin, DL alpha tocopherol acetate, DL alpha-tocopherol, vitamin A, choline chloride, calcium pantothenate, pantothenic acid, folic acid nicotinamide, pyridoxine, riboflavin, thiamine, inositol, and vitamin B12. In some embodiments, the vitamins include or consist essentially of biotin, DL alpha tocopherol acetate, DL alpha-tocopherol, vitamin A, or combinations or salts thereof. In some embodiments, the medium further comprises proteins. In some embodiments, the proteins comprise albumin or bovine serum albumin, a fraction of BSA, catalase, insulin, transferrin, superoxide dismutase, or combinations thereof. In some embodiments, the medium further comprises one or more of the following: corticosterone, D-Galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite, or triodo-I-thyronine, or combinations thereof. In some embodiments, the medium comprises one or more of the following: a B-27®supplement, xeno-free B-27®supplement, GS21TMsupplement, or combinations thereof. In some embodiments, the medium comprises or further comprises amino acids, monosaccharides, inorganic ions. In some embodiments, the amino acids comprise arginine, cystine, isoleucine, leucine, lysine, methionine, glutamine, phenylalanine, threonine, tryptophan, histidine, tyrosine, or valine, or combinations thereof. In some embodiments, the inorganic ions comprise sodium, potassium, calcium, magnesium, nitrogen, or phosphorus, or combinations or salts thereof. In some embodiments, the medium further comprises one or more of the following: molybdenum, vanadium, iron, zinc, selenium, copper, or manganese, or combinations thereof. In certain embodiments, the medium comprises or consists essentially of one or more vitamins discussed herein and / or one or more proteins discussed herein, and / or one or more of the following: corticosterone, D-Galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite, or triodo-I-thyronine, a B-27®supplement, xeno-free B- 27®supplement, GS21TMsupplement, an amino acid (such as arginine, cystine, isoleucine, leucine, lysine, methionine, glutamine, phenylalanine, threonine, tryptophan, histidine, tyrosine, or valine), monosaccharide, inorganic ion (such as sodium, potassium, calcium, magnesium, nitrogen, and / or phosphorus) or salts thereof, and / or molybdenum, vanadium, iron, zinc, selenium, copper, or manganese. In further embodiments, the medium may comprise externally added ascorbic acid. The medium can also contain one or more externally added fatty acids or lipids, amino acids (such as non-essential amino acids), vitamin(s), growth factors, cytokines, antioxidant substances, 2-mercaptoethanol, pyruvic acid, buffering agents, and / or inorganic salts. One or more of the medium components may be added at a concentration of at least, at most, or about 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250 ng / L, ng / ml, μg / ml, mg / ml, or any range derivable therein. The medium used may be supplemented with at least one externally added cytokine at a concentration from about 0.1 ng / mL to about 500 ng / mL, more particularly 1 ng / mL to 100 ng / mL, or at least, at most, or about 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250 ng / L, ng / ml, μg / ml, mg / ml, or any range derivable therein. Suitable cytokines, include but are not limited to, FLT3 ligand (FLT3L), interleukin 7 (IL-7), stem cell factor (SCF), thrombopoietin (TPO), IL-2, IL-4, IL-6, IL-12, IL-15,IL-18, IL-21, TNF- alpha, TGF-beta, interferon-gamma, interferon-lambda, TSLP, thymopentin, pleotrophin, and / or midkine. Particularly, the culture medium may include at least one of FLT3L and IL-7. More particularly, the culture may include a plurality of these cytokines. Other culturing conditions can be appropriately defined. For example, the culturing temperature can be about 20 to 40°C, such as at least, at most, or about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40°C (or any range derivable therein), though the temperature may be above or below these values. The CO2concentration can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% (or any range derivable therein), such as about 2% to 10%, for example, about 2 to 5%, or any range derivable therein. The oxygen tension can be at least or about 1, 5, 8, 10, 20%, or any range derivable therein. In specific embodiments, the allogeneic HSC-engineered HLA-negative eMAIT cells are specifically formulated. They may or may not be formulated as a cell suspension. In specific cases they are formulated in a single dose form. They may be formulated for systemic or local administration. In some cases, the cells are formulated for storage prior to use, and the cell formulation may comprise one or more cryopreservation agents, such as DMSO (for example, in 5% DMSO). The cell formulation may comprise albumin, including human albumin, with a specific formulation comprising 2.5% human albumin. The cells may be formulated specifically for intravenous administration; for example, they are formulated for intravenous administration over less than one hour. In particular embodiments the cells are in a formulated cell suspension that is stable at room temperature for 1, 2, 3, or 4 hours or more from time of thawing. In some embodiments, the method further comprises priming the eMAIT cells. In some embodiments, the eMAIT cells are primed with antigen presenting cells. In some embodiments, the antigen presenting cells present tumor antigens. In particular embodiments, the exogenous TCR of the eMAIT cells may be of any defined antigen specificity. In some embodiments, it can be selected based on absent or reduced alloreactivity to the intended recipient (examples include certain virus-specific TCRs, xeno-specific TCRs, or cancer-testis antigen-specific TCRs). In the example where the exogenous TCR is non-alloreactive, during T cell differentiation the exogenous TCR suppresses rearrangement and / or expression of endogenous TCR loci through a developmental process called allelic exclusion, resulting in T cells that express only the non-alloreactive exogenous TCR and are thus non-alloreactive. In some embodiments, the choice of exogenous TCR may not necessarily be defined based on lack of alloreactivity. In some embodiments, the endogenous TCR genes have been modified by genome editing so that they do not express a protein. Methods of gene editing such as methods using the CRISPR / Cas9 system are known in the art and described herein. In some embodiments, the isolated eMAIT cell or population thereof comprise

[0002] VEGF receptors (e.g., VEGFR2), for example. The CAR may be a first, second, third, or more generation CAR. The CAR may be bispecific for any two nonidentical antigens, or it may be specific for more than two nonidentical antigens. II. Additional Modifications and Polypeptide Embodiments Additionally, the polypeptides of the disclosure may be chemically modified. Glycosylation of the polypeptides can be altered, for example, by modifying one or more sites of glycosylation within the polypeptide sequence to increase the affinity of the polypeptide for antigen (U.S. Pat. Nos.5,714,350 and 6,350,861). Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide, with or without the loss of other functions or properties. Substitutions may be conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. Alternatively, substitutions may be non-conservative such that a function or activity of the polypeptide is affected. Non-conservative changes typically involve substituting a residue with one that is chemically dissimilar, such as a polar or charged amino acid for a nonpolar or uncharged amino acid, and vice versa. Proteins may be recombinant, or synthesized in vitro. Alternatively, a non- recombinant or recombinant protein may be isolated from bacteria. It is also contemplated that bacteria containing such a variant may be implemented in compositions and methods. Consequently, a protein need not be isolated. The term “functionally equivalent codon” is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids. It also will be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids, or 5' or 3' sequences, respectively, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region. The following is a discussion based upon changing of the amino acids of a protein to create an equivalent, or even an improved, second-generation molecule. For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity. Structures such as, for example, an enzymatic catalytic domain or interaction components may have amino acid substituted to maintain such function. Since it is the interactive capacity and nature of a protein that defines that protein’s biological functional activity, certain amino acid substitutions can be made in a protein sequence, and in its underlying DNA coding sequence, and nevertheless produce a protein with like properties. It is thus contemplated by the inventors that various changes may be made in the DNA sequences of genes without appreciable loss of their biological utility or activity. In other embodiments, alteration of the function of a polypeptide is intended by introducing one or more substitutions. For example, certain amino acids may be substituted for other amino acids in a protein structure with the intent to modify the interactive binding capacity of interaction components. Structures such as, for example, protein interaction domains, nucleic acid interaction domains, and catalytic sites may have amino acids substituted to alter such function. Since it is the interactive capacity and nature of a protein that defines that protein’s biological functional activity, certain amino acid substitutions can be made in a protein sequence, and in its underlying DNA coding sequence, and nevertheless produce a protein with different properties. It is thus contemplated by the inventors that various changes may be made in the DNA sequences of genes with appreciable alteration of their biological utility or activity. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like. It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still produce a biologically equivalent and immunologically equivalent protein. As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. In specific embodiments, all or part of proteins described herein can also be synthesized in solution or on a solid support in accordance with conventional techniques. Various automatic synthesizers are commercially available and can be used in accordance with known protocols. See, for example, Stewart and Young, (1984); Tam et al., (1983); Merrifield, (1986); and Barany and Merrifield (1979), each incorporated herein by reference. Alternatively, recombinant DNA technology may be employed wherein a nucleotide sequence that encodes a peptide or polypeptide is inserted into an expression vector, transformed or transfected into an appropriate host cell and cultivated under conditions suitable for expression. One embodiment includes the use of gene transfer to cells, including microorganisms, for the production and / or presentation of proteins. The gene for the protein of interest may be transferred into appropriate host cells followed by culture of cells under the appropriate conditions. A nucleic acid encoding virtually any polypeptide may be employed. The generation of recombinant expression vectors, and the elements included therein, are discussed herein. Alternatively, the protein to be produced may be an endogenous protein normally synthesized by the cell used for protein production. III. Methods of Producing the eMAIT Cells The examples provided herein are merely illustrative, and eMAIT cells may be produced by a variety of suitable method(s). The method(s) may utilize one or more successive steps for one or more modifications to cells and / or utilize one or more simultaneous steps for one or more modifications to cells. In specific embodiments, a starting source of cells from a cell line are modified to become functional as eMAIT cells followed by one or more steps to add one or more additional characteristics to the cells, such as the ability to be imaged, and / or the ability to be selectively killed, and / or the ability to be able to be used allogeneically. In specific embodiments, at least part of the process for generating eMAIT cells occurs in a specific in vitro culture system. An example of a specific in vitro culture system is one that allows differentiation of certain cells at high efficiency and high yield. In specific cases, eMAIT cells may be generated by the following: 1) genetic modification of cells from a pluripotent stem cell line so that they express eMAIT TCRs (for example, via lentiviral vectors) and optionally to eliminate expression of HLA-I / II molecules (for example, via CRISPR / Cas9-based gene editing); 2) in vitro differentiation into eMAIT cells via culture, 3) in vitro eMAIT cell purification and expansion, and 4) formulation and cryopreservation and / or use. Specific aspects of the disclosure relate to a novel three-dimensional cell culture system to produce eMAIT cells from less differentiated cell lines such as embryonic stem cell lines, pluripotent stem cell lines, hematopoietic stem or progenitor cell lines, induced pluripotent stem (iPS) cell lines, or stem or progenitor cell lines. In particular embodiments, the system involves using serum-free medium. In certain aspects, the system uses a serum-free medium that is suitable for cell development for culturing of a three-dimensional cell aggregate. Such a system produces sufficient amounts of eMAIT cells. In embodiments of the disclosure, the 3D cell aggregate is cultured in a serum-free medium comprising insulin for a time period sufficient for the in vitro differentiation of stem or progenitor cells to eMAIT cells or precursors to eMAIT cells. In certain of these embodiments, cells are cultured in a medium selected to contain certain factors such as one comprising one or more of: vitamin B2 or a vitamin B2 precursor (e.g., 5-(2-oxopropylideneamino)-6-D- ribitylaminouracil (5-OP-RU) and 5-(2-oxoethylideneamino)-6-D-ribitylaminouracil (5-OE-RU) ); 5-amino-6-ribitylamino-2,4-(1H,3H)-pyrimidinedione (5-A-RU); a TLR9 agonist, IL-12, and / or IL-18 Embodiments of a cell culture composition comprise a culture that uses highly standardized, serum-free components and a stromal cell line to facilitate robust and highly reproducible T cell differentiation from human HSCs. In certain embodiments, cell differentiation mimics endogenous thymopoiesis and, in contrast to monolayer co- cultures, supported efficient positive selection of functional eMAIT cells. Certain aspects of the 3D culture compositions use serum-free conditions, avoid the use of human thymic tissue or proprietary scaffold materials, and facilitate positive selection and robust generation of fully functional, mature human eMAIT cells from source cells. In methods of preparing a population of clonal eMAIT cells, selecting eMAIT cells lacking surface expression of HLA-I and HLA-II molecules may comprise contacting the eMAIT cells with magnetic beads that bind to and positively select for eMAIT cells and negatively select for HLA-I / II-negative cells. In specific embodiments, the magnetic beads are coated with monoclonal antibodies recognizing human eMAIT TCRs, HLA-I molecules, or HLA-II molecules. In particular embodiments, the monoclonal antibodies are Clone 3C10 (recognizing human TCRV 7.2 thus recognizing human eMAIT invariant TCR alpha chain), Clone 2M2(recognizing human B2M thus recognizing cell surface-displayed human HLA-I molecules), Clone W6 / 32 (recognizing HLA-A,B,C thus recognizing human HLA-I molecules), and Clone Tü39 (recognizing human HLA-DR, DP, DQ thus recognizing human HLA-II molecules). Cells produced by the preparation methods may be frozen. The produced cells may be in a solution comprising dextrose, one or more electrolytes, albumin, dextran, and DMSO. The solution may be sterile, nonpyogenic, and isotonic. In particular embodiments, the system utilizes feeder cells that may comprise CD34- cells. Preparation methods may further comprise activating and expanding the selected eMAIT cells; for example, the selected eMAIT cells have been activated with 5-(2- oxopropylideneamino)-6-D-ribitylaminouracil (5-OP-RU). The feeder cells may have been pulsed with 5-OP-RU. Preparation methods of the disclosure may produce a population of clonal eMAIT cells comprising at least about 102-106clonal eMAIT cells. The method may produce a cell population comprising at least about 106-1012total cells. The produced cell population may be frozen and then thawed. In some cases of the preparation method, the method further comprises introducing one or more additional nucleic acids into the frozen and thawed cell population, such as the one or more additional nucleic acids encoding one or more therapeutic gene products, for example. For example, aggregation is achieved by centrifugation of the mixed cell suspension (“compaction aggregation”) followed by aspiration of the cell-free supernatant. In particular embodiments, the cell pellet may then be aspirated as a slurry in 5-10 ul of a differentiation medium and transferred as a droplet onto 0.4 um nylon transwell culture inserts, which are floated in a well of differentiation medium, allowing the bottom of the insert to be in contact with medium and the top with air. Variations in the protocol permit the use of alternative components with varying impact on efficacy, specifically: Base medium RPMI may be substituted for several commercially available alternatives (e.g. IMDM). Cytokine conditions can be varied: e.g. levels of IL-12 and IL-18 may be changed to alter T cell differentiation kinetics; other hematopoietic cytokines such as Stem Cell Factor (SCF / KIT ligand), thrombopoietin (TPO), IL-2, IL-15 may be added. Genetic modification may also be introduced to certain components to generate antigen-specific T cells, and to model positive and negative selection. Examples of these modifications include: transduction of HSCs with a lentiviral vector encoding an antigen-specific T cell receptor (TCR) or chimeric antigen receptor (CAR) for the generation of antigen-specific, allelically excluded naïve T cells; transduction of HSCs with gene / s to direct lineage commitment to specialized lymphoid cells. For example, transduction of HSCs with a MAIT cell associated TCR to generate functional eMAIT cells; transduction of the cells with human MHC genes (e.g. human CD1d gene) to enhance positive selection and maturation of both TCR engineered or non-engineered T cells; and / or transduction of the cell line with an antigen plus costimulatory molecules or cytokines to enhance the positive selection of CAR MAIT cells. In producing the eMAIT cells, CD34+ cells may be modified by introducing certain exogenous gene(s) and by knocking out certain endogenous gene(s). The methods may further comprise culturing selected CD34+ cells in media prior to introducing one or more nucleic acids into the cells. The culturing may comprise incubating the selected CD34+ cells with medium comprising one or more growth factors, in some cases, and the one or more growth factors may comprise c-kit ligand, flt-3 ligand, and / or human thrombopoietin (TPO), for example. The growth factors may or may not be at a certain concentration, such as between about 5 ng / ml to about 500 ng / ml. In particular methods the nucleic acid(s) to be introduced into the cells are one or more nucleic acids that comprise a nucleic acid sequence encoding an -TCR and a -TCR. The methods may further comprise introducing into the selected CD34+ cells a nucleic acid encoding a suicide gene. In specific aspects, one nucleic acid encodes both the -TCR and the -TCR, or one nucleic acid encodes the -TCR, the -TCR, and the suicide gene. The suicide gene may be enzyme-based, such as thymidine kinase (TK) including a viral TK gene such as one from herpes simplex virus TK gene. The suicide gene may be activated by a substrate, such as ganciclovir, penciclovir, or a derivative thereof. The cells may be engineered to comprise an exogenous nucleic acid encoding a polypeptide that has a substrate that may be labeled for imaging. In some cases, a suicide gene product is a polypeptide that has a substrate that may be labeled for imaging, such as sr39TK. The cells may be engineered to lack surface expression of HLA-I and / or HLA- II molecules, for example by disrupting the functional expression of genes encoding beta-2-microglobulin (B2M), major histocompatibility complex class II transactivator (CIITA), and / or HLA-I and HLA-II molecules. In the production methods, eliminating surface expression of one or more HLA-I / II molecules in the isolated human CD34+ cells may comprise introducing CRISPR and one or more guide RNAs (gRNAs) corresponding to B2M, CIITA, or individual HLA-I or HLA-II molecules into the cells. CRISPR or the one or more gRNAs are transfected into the cell by electroporation or lipid-mediated transfection in some cases. In specific embodiments, the nucleic acid encoding the TCR receptor is introduced into the cell using a recombinant vector such as a viral vector including at least a lentivirus, a retrovirus, an adeno-associated virus (AAV), a herpesvirus, or adenovirus, for example. In manufacturing the eMAIT cells, the cells may be present in a particular serum-free medium, including one that comprises externally added ascorbic acid. In specific aspects, the serum-free medium further comprises externally added FLT3 ligand (FLT3L), interleukin 7 (IL-7), stem cell factor (SCF), thrombopoietin (TPO), stem cell factor (SCF), thrombopoietin (TPO), IL-2, IL-4, IL-6, IL-15, IL-21, TNF- alpha, TGF-beta, interferon-gamma, interferon-lambda, TSLP, thymopentin, pleotrophin, midkine, or combinations thereof. The serum-free medium may further comprise vitamins, including biotin, DL alpha tocopherol acetate, DL alpha-tocopherol, vitamin A, choline chloride, calcium pantothenate, pantothenic acid, folic acid nicotinamide, pyridoxine, riboflavin, thiamine, inositol, vitamin B12, or combinations thereof or salts thereof. The serum-free medium may further comprise one or more externally added (or not) proteins, such as albumin or bovine serum albumin, a fraction of BSA, catalase, insulin, transferrin, superoxide dismutase, or combinations thereof. The serum-free medium may further comprise corticosterone, D-Galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite, or triodo-I-thyronine, or combinations thereof. The serum- free medium may comprise a B-27®supplement, xeno-free B-27®supplement, GS21TMsupplement, or combinations thereof. Amino acids (including arginine, cysteine, isoleucine, leucine, lysine, methionine, glutamine, phenylalanine, threonine, tryptophan, histidine, tyrosine, or valine, or combinations thereof), monosaccharides, and / or inorganic ions (including sodium, potassium, calcium, magnesium, nitrogen, or phosphorus, or combinations or salts thereof, for example) may be present in the serum- free medium. The serum-free medium may further comprise molybdenum, vanadium, iron, zinc, selenium, copper, or manganese, or combinations thereof. Cell culture conditions may be provided for the culture of 3D cell aggregates described herein and for the production of T cells and / or positive / negative selection thereof. In certain aspects, starting cells of a selected population may comprise at least or about 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013cells or any range derivable therein. The starting cell population may have a seeding density of at least or about 10, 101, 102, 103, 104, 105, 106, 107, 108cells / ml, or any range derivable therein. A culture vessel used for culturing the 3D cell aggregates or progeny cells thereof can include, but is particularly not limited to: flask, flask for tissue culture, dish, petri dish, dish for tissue culture, multi dish, micro plate, micro-well plate, multi plate, multi-well plate, micro slide, chamber slide, tube, tray, CellSTACK® Chambers, culture bag, and roller bottle, as long as it is capable of culturing the stem cells therein. The stem cells may be cultured in a volume of at least or about 0.2, 0.5, 1, 2, 5, 10, 20, 30, 40, 50 ml, 100 ml, 150 ml, 200 ml, 250 ml, 300 ml, 350 ml, 400 ml, 450 ml, 500 ml, 550 ml, 600 ml, 800 ml, 1000 ml, 1500 ml, or any range derivable therein, depending on the needs of the culture. In a certain embodiment, the culture vessel may be a bioreactor, which may refer to any device or system that supports a biologically active environment. The bioreactor may have a volume of at least or about 2, 4, 5, 6, 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 500 liters, 1, 2, 4, 6, 8, 10, 15 cubic meters, or any range derivable therein. The culture vessel can be cellular adhesive or non-adhesive and selected depending on the purpose. The cellular adhesive culture vessel can be coated with any of substrates for cell adhesion such as extracellular matrix (ECM) to improve the adhesiveness of the vessel surface to the cells. The substrate for cell adhesion can be any material intended to attach stem cells or feeder cells (if used). The substrate for cell adhesion includes collagen, gelatin, poly-L-lysine, poly-D-lysine, laminin, and fibronectin and mixtures thereof for example MatrigelTM, and lysed cell membrane preparations. Various defined matrix components may be used in the culturing methods or compositions. For example, recombinant collagen IV, fibronectin, laminin, and vitronectin in combination may be used to coat a culturing surface as a means of providing a solid support for pluripotent cell growth, as described in Ludwig et al. (2006a; 2006b), which are incorporated by reference in its entirety. A matrix composition may be immobilized on a surface to provide support for cells. The matrix composition may include one or more extracellular matrix (ECM) proteins and an aqueous solvent. The term “extracellular matrix” is recognized in the art. Its components include one or more of the following proteins: fibronectin, laminin, vitronectin, tenascin, entactin, thrombospondin, elastin, gelatin, collagen, fibrillin, merosin, anchorin, chondronectin, link protein, bone sialoprotein, osteocalcin, osteopontin, epinectin, hyaluronectin, undulin, epiligrin, and kalinin. Other extracellular matrix proteins are described in Kleinman et al., (1993), herein incorporated by reference. It is intended that the term “extracellular matrix” encompass a presently unknown extracellular matrix that may be discovered in the future, since its characterization as an extracellular matrix will be readily determinable by persons skilled in the art. In some aspects, the total protein concentration in the matrix composition may be about 1 ng / mL to about 1 mg / mL. In some embodiments, the total protein concentration in the matrix composition is about 1 g / mL to about 300 g / mL. In more preferred embodiments, the total protein concentration in the matrix composition is about 5 g / mL to about 200 g / mL. The extracellular matrix (ECM) proteins may be of natural origin and purified from human or animal tissues. Alternatively, the ECM proteins may be genetically engineered recombinant proteins or synthetic in nature. The ECM proteins may be a whole protein or in the form of peptide fragments, native or engineered. Examples of ECM protein that may be useful in the matrix for cell culture include laminin, collagen I, collagen IV, fibronectin and vitronectin. In some embodiments, the matrix composition includes synthetically generated peptide fragments of fibronectin or recombinant fibronectin. In still further embodiments, the matrix composition includes a mixture of at least fibronectin and vitronectin. In some other embodiments, the matrix composition preferably includes laminin. The matrix composition preferably includes a single type of extracellular matrix protein. In some embodiments, the matrix composition includes fibronectin, particularly for use with culturing progenitor cells. For example, a suitable matrix composition may be prepared by diluting human fibronectin, such as human fibronectin sold by Becton, Dickinson & Co. of Franklin Lakes, N.J. (BD) (Cat#354008), in Dulbecco's phosphate buffered saline (DPBS) to a protein concentration of 5 g / mL to about 200 g / mL. In a particular example, the matrix composition includes a fibronectin fragment, such as RetroNectin®. RetroNectin® is a ~63 kDa protein of (574 amino acids) that contains a central cell-binding domain (type III repeat, 8,9,10), a high affinity heparin-binding domain II (type III repeat, 12,13,14), and CS1 site within the alternatively spliced IIICS region of human fibronectin. In some other embodiments, the matrix composition may include laminin. For example, a suitable matrix composition may be prepared by diluting laminin (Sigma- Aldrich (St. Louis, Mo.); Cat#L6274 and L2020) in Dulbecco's phosphate buffered saline (DPBS) to a protein concentration of 5 g / ml to about 200 g / ml. In some embodiments, the matrix composition is xeno-free, in that the matrix is or its component proteins are only of human origin. This may be desired for certain research applications. For example, in the xeno-free matrix to culture human cells, matrix components of human origin may be used, wherein any non-human animal components may be excluded. In certain aspects, MatrigelTMmay be excluded as a substrate from the culturing composition. MatrigelTMis a gelatinous protein mixture secreted by mouse tumor cells and is commercially available from BD Biosciences (New Jersey, USA). This mixture resembles the complex extracellular environment found in many tissues and is used frequently by cell biologists as a substrate for cell culture, but it may introduce undesired xeno antigens or contaminants. In certain embodiments, cells containing an exogenous nucleic acid may be identified in vitro or in vivo by including a marker in the expression vector or the exogenous nucleic acid. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector. Generally, a selection marker may be one that confers a property that allows for selection. A positive selection marker may be one in which the presence of the marker allows for its selection, while a negative selection marker is one in which its presence prevents its selection. An example of a positive selection marker is a drug resistance marker. Usually the inclusion of a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selection markers. In addition to markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions, other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated. Alternatively, screenable enzymes as negative selection markers such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized. One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selection and screenable markers are well known to one of skill in the art. Selectable markers may include a type of reporter gene used in laboratory microbiology, molecular biology, and genetic engineering to indicate the success of a transfection or other procedure meant to introduce foreign DNA into a cell. Selectable markers are often antibiotic resistance genes; cells that have been subjected to a procedure to introduce foreign DNA are grown on a medium containing an antibiotic, and those cells that can grow have successfully taken up and expressed the introduced genetic material. Examples of selectable markers include: the Abicr gene or Neo gene from Tn5, which confers antibiotic resistance to geneticin. A screenable marker may comprise a reporter gene, which allows the researcher to distinguish between wanted and unwanted cells. Certain embodiments of the present invention utilize reporter genes to indicate specific cell lineages. For example, the reporter gene can be located within expression elements and under the control of the ventricular- or atrial-selective regulatory elements normally associated with the coding region of a ventricular- or atrial-selective gene for simultaneous expression. A reporter allows the cells of a specific lineage to be isolated without placing them under drug or other selective pressures or otherwise risking cell viability. Examples of such reporters include genes encoding cell surface proteins (e.g., CD4, HA epitope), fluorescent proteins, antigenic determinants and enzymes (e.g., - galactosidase). The vector containing cells may be isolated, e.g., by FACS using fluorescently-tagged antibodies to the cell surface protein or substrates that can be converted to fluorescent products by a vector encoded enzyme. In specific embodiments, the reporter gene is a fluorescent protein. A broad range of fluorescent protein genetic variants have been developed that feature fluorescence emission spectral profiles spanning almost the entire visible light spectrum. Mutagenesis efforts in the original Aequorea victoria jellyfish green fluorescent protein have resulted in new fluorescent probes that range in color from blue to yellow, and are some of the most widely used in vivo reporter molecules in biological research. Longer wavelength fluorescent proteins, emitting in the orange and red spectral regions, have been developed from the marine anemone, Discosoma striata, and reef corals belonging to the class Anthozoa. Still other species have been mined to produce similar proteins having cyan, green, yellow, orange, and deep red fluorescence emission. Developmental research efforts are ongoing to improve the brightness and stability of fluorescent proteins, thus improving their overall usefulness. The cells in certain embodiments can be made to contain one or more genetic alterations by genetic engineering of the cells either before or after differentiation (US 2002 / 0168766). A cell is said to be "genetically altered", “genetically modified” or “transgenic” when an exogenous nucleic acid or polynucleotide has been transferred into the cell by any suitable means of artificial manipulation, or where the cell is a progeny of the originally altered cell that has inherited the polynucleotide. For example, the cells can be processed to increase their replication potential by genetically altering the cells to express telomerase reverse transcriptase, either before or after they progress to restricted developmental lineage cells or terminally differentiated cells (U.S. Patent Application Publication 2003 / 0022367). In certain embodiments, cells containing an exogenous nucleic acid construct may be identified in vitro or in vivo by including a marker in the expression vector, such as a selectable or screenable marker. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector, or help enrich or identify differentiated cardiac cells by using a tissue-specific promoter. For example, in the aspects of cardiomyocyte differentiation, cardiac-specific promoters may be used, such as promoters of cardiac troponin I (cTnI), cardiac troponin T (cTnT), sarcomeric myosin heavy chain (MHC), GATA-4, Nkx2.5, N-cadherin, 1- adrenoceptor, ANF, the MEF-2 family of transcription factors, creatine kinase MB (CK-MB), myoglobin, or atrial natriuretic factor (ANF). In aspects of neuron differentiation, neuron-specific promoters may be used, including but not limited to, TuJ-1, Map-2, Dcx or Synapsin. In aspects of hepatocyte differentiation, definitive endoderm- and / or hepatocyte-specific promoters may be used, including but not limited to, ATT, Cyp3a4, ASGPR, FoxA2, HNF4a or AFP. Generally, a selectable marker is one that confers a property that allows for selection. A positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection. An example of a positive selectable marker is a drug resistance marker. Usually the inclusion of a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to blasticidin, neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. In addition to markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions, other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated. Alternatively, screenable enzymes such as chloramphenicol acetyltransferase (CAT) may be utilized. One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable and screenable markers are well known to one of skill in the art. In embodiments wherein cells are genetically modified, such as to add or reduce one or more features, the genetic modification may occur by any suitable method. For example, any genetic modification compositions or methods may be used to introduce exogenous nucleic acids into cells or to edit the genomic DNA, such as gene editing, homologous recombination or non-homologous recombination, RNA-mediated genetic delivery or any conventional nucleic acid delivery methods. Non-limiting examples of the genetic modification methods may include gene editing methods such as by CRISPR / CAS9, zinc finger nuclease, or TALEN technology. Genetic modification may also include the introduction of a selectable or screenable marker that aid selection or screen or imaging in vitro or in vivo. Particularly, in vivo imaging agents or suicide genes may be expressed exogenously or added to starting cells or progeny cells. In further aspects, the methods may involve image-guided adoptive cell therapy. IV. Methods of Using the Cells The eMAIT cells of the disclosure may or may not be utilized directly after production. In some cases, they are stored for later purpose. In any event, they may be utilized in therapeutic or preventative applications for a mammalian subject (human, dog, cat, horse, etc.) such as a patient. The patient may be in need of cell therapy for a medical condition of any kind, including allogeneic cell therapy. Methods of treating a patient with a therapeutically effective amount of eMAIT cells of the disclosure comprise administering the cells or clonal populations thereof to the patient. The cells or cell populations may be allogeneic with respect to the patient. The patient does not exhibit signs of depletion of the cells or cell population, in particular embodiments. The patient may or may not have cancer and / or a disease or condition involving inflammation. In specific embodiments wherein the patient has cancer, tumor cells of the cancer patient are killed after administering the cells or cell population to the patient. In specific cases wherein the patient has inflammation, the inflammation is reduced following administering the cells or cell population to the patient. In specific embodiments of the methods of treatment, the method further comprises administering to the patient a compound that initiates the suicide gene product. For patients with cancer, once infused into patients it is expected that this cell product can employ multiple mechanisms to target and eradicate tumor cells. The infused cells can directly recognize and kill MR1+tumor cells through cytotoxicity.They can secrete cytokines such as IFN- to activate cells to kill HLA-negative tumorcells, and also activate DCs which then stimulate cytotoxic T cells to kill HLA-positive tumor cells. Because the eMAIT cells can target a large range of cancers without tumor antigen- and MHC-restrictions, an off-the-shelf eMAIT cellular product is useful as a general cancer immunotherapy for treating any type of cancer and a large population of cancer patients. In specific cases, the present therapy is useful for patients with cancers that have been clinically indicated to be subject to eMAIT cell regulation, including multiple types of solid tumors (melanoma, colon, lung, breast, and head and neck cancers) and blood cancers (leukemia, multiple myeloma, and myelodysplastic syndromes), for example. In some embodiments of any of the above-disclosed methods, the subject has or is at risk of having an autoimmune disease, graft versus host disease (GVHD), or graft rejection. The subject may be one diagnosed with such disease or one that has been determined to have a pre-disposition to such disease based on genetic or family history analysis. The subject may also be one that is preparing to or has undergone a transplant. In some embodiments, the method is for treating an autoimmune disease, GVHD, or graft rejection. Individuals treated with the present cell therapy may or may not have been treated for the particular medical condition prior to receiving the eMAIT cell therapy. In cases wherein the individual has cancer, the cancer may be primary, metastatic, resistant to therapy, and so forth. patients who have exhausted conventional treatment options. In particular embodiments, the cells are provided to the patient at 107-109cells per dose. In specific embodiments, the dosing regimen is a single-dose of allogeneic eMAIT cells following lymphodeleting conditioning. The cells may be administered intravenously following lymphodepleting conditioning with fludarabine and cyclophosphamide, for example. In cases wherein antitumor efficacy in vivo is characterized for subsequent in vivo therapeutic cases, in vivo pharmacological responses may be measured by treating tumor-bearing NSG mice with escalating doses (1x106, 5x106, 10x106) of eMAIT cells (n = 8 per group); treatment with PBS may be included as a control. Two tumor models may be utilized, as examples. A375-FG (1x106s.c.) may be used as a solid tumor model and MM.1S-FG (5x106i.v.) may be used as a hematological malignancy model. Tumor growth can be monitored by either measuring size and / or bioluminescence imaging. Antitumor immune responses can be measured by PET imaging, periodic bleeding, and end-point tumor harvest followed by flow cytometry and qPCR. Inhibition of tumor growth in response to eMAIT treatment can indicate the therapeutic efficacy of eMAIT cell therapy. Correlation of tumor inhibition with eMAIT doses can confirm the therapeutic role of the eMAIT cells and indicate an effective therapeutic window for human therapy. Detection of eMAIT cell responses to tumors can demonstrate the pharmacological antitumor activities of these cells in vivo. Methods may be employed with respect to individuals who have tested positive for a medical condition, who have one or more symptoms of a medical condition, or who are deemed to be at risk for developing such a condition. In some embodiments, the compositions and methods described herein are used to treat an inflammatory or autoimmune component of a disorder listed herein and / or known in the art. Certain aspects of the disclosure relate to the treatment of cancer and / or use of cancer antigens. The cancer to be treated or antigen may be an antigen associated with any cancer known in the art or, for example, epithelial cancer, (e.g., breast, gastrointestinal, lung), prostate cancer, bladder cancer, lung (e.g., small cell lung) cancer, colon cancer, ovarian cancer, brain cancer, gastric cancer, renal cell carcinoma, pancreatic cancer, liver cancer, esophageal cancer, head and neck cancer, or a colorectal cancer. In some embodiments, the cancer to be treated or antigen is from one of the following cancers: adenocortical carcinoma, agnogenic myeloid metaplasia, AIDS- related cancers (e.g., AIDS-related lymphoma), anal cancer, appendix cancer, astrocytoma (e.g., cerebellar and cerebral), basal cell carcinoma, bile duct cancer (e.g., extrahepatic), bladder cancer, bone cancer, (osteosarcoma and malignant fibrous histiocytoma), brain tumor (e.g., glioma, brain stem glioma, cerebellar or cerebral astrocytoma (e.g., pilocytic astrocytoma, diffuse astrocytoma, anaplastic (malignant) astrocytoma), malignant glioma, ependymoma, oligodenglioma, meningioma, meningiosarcoma, craniopharyngioma, haemangioblastomas, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic glioma, and glioblastoma), breast cancer, bronchial adenomas / carcinoids, carcinoid tumor (e.g., gastrointestinal carcinoid tumor), carcinoma of unknown primary, central nervous system lymphoma, cervical cancer, colon cancer, colorectal cancer, chronic myeloproliferative disorders, endometrial cancer (e.g., uterine cancer), ependymoma, esophageal cancer, Ewing's family of tumors, eye cancer (e.g., intraocular melanoma and retinoblastoma), gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor, (e.g., extracranial, extragonadal, ovarian), gestational trophoblastic tumor, head and neck cancer, hepatocellular (liver) cancer (e.g., hepatic carcinoma and hepatoma), hypopharyngeal cancer, islet cell carcinoma (endocrine pancreas), laryngeal cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, oral cancer, liver cancer, lung cancer (e.g., small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung), lymphoid neoplasm (e.g., lymphoma), medulloblastoma, ovarian cancer, mesothelioma, metastatic squamous neck cancer, mouth cancer, multiple endocrine neoplasia syndrome, myelodysplastic syndromes, myelodysplastic / myeloproliferative diseases, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, neuroendocrine cancer, oropharyngeal cancer, ovarian cancer (e.g., ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor), pancreatic cancer, parathyroid cancer, penile cancer, cancer of the peritoneal, pharyngeal cancer, pheochromocytoma, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, pleuropulmonary blastoma, lymphoma, primary central nervous system lymphoma (microglioma), pulmonary lymphangiomyomatosis, rectal cancer, renal cancer, renal pelvis and ureter cancer (transitional cell cancer), rhabdomyosarcoma, salivary gland cancer, skin cancer (e.g., non-melanoma (e.g., squamous cell carcinoma), melanoma, and Merkel cell carcinoma), small intestine cancer, squamous cell cancer, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, tuberous sclerosis, urethral cancer, vaginal cancer, vulvar cancer, Wilms' tumor, and post-transplant lymphoproliferative disorder (PTLD), abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors), or Meigs' syndrome. Certain aspects of the disclosure relate to the treatment of an autoimmune condition and / or use of an autoimmune-associated antigen. The autoimmune disease to be treated or antigen may be an antigen associated with any autoimmune condition known in the art or, for example, diabetes, graft rejection, GVHC, arthritis (rheumatoid arthritis such as acute arthritis, chronic rheumatoid arthritis, gout or gouty arthritis, acute gouty arthritis, acute immunological arthritis, chronic inflammatory arthritis, degenerative arthritis, type II collagen-induced arthritis, infectious arthritis, Lyme arthritis, proliferative arthritis, psoriatic arthritis, Still's disease, vertebral arthritis, and juvenile-onset rheumatoid arthritis, osteoarthritis, arthritis chronica progrediente, arthritis deformans, polyarthritis chronica primaria, reactive arthritis, and ankylosing spondylitis), inflammatory hyperproliferative skin diseases, psoriasis such as plaque psoriasis, gutatte psoriasis, pustular psoriasis, and psoriasis of the nails, atopy including atopic diseases such as hay fever and Job's syndrome, dermatitis including contact dermatitis, chronic contact dermatitis, exfoliative dermatitis, allergic dermatitis, allergic contact dermatitis, dermatitis herpetiformis, nummular dermatitis, seborrheic dermatitis, non-specific dermatitis, primary irritant contact dermatitis, and atopic dermatitis, x-linked hyper IgM syndrome, allergic intraocular inflammatory diseases, urticaria such as chronic allergic urticaria and chronic idiopathic urticaria, including chronic autoimmune urticaria, myositis, polymyositis / dermatomyositis, juvenile dermatomyositis, toxic epidermal necrolysis, scleroderma (including systemic scleroderma), sclerosis such as systemic sclerosis, multiple sclerosis (MS) such as spino-optical MS, primary progressive MS (PPMS), and relapsing remitting MS (RRMS), progressive systemic sclerosis, atherosclerosis, arteriosclerosis, sclerosis disseminata, ataxic sclerosis, neuromyelitis optica (NMO), inflammatory bowel disease (IBD) (for example, Crohn's disease, autoimmune-mediated gastrointestinal diseases, colitis such as ulcerative colitis, colitis ulcerosa, microscopic colitis, collagenous colitis, colitis polyposa, necrotizing enterocolitis, and transmural colitis, and autoimmune inflammatory bowel disease), bowel inflammation, pyoderma gangrenosum, erythema nodosum, primary sclerosing cholangitis, respiratory distress syndrome, including adult or acute respiratory distress syndrome (ARDS), meningitis, inflammation of all or part of the uvea, iritis, choroiditis, an autoimmune hematological disorder, rheumatoid spondylitis, rheumatoid synovitis, hereditary angioedema, cranial nerve damage as in meningitis, herpes gestationis, pemphigoid gestationis, pruritis scroti, autoimmune premature ovarian failure, sudden hearing loss due to an autoimmune condition, IgE-mediated diseases such as anaphylaxis and allergic and atopic rhinitis, encephalitis such as Rasmussen's encephalitis and limbic and / or brainstem encephalitis, uveitis, such as anterior uveitis, acute anterior uveitis, granulomatous uveitis, nongranulomatous uveitis, phacoantigenic uveitis, posterior uveitis, or autoimmune uveitis, glomerulonephritis (GN) with and without nephrotic syndrome such as chronic or acute glomerulonephritis such as primary GN, immune- mediated GN, membranous GN (membranous nephropathy), idiopathic membranous GN or idiopathic membranous nephropathy, membrano- or membranous proliferative GN (MPGN), including Type I and Type II, and rapidly progressive GN, proliferative nephritis, autoimmune polyglandular endocrine failure, balanitis including balanitis circumscripta plasmacellularis, balanoposthitis, erythema annulare centrifugum, erythema dyschromicum perstans, eythema multiform, granuloma annulare, lichen nitidus, lichen sclerosus et atrophicus, lichen simplex chronicus, lichen spinulosus, lichen planus, lamellar ichthyosis, epidermolytic hyperkeratosis, premalignant keratosis, pyoderma gangrenosum, allergic conditions and responses, allergic reaction, eczema including allergic or atopic eczema, asteatotic eczema, dyshidrotic eczema, and vesicular palmoplantar eczema, asthma such as asthma bronchiale, bronchial asthma, and auto-immune asthma, conditions involving infiltration of T cells and chronic inflammatory responses, immune reactions against foreign antigens such as fetal A-B- O blood groups during pregnancy, chronic pulmonary inflammatory disease, autoimmune myocarditis, leukocyte adhesion deficiency, lupus, including lupus nephritis, lupus cerebritis, pediatric lupus, non-renal lupus, extra-renal lupus, discoid lupus and discoid lupus erythematosus, alopecia lupus, systemic lupus erythematosus (SLE) such as cutaneous SLE or subacute cutaneous SLE, neonatal lupus syndrome (NLE), and lupus erythematosus disseminatus, juvenile onset (Type I) diabetes mellitus, including pediatric insulin-dependent diabetes mellitus (IDDM), and adult onset diabetes mellitus (Type II diabetes) and autoimmune diabetes. Also contemplated are immune responses associated with acute and delayed hypersensitivity mediated by cytokines and T-lymphocytes, sarcoidosis, granulomatosis including lymphomatoid granulomatosis, Wegener's granulomatosis, agranulocytosis, vasculitides, including vasculitis, large-vessel vasculitis (including polymyalgia rheumatica and gianT cell (Takayasu's) arteritis), medium-vessel vasculitis (including Kawasaki's disease and polyarteritis nodosa / periarteritis nodosa), microscopic polyarteritis, immunovasculitis, CNS vasculitis, cutaneous vasculitis, hypersensitivity vasculitis, necrotizing vasculitis such as systemic necrotizing vasculitis, and ANCA-associated vasculitis, such as Churg-Strauss vasculitis or syndrome (CSS) and ANCA-associated small-vessel vasculitis, temporal arteritis, aplastic anemia, autoimmune aplastic anemia, Coombs positive anemia, Diamond Blackfan anemia, hemolytic anemia or immune hemolytic anemia including autoimmune hemolytic anemia (AIHA), Addison's disease, autoimmune neutropenia, pancytopenia, leukopenia, diseases involving leukocyte diapedesis, CNS inflammatory disorders, Alzheimer's disease, Parkinson's disease, multiple organ injury syndrome such as those secondary to septicemia, trauma or hemorrhage, antigen-antibody complex-mediated diseases, anti-glomerular basement membrane disease, anti-phospholipid antibody syndrome, allergic neuritis, Behcet's disease / syndrome, Castleman's syndrome, Goodpasture's syndrome, Reynaud's syndrome, Sjogren's syndrome, Stevens-Johnson syndrome, pemphigoid such as pemphigoid bullous and skin pemphigoid, pemphigus (including pemphigus vulgaris, pemphigus foliaceus, pemphigus mucus-membrane pemphigoid, and pemphigus erythematosus), autoimmune polyendocrinopathies, Reiter's disease or syndrome, thermal injury, preeclampsia, an immune complex disorder such as immune complex nephritis, antibody-mediated nephritis, polyneuropathies, chronic neuropathy such as IgM polyneuropathies or IgM-mediated neuropathy, autoimmune or immune-mediated thrombocytopenia such as idiopathic thrombocytopenic purpura (ITP) including chronic or acute ITP, scleritis such as idiopathic cerato-scleritis, episcleritis, autoimmune disease of the testis and ovary including autoimmune orchitis and oophoritis, primary hypothyroidism, hypoparathyroidism, autoimmune endocrine diseases including thyroiditis such as autoimmune thyroiditis, Hashimoto's disease, chronic thyroiditis (Hashimoto's thyroiditis), or subacute thyroiditis, autoimmune thyroid disease, idiopathic hypothyroidism, Grave's disease, polyglandular syndromes such as autoimmune polyglandular syndromes (or polyglandular endocrinopathy syndromes), paraneoplastic syndromes, including neurologic paraneoplastic syndromes such as Lambert-Eaton myasthenic syndrome or Eaton-Lambert syndrome, stiff-man or stiff-person syndrome, encephalomyelitis such as allergic encephalomyelitis or encephalomyelitis allergica and experimental allergic encephalomyelitis (EAE), experimental autoimmune encephalomyelitis, myasthenia gravis such as thymoma- associated myasthenia gravis, cerebellar degeneration, neuromyotonia, opsoclonus or opsoclonus myoclonus syndrome (OMS), and sensory neuropathy, multifocal motor neuropathy, Sheehan's syndrome, autoimmune hepatitis, chronic hepatitis, lupoid hepatitis, gianT cell hepatitis, chronic active hepatitis or autoimmune chronic active hepatitis, lymphoid interstitial pneumonitis (LIP), bronchiolitis obliterans (non- transplant) vs NSIP, Guillain-Barre syndrome, Berger's disease (IgA nephropathy), idiopathic IgA nephropathy, linear IgA dermatosis, acute febrile neutrophilic dermatosis, subcorneal pustular dermatosis, transient acantholytic dermatosis, cirrhosis such as primary biliary cirrhosis and pneumonocirrhosis, autoimmune enteropathy syndrome, Celiac or Coeliac disease, celiac sprue (gluten enteropathy), refractory sprue, idiopathic sprue, cryoglobulinemia, amylotrophic lateral sclerosis (ALS; Lou Gehrig's disease), coronary artery disease, autoimmune ear disease such as autoimmune inner ear disease (AIED), autoimmune hearing loss, polychondritis such as refractory or relapsed or relapsing polychondritis, pulmonary alveolar proteinosis, Cogan's syndrome / nonsyphilitic interstitial keratitis, Bell's palsy, Sweet's disease / syndrome, rosacea autoimmune, zoster-associated pain, amyloidosis, a non-cancerous lymphocytosis, a primary lymphocytosis, which includes monoclonal B cell lymphocytosis (e.g., benign monoclonal gammopathy and monoclonal gammopathy of undetermined significance, MGUS), peripheral neuropathy, paraneoplastic syndrome, channelopathies such as epilepsy, migraine, arrhythmia, muscular disorders, deafness, blindness, periodic paralysis, and channelopathies of the CNS, autism, inflammatory myopathy, focal or segmental or focal segmental glomerulosclerosis (FSGS), endocrine opthalmopathy, uveoretinitis, chorioretinitis, autoimmune hepatological disorder, fibromyalgia, multiple endocrine failure, Schmidt's syndrome, adrenalitis, gastric atrophy, presenile dementia, demyelinating diseases such as autoimmune demyelinating diseases and chronic inflammatory demyelinating polyneuropathy, Dressler's syndrome, alopecia greata, alopecia totalis, CREST syndrome (calcinosis, Raynaud's phenomenon, esophageal dysmotility, sclerodactyl), and telangiectasia), male and female autoimmune infertility, e.g., due to anti-spermatozoan antibodies, mixed connective tissue disease, Chagas' disease, rheumatic fever, recurrent abortion, farmer's lung, erythema multiforme, post-cardiotomy syndrome, Cushing's syndrome, bird-fancier's lung, allergic granulomatous angiitis, benign lymphocytic angiitis, Alport's syndrome, alveolitis such as allergic alveolitis and fibrosing alveolitis, interstitial lung disease, transfusion reaction, leprosy, malaria, parasitic diseases such as leishmaniasis, kypanosomiasis, schistosomiasis, ascariasis, aspergillosis, Sampter's syndrome, Caplan's syndrome, dengue, endocarditis, endomyocardial fibrosis, diffuse interstitial pulmonary fibrosis, interstitial lung fibrosis, pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, endophthalmitis, erythema elevatum et diutinum, erythroblastosis fetalis, eosinophilic faciitis, Shulman's syndrome, Felty's syndrome, flariasis, cyclitis such as chronic cyclitis, heterochronic cyclitis, iridocyclitis (acute or chronic), or Fuch's cyclitis, Henoch-Schonlein purpura, human immunodeficiency virus (HIV) infection, SCID, acquired immune deficiency syndrome (AIDS), echovirus infection, sepsis, endotoxemia, pancreatitis, thyroxicosis, parvovirus infection, rubella virus infection, post-vaccination syndromes, congenital rubella infection, Epstein-Barr virus infection, mumps, Evan's syndrome, autoimmune gonadal failure, Sydenham's chorea, post-streptococcal nephritis, thromboangitis ubiterans, thyrotoxicosis, tabes dorsalis, chorioiditis, gianT cell polymyalgia, chronic hypersensitivity pneumonitis, keratoconjunctivitis sicca, epidemic keratoconjunctivitis, idiopathic nephritic syndrome, minimal change nephropathy, benign familial and ischemia-reperfusion injury, transplant organ reperfusion, retinal autoimmunity, joint inflammation, bronchitis, chronic obstructive airway / pulmonary disease, silicosis, aphthae, aphthous stomatitis, arteriosclerotic disorders, asperniogenese, autoimmune hemolysis, Boeck's disease, cryoglobulinemia, Dupuytren's contracture, endophthalmia phacoanaphylactica, enteritis allergica, erythema nodosum leprosum, idiopathic facial paralysis, chronic fatigue syndrome, febris rheumatica, Hamman-Rich's disease, sensoneural hearing loss, haemoglobinuria paroxysmatica, hypogonadism, ileitis regionalis, leucopenia, mononucleosis infectiosa, traverse myelitis, primary idiopathic myxedema, nephrosis, ophthalmia symphatica, orchitis granulomatosa, pancreatitis, polyradiculitis acuta, pyoderma gangrenosum, Quervain's thyreoiditis, acquired spenic atrophy, non-malignant thymoma, vitiligo, toxic-shock syndrome, food poisoning, conditions involving infiltration of T cells, leukocyte-adhesion deficiency, immune responses associated with acute and delayed hypersensitivity mediated by cytokines and T-lymphocytes, diseases involving leukocyte diapedesis, multiple organ injury syndrome, antigen-antibody complex-mediated diseases, antiglomerular basement membrane disease, allergic neuritis, autoimmune polyendocrinopathies, oophoritis, primary myxedema, autoimmune atrophic gastritis, sympathetic ophthalmia, rheumatic diseases, mixed connective tissue disease, nephrotic syndrome, insulitis, polyendocrine failure, autoimmune polyglandular syndrome type I, adult-onset idiopathic hypoparathyroidism (AOIH), cardiomyopathy such as dilated cardiomyopathy, epidermolisis bullosa acquisita (EBA), hemochromatosis, myocarditis, nephrotic syndrome, primary sclerosing cholangitis, purulent or nonpurulent sinusitis, acute or chronic sinusitis, ethmoid, frontal, maxillary, or sphenoid sinusitis, an eosinophil- related disorder such as eosinophilia, pulmonary infiltration eosinophilia, eosinophilia- myalgia syndrome, Loffler's syndrome, chronic eosinophilic pneumonia, tropical pulmonary eosinophilia, bronchopneumonic aspergillosis, aspergilloma, or granulomas containing eosinophils, anaphylaxis, seronegative spondyloarthritides, polyendocrine autoimmune disease, sclerosing cholangitis, sclera, episclera, chronic mucocutaneous candidiasis, Bruton's syndrome, transient hypogammaglobulinemia of infancy, Wiskott-Aldrich syndrome, ataxia telangiectasia syndrome, angiectasis, autoimmune disorders associated with collagen disease, rheumatism, neurological disease, lymphadenitis, reduction in blood pressure response, vascular dysfunction, tissue injury, cardiovascular ischemia, hyperalgesia, renal ischemia, cerebral ischemia, and disease accompanying vascularization, allergic hypersensitivity disorders, glomerulonephritides, reperfusion injury, ischemic re-perfusion disorder, reperfusion injury of myocardial or other tissues, lymphomatous tracheobronchitis, inflammatory dermatoses, dermatoses with acute inflammatory components, multiple organ failure, bullous diseases, renal cortical necrosis, acute purulent meningitis or other central nervous system inflammatory disorders, ocular and orbital inflammatory disorders, granulocyte transfusion-associated syndromes, cytokine-induced toxicity, narcolepsy, acute serious inflammation, chronic intractable inflammation, pyelitis, endarterial hyperplasia, peptic ulcer, valvulitis, graft versus host disease, contact hypersensitivity, asthmatic airway hyperreaction, and endometriosis. Further aspects relate to the treatment or prevention microbial infection and / or use of microbial antigens. The microbial infection to be treated or prevented or antigen may be an antigen associated with any microbial infection known in the art or, for example, anthrax, cervical cancer (human papillomavirus), diphtheria, hepatitis A, hepatitis B, haemophilus influenzae type b (Hib), human papillomavirus (HPV), influenza (Flu), japanese encephalitis (JE), lyme disease, measles, meningococcal, monkeypox, mumps, pertussis, pneumococcal, polio, rabies, rotavirus, rubella, shingles (herpes zoster), smallpox, tetanus, typhoid, tuberculosis (TB), varicella (Chickenpox), and yellow fever. Further aspects and embodiments of the invention are described in the following examples. EXAMPLES EXAMPLE 1: GENERATION OF HUMAN PBMC-DERIVED MAIT CELLS As discussed below, embodiments of the invention comprise novel leukocyte expansion approaches (high yield and antitumor efficacy), that can be used to generate PBMC-derived MAIT cells and gene-engineered derivatives (PBMCMAIT cell products). The studies presented herein show the successful generation ofPBMCMAIT cells and derivatives. The engineering ofPBMCMAIT cells to additionally express additional exogenous molecules including Mesothelin CAR (PBMCMCAR-MAIT cell product) and Interleukin-15 (IL-15) (PBMCMCAR15-MAIT cell product) also proved successful. Pilot CMC, pharmacology, and efficacy studies were performed analyzing these cell products. Figures 2 –11 provide data from illustrative methods for the generation and evaluation of humanPBMCMAIT cells and derivatives. Key elements of this invention include: (1) PBMCMAIT cells can be isolated and expanded into large quantities using irradiated PBMCs+5-OP-RU or aAPC approach; (2) PBMCMAIT cells expanded using aAPC approach have much higher yield compared to using PBMCs +5-OP-RU approach; (3) PBMCMAIT cells expanded using aAPC approach upregulate NK receptors and have stronger antitumor properties compared to using PBMCs+5-OP-RU approach; and (4) PBMCMAIT cells can be gene-engineered to have improved functionalities then further expanded into large quantities. PBMCs can be isolated using a variety of conventional method, for example from the blood or the leukopak of human patients having a disease or disorder, or from the blood or the leukopak of healthy human donors. Illustrative Detailed description of a method for generatingPBMCMAIT cells Media The T cell Expansion Medium (T-Med) used forPBMCMAIT cell expansion was made of a base medium, including but not limited to, CTS OpTmizer, TexMACS, RPMI, DMEM, X-Vivo15, and supplemented with T cell supporting cytokines (e.g.,IL-2, IL-4, IL-7, IL-12, IL-15, IL-18, IL-21, TNF , TL-1A, SDF-1 , TGF- ), smallmolecules and additives (e.g., Wnt activators or glycogen synthase kinase-3 (GSK-3) inhibitors such as Wnt3A, CHIR99021, AR-A014418, TWS119, LY2090314, 9-ING- 41, lithium chloride (LiCl), BIO (6-bromoindirubin-3-oxime, 6-Bromoindirubin-3'- oxime, or tyrosine kinase inhibitors such as dasatinib, ibrutinib, acalabrutinib, and zanubrutinib, or caspase inhibitors such as Emricasan, Z-VAD-FMK, and Z-VKD- FMK). The cell culture approach can be serum-free and feeder-free.PBMCMAIT cell expansion PBMCMAIT cells are isolated from PBMCs via MR1-5-OP-RU tetramer staining followed by magnetic activated cell sorting (MACS). The isolatedPBMCMAIT cells are enriched from ~5% to over 90%, and are subjected to stimulation with MAIT TCR specific antigens (e.g., RL-6-Me-7-OH, 5-OP-RU, 5-OE-RU, 3-F-SA, 5-OH-DCF, NV18.1, DB28), TCR cognate antigens (e.g., proteins, peptides, lipids, phosphor- antigens, small molecules) or non-specific TCR stimulatory reagents (e.g., anti- CD3 / anti-CD28 antibodies or antibody-coated beads, Concanavalin A, PMA / Ionomycin, artificial APCs), and expanded for up to 1 month in T-Med medium supplemented with supporting cytokines and additives.PBMCMAIT cell derivatives In some embodiments,PBMCMAIT cells can be further engineered to express additional transgenes. In one embodiment, such transgenes encode disease targeting molecules such as chimeric antigen receptors (CARs), T-cell receptors (TCRs), and other native or synthetic receptor / ligands. In another embodiment, such transgenes can encode T cell regulatory proteins such as IL-2, IL-4, IL-7, IL-10, IL-12, IL-15, IL-18,IFN- , TNF- , TL1A, CD27, CD28, 4-1BB, OX40, ICOS, DAP10, dominant negative(DN) form of the TGF- receptor 2 (TGFBR2-DN). In another embodiment, suchtransgenes can encode transcription factors such as Bcl11b, Batf3, ThPOK, FOXP3, Runx3. In some embodiments,PBMCMAIT cells can be further engineered to disrupt selected genes using gene editing tools (CRISPR, TALEN, Zinc-Finger). In one embodiment, disrupted genes encode T cell immune checkpoint inhibitors (PD-1, CTLA-4, TIM-3, LAG-3, CD161). In another embodiment, disrupted genes encode Tcell regulatory proteins (e.g., TET2, PI3K / , DGK, DNMT3a, Suv39h1, TGFBR2,CBLB, SOCS1, SOCS2, SOCS3, CISH, FAS, REGNASE-1, PTPN2, CUL5). Deficiency of these negative regulatory genes may enhance the disease fighting capacity ofPBMCMAIT cells, making them resistance to disease-induced anergy and tolerance. In some embodiments,PBMCMAIT cells can be further engineered to make them suitable for allogeneic adoptive transfer, thereby suitable for serving as off-the-shelf cellular products. In one embodiment, genes encoding MHC molecules or MHC expression / display regulatory molecules [MHC molecules, B2M, CIITA (Class II transcription activator control induction of MHC class II mRNA expression)]. Lack of MHC molecule expression onPBMCMAIT cells makes them resistant to allogeneic host T cell-mediated depletion. In another embodiment, MHC class-I deficientPBMCMAIT cells will be further engineered to overexpress an HLA-C, HLA-E, HLA-G, and CD47 gene that will endow them resistant to host NK cell-mediated depletion. ThePBMCMAIT cell products and derivatives can be used freshly or cryopreserved for further usage. Embodiments of the invention have a number of novel features and advantages over conventional technologies. For example, as compared to the irradiated PBMCs and 5-OP-RU method of generatingPBMCMAIT cell products for cancer immunotherapy, embodiments of this invention offer a novel approach to expandPBMCMAIT cells with higher yield and enhanced antitumor properties. Unique features of this inventioninclude: (1) It expands PBMCMAIT cells with higher yield One PBMC leukopak cangenerate over 1011 PBMCMAIT cells, and can be potentially formulated 100-1,000 doses for patients; (2) The resultingPBMCMAIT cells have enhanced antitumor properties; and (3) The resultingPBMCMAIT cells can be engineered to express exogenous polypeptides such as CAR, and other molecules. EXAMPLE 2: GENERATION OF HUMAN HSC-DERIVED MAIT CELLS Materials Illustrative human MAIT TCR clones, sequences, and gene delivery vectors are described below. Human MAIT TCRs (referred to as MAIT TCR in this patent) were cloned from healthy donor peripheral blood mononuclear cells (PBMCs)-derived MAIT (PBMC- MAIT) cells. MAIT TCR sequences (amino acid sequences and gene coding sequences) are provided; MAIT TCR gene delivery vectors are also included. Methods Human MAIT cells can be generated through MAIT TCR gene-engineering of CD34+ HSCs, followed by ex vivo differentiation into transgenic MAIT cells. HSCs refer to human CD34+ hematopoietic progenitor and stem cells, that can be directly isolated from cord blood or G-CSF-mobilized peripheral blood (CB HSPCs or PBSCs), or derived from embryonic or induced pluripotent stem cells (ES-HSPCs or iPS- HSPCs). In addition to the antigen-specificity endowed by the monoclonal transgenic can be further engineered to express additional targeting molecules to enhance their disease-targeting capacity. Such targeting molecules can be Chimeric Antigen Receptors (CARs), natural or synthetic receptors / ligands, or others. The resulting CAR-MAIT cells can then be utilized for off- the-shelf disease-targeting cellular therapy. The production procedure includes 1) genetic modification of human CD34+ hematopoietic stem cells (HSCs) to express a selected TCR gene; 2) ex vivo differentiationHSCMAIT cells without feeder cells; and 3) ex vivo expansion of differentiatedHSCMAIT cells. Medias The Stage 1 Diff-T Medium (Diff-T M1) used for culturing CD34+ HSCs wasmade of base medium (e.g., Iscove s Modified Dulbecco s Medium, RPMI 1640,SFEMII, MEM) containing a serum-free supplement (e.g., recombinant human albumin, BIT 9500 serum substitute, B-27 supplement), Insulin-transferrin-selenium, 2-mercaptoethanol, Vitamin C (e.g., L-Ascorbic acid, L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate, and its other forms), human low density lipoproteins,IL-7, SCF, TPO, IL-3, IL-6, Flt3 ligand, SDF-1 , HSC self-renewal agonists (e.g.,UM171, UM729), aryl hydrocarbon receptor inhibitors (e.g., PD98059, BAY-218, StemRegenin 1, CH-223191), p38 MAPK inhibitors (e.g., Adezmapimod, Doramapimod, Losmapimod, SB202190). The Stage 2 Diff-T Medium (Diff-T M2) was made of base medium (e.g.,Iscove s Modified Dulbecco s Medium, RPMI 1640, SFEMII, MEM) containing aserum-free supplement (e.g., recombinant human albumin, BIT 9500 serum substitute, B-27 supplement), Insulin-transferrin-selenium, 2-mercaptoethanol, Vitamin C (e.g., L-Ascorbic acid, L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate, and its other forms), human low density lipoproteins, IL-7, SCF, Flt3 ligand, IL-2, IL-15, IL-21, TGF- , SDF-1 , HSC self-renewal agonists (e.g., UM171, UM729), arylhydrocarbon receptor inhibitors (e.g., PD98059, BAY-218, StemRegenin 1, CH- 223191), p38 MAPK inhibitors (e.g., Adezmapimod, Doramapimod, Losmapimod, SB202190). The Stage 3 T cell Expansion Medium (Diff-T M3) used for Diff-T cell expansion was made of a base medium, including but not limited to, CTS OpTmizer, TexMACS, RPMI, DMEM, X-Vivo15, and supplemented with T cell supportingcytokines (e.g., IL-2, IL-4, IL-7, IL-12, IL-15, IL-18, IL-21, TNF , TL-1A, SDF-1 ,TGF- ), small molecules and additives (e.g., Wnt activators or glycogen synthasekinase-3 (GSK-3) inhibitors such as Wnt3A, CHIR99021, AR-A014418, TWS119, LY2090314, 9-ING-41, lithium chloride (LiCl), BIO (6-bromoindirubin-3-oxime, 6- Bromoindirubin-3'-oxime, or tyrosine kinase inhibitors such as dasatinib, ibrutinib, acalabrutinib, and zanubrutinib, or caspase inhibitors such as Emricasan, Z-VAD-FMK, and Z-VKD-FMK). The cell culture approach can be serum-free and feeder-free. Stage 1 and Stage 2:HSCMAIT cell differentiation Fresh or frozen / thawed CD34+ HSCs are cultured in stem cell culture media (base medium supplemented with cytokine cocktails including IL-3, IL-7, IL-6, SCF, EPO, TPO, FLT3L) for 12-72 hours in flasks coated with retronectin, followed by addition of the TCR gene-delivery vector, and culturing for an additional 12-48 hours. TCR gene-modified HSCs are then differentiated intoHSCMAIT cells in Diff-T M1 and Diff-T M2 medium over a period of 4-10 weeks without feeders. Non-tissue culture-treated plates are coated with a Diff-T Culture Coating (Diff-Tc) Material (DLL-1 / 4, VCAM-1 / 5, retronectin). TCR gene-modified HSCs are suspended in a Diff- T M1 Medium and seeded into the Diff-Tc coated wells of a plate, and cultured for about 2 weeks. Diff-T M1 Medium is refreshed every 3-4 days. Cells are then collected and suspended in a Diff-T M2 Medium and seeded into the Diff-Tc coated wells of a plate, and cultured for another 2-8 weeks. Diff-T M2 Medium is refreshed every 3-4 days. Stage 3:HSCMAIT cell expansion DifferentiatedHSCMAIT cells are stimulated with MAIT TCR specific antigens (e.g., RL-6-Me-7-OH, 5-OP-RU, 5-OE-RU, 3-F-SA, 5-OH-DCF, NV18.1, DB28), TCR cognate antigens (e.g., proteins, peptides, lipids, phosphor-antigens, small molecules) or non-specific TCR stimulatory reagents (e.g., anti-CD3 / anti-CD28 antibodies or antibody-coated beads, Concanavalin A, PMA / Ionomycin, artificial APCs), and expanded for up to 1 month in Diff-T M3 medium supplemented with supporting cytokines and additives.HSCMAIT cell derivatives In some embodiments,HSCMAIT cells can be further engineered to express additional transgenes. In one embodiment, such transgenes encode disease targeting molecules such as chimeric antigen receptors (CARs), T-cell receptors (TCRs), and other native or synthetic receptor / ligands. In another embodiment, such transgenes can encode T cell regulatory proteins such as IL-2, IL-4, IL-7, IL-10, IL-12, IL-15, IL-18,IFN- , TNF- , TL1A, CD27, CD28, 4-1BB, OX40, ICOS, DAP10, dominant negative(DN) form of the TGF- receptor 2 (TGFBR2-DN). In another embodiment, suchtransgenes can encode transcription factors such as Bcl11b, Batf3, ThPOK, FOXP3, Runx3. Transgenes can be introduced into post-expansionHSCMAIT cells or their progenitor cells (HSCs, newly differentiatedHSCMAIT cells, in-expansionHSCMAIT cells) at various culture stages. In some embodiments,HSCMAIT cells can be further engineered to disrupt selected genes using gene editing tools (CRISPR, TALEN, Zinc-Finger). In one embodiment, disrupted genes encode T cell immune checkpoint inhibitors (PD-1, CTLA-4, TIM-3, LAG-3, CD161). In another embodiment, disrupted genes encode Tcell regulatory proteins (e.g., TET2, PI3K / , DGK, DNMT3a, Suv39h1, TGFBR2,CBLB, SOCS1, SOCS2, SOCS3, CISH, FAS, REGNASE-1, PTPN2, CUL5). Deficiency of these negative regulatory genes may enhance the disease fighting capacity ofHSCMAIT cells, making them resistance to disease-induced anergy and tolerance. In some embodiments,HSCMAIT cells or enhancedHSCMAIT cells can be further engineered to make them suitable for allogeneic adoptive transfer, thereby suitable for serving as off-the-shelf cellular products. In one embodiment, genes encoding MHC molecules or MHC expression / display regulatory molecules [MHC molecules, B2M, CIITA (Class II transcription activator control induction of MHC class II mRNA expression)]. Lack of MHC molecule expression onHSCMAIT cells makes them resistant to allogeneic host T cell-mediated depletion. In another embodiment, MHC class-I deficientHSCMAIT cells will be further engineered to overexpress an HLA-C, HLA-E, HLA-G, and CD47 gene that will endow them resistant to host NK cell-mediated depletion. TheHSCMAIT cell products and derivatives can be used freshly or cryopreserved for further usage. In addition, various intermediate cellular products generated during HSC-to-HSCMAIT cell culture can be paused for cryopreservation, stored and recovered for continued production. Embodiments of the invention have a number of novel features and advantages over conventional technologies. For example, as compared to the method of generatingHSCMAIT cells using a feeder-dependent culture (e.g., ATO culture), this invention offers an in vitro differentiation method that does not require feeder cells. This new method greatly improves the process for the scale-up production and GMP-compatible manufacturing of therapeutic cells for human applications. The cell products,HSCMAIT cells, display phenotypes / functionalities distinct from that of their native counterpart T cells as well as their counterpart T cells generated using other ex vivo culture methods (e.g., ATO culture method), makingHSCMAIT cells unique cellular products. Unique features of theHSC-MAIT cell differentiation culture include: (1) It is Ex Vivo and Feeder-Free; (2) It does not support TCR V / D / J recombination, so no randomly rearranged endogenous TCRs, thereby no GvHD risk; (3) It supports the synchronized differentiation of transgenicHSCMAIT cells, thereby eliminating the presence of un-differentiated progenitor cells and other lineages of bystander immune cells; (4) As a result, theHSCMAIT cell product comprises a homogenous and pure population of monoclonal TCR engineered T cells. No escaped random T cells, no other lineages of immune cells, and no un-differentiated progenitor cells. Therefore, no need for a purification step; (5) High yield! About 1013 HSCMAIT cells (10,000-100,000 doses) can be generated from PBSCs of a healthy donor, and about 1013 HSCMAIT cells (10,000-100,000 doses) can be generated from CB HSCs of a healthy donor; and 96) Unique phenotype ofHSCMAIT cells- transgenic TCR+ and endogenous TCR-CD3+. (Note: These unique features of theHSCMAIT cell differentiation culture distinct it from other methods to generate off-the-shelf T cell products, including the healthy donor PBMC-based T cell culture, the ATO culture, and the others.) The studies presented herein show the successful generation ofHSCMAIT cells and derivatives. Further engineering ofHSCMAIT cells to additionally express a Mesothelin CAR (HSCMCAR-MAIT cell product) and together with IL-15 (HSCMCAR15-MAIT cell product) were also proved successful. Pilot CMC, pharmacology, and efficacy studies were performed analyzing these cell products. Figure 12 – Figure 18: Generation and evaluation of humanHSCMAIT cells and derivatives. EXAMPLE 3: GENERATION OF HUMAN PSC-DERIVED MAIT CELLS Human MAIT cells can be generated through MAIT TCR gene-engineering of PSCs or PSC-derived CD34+ HSCs, followed by ex vivo differentiation into transgenicPSCMAIT cells. Human MAIT cells can also be generated through reprogramming mature MAIT cells into MAIT cell-reprogrammed induced PSC (MAIT-iPSC), followed by ex vivo differentiation intoPSCMAIT cells. Key elements of this invention include: (1) pluripotent stem cells (PSCs) are gene-engineered via an All-in-One engineering (AO-Engineering) strategy when all the desired gene modifications are integrated in a master PSC line, or via an Assembly- Line engineering (AL-Engineering) strategy when the desired gene modifications occur stepwise on the master PSC line as well as its progeny hematopoietic stem and progenitor cells (HSPCs or HSCs; both terms are alternatively used herein); (2) A selected monoclonal MAIT TCR is introduced as an endogenous MAIT TCR when a MAIT-iPSC line is used, while is introduced through a transgene when a non-MAIT- iPSC line is used; (3) PSCs are differentiated into highly pure CD34+ HSCs (suitable for cryopreservation) in a feeder-free / serum-free ex vivo culture, eliminating the necessity for CD34+ cell sorting using a novel differentiation method; (4) PSC-derived HSCs (fresh or cryo-recovered) are differentiated into mature CD8 single positive (SP)PSCMAIT cells in a feeder-free / serum-free ex vivo culture; (5) PSC-derived HSCs (fresh or cryo-recovered) are differentiated into mature CD4 SPPSCMAIT cells in a feeder- free / serum-free ex vivo culture; and (6) maturePSCMAIT cells can be further expanded in an ex vivo culture that is either feeder-free or feeder-dependent (e.g., using natural or artificial antigen presenting cells). ThePSCMAIT cell culture can be combined with HLA-I / II gene-editing and HLA-C / HLA-E / HLA-G / CD47 gene-engineering to produce HLA-I / II-negative HLA- C / HLA-E / HLA-G / CD47-positive UniversalPSCMAIT cells (U-PSCMAIT cells), that are suitable for allogeneic adoptive transfer and therefore can be utilized as off-the-shelf cellular product. TheU-PSCMAIT cell culture can be combined with RAG-I / RAG-II gene-editing to create RAG-negativeU-PSCMAIT cells. These cells prevent endogenous TCR recombination and are amenable to engineering with monoclonal transgenic TCRs. In addition to the antigen-specificity endowed by the monoclonal transgenic TCR,U-PSCMAIT cells can be further engineered to express additional targeting molecules to enhance their disease-targeting capacity. Such targeting molecules can beChimeric Antigen Receptors (CARs), other T cell receptors (TCRs), CD16 (FC RIII),natural or synthetic receptors / ligands, or others. The resultingU-PSCCAR-MAIT cells,U-PSCTCR-MAIT cells, orU-PSCX-MAIT cells can then be utilized for off-the-shelf disease-targeting cellular therapy. ThePSCMAIT cells and derivatives can also be further engineered to overexpress genes encoding T cell stimulatory factors, or to disrupt genes encoding T cell inhibitory factors, resulting in functionally enhancedPSCMAIT cells and derivatives. PSCs refer to human pluripotent stem cells, that can be embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs). iPSCs can be reprogrammed from MAIT cells (resulting in MAIT-iPSCs) or from non-MAIT cells such as CD34+ HSCs (resulting in HSC-iPSCs) and others (e.g., fibroblasts, T cells, NK cells, macrophages). Genetically engineered PSCs (as well as their derived HSCs) can be used to establish master cell banks, as an unlimited supply to generate the intended “off-the-shelf” MAIT cell products via Ex Vivo culture. Detailed description of thePSCMAIT cell culture method Stage 0: PSC master cell bank generation A PSC line is cultured in a suitable cell culture vessel (e.g., in Matrigel, or on laminin-coated plate) with serum-free PSC culture media (base medium supplementedwith cytokine cocktails including bFGF, TGF , FLT3L, Noggin, activin, Bio, LIF) for12-72 hours, followed by addition of the MAIT TCR gene-delivery vector, and culturing for an additional 1-7 days. After verification (and sorting and single cloning if needed), MAIT TCR gene-engineered PSC line is then used to establish master cell bank, that can be cryopreserved for storage or / and maintained in cell culture via passaging. Stage 1: PSC-to-HSC differentiation MAIT TCR gene-engineered PSC cells are gently dissociated to single cells (e.g., via cell dissociation reagent such as Accutase, Versene, or TrypLE) and then transferred to a suitable cell culture vessel (e.g., Ultra-Low Attachment plate or AggreWell) in HSC differentiation medium A containing a base medium (e.g., APELMedium, StemPro-34 SFM, Ham's F-12 Nutrient Mix, Iscove s Modified Dulbecco sMedium), GlutaMAX, Non-essential amino acids, Vitamin C (e.g., L-Ascorbic acid, L- Ascorbic acid 2-phosphate sesquimagnesium salt hydrate, and its other forms), Monothioglycerol, Transferrin, Activin A, BMP-4, bFGF, VEGF, supplemented with GSK3 Inhibitor / WNT Activators (e.g., Wnt3A, CHIR99021, AR-A014418, TWS119, LY2090314, 9-ING-41) and ROCK inhibitors (e.g., Y-27632, Thiazovivin, H-1152) for 12-48 hours to form embryoid bodies (EBs) or monolayers. Then the media is changed to fresh HSC differentiation medium A until day 3 to day 4. At day 3 to day 4, half medium is removed and replaced with HSC differentiation medium B containing a base medium (e.g., APEL Medium, StemPro-34 SFM, Ham's F-12 Nutrient Mix,Iscove s Modified Dulbecco s Medium), GlutaMAX, Non-essential amino acids,Vitamin C (e.g., L-Ascorbic acid, L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate, and its other forms), Monothioglycerol, human transferrin, heparin, a serum- free supplement (e.g., recombinant human albumin, BIT 9500 serum substitute, B-27supplement), TGF- inhibitors (e.g., SB431542, SB505124, SB525334, A 83-01), arylhydrocarbon receptor inhibitors (e.g., PD98059, BAY-218, StemRegenin 1, CH- 223191), BMP-4, bFGF, VEGF, SCF, TPO, Flt3 ligand, IL-3, IL-6, IL-11, IGF-1, IGF-2, EPO, SDF-1 , for 6-10 days. HSC differentiation medium B is refreshed every otherday. At the end of culture, the CD34+HSCs are harvested and cryopreserved. Stage 2: HSC-to-PSCMAIT cell differentiation MAIT TCR gene-engineered PSC-derived HSCs are then differentiated intoPSCMAIT cells in a differentiation medium over a period of 4-10 weeks without feeders. Non-tissue culture-treated plates are coated with Culture Coating Material (DLL-1 / 4, VCAM-1 / 5, Retronectin). CD34+HSCs are suspended in Expansion Mediumcontaining a base medium (e.g., Iscove s Modified Dulbecco s Medium, RPMI 1640,SFEMII, MEM), a serum-free supplement (e.g., recombinant human albumin, BIT 9500 serum substitute, B-27 supplement), Insulin-transferrin-selenium, 2- mercaptoethanol, Vitamin C (e.g., L-Ascorbic acid, L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate, and its other forms), human low density lipoproteins,IL-7, SCF, TPO, IL-3, IL-6, Flt3 ligand, SDF-1 , HSC self-renewal agonists (e.g.,UM171, UM729), aryl hydrocarbon receptor inhibitors (e.g., PD98059, BAY-218, StemRegenin 1, CH-223191), p38 MAPK inhibitors (e.g., Adezmapimod, Doramapimod, Losmapimod, SB202190), AKT inhibitors (e.g., Capivasertib,Ipatasertib, Idelalisib, AKT inhibitor VIII), NF- B inhibitors (e.g., BAY 11-7082,IKK16, BMS-345541 hydrochloride, TPCA-1, JSH-23) and other additives, seeded into the coated wells of a plate, and cultured for 12-14 days. Expansion Medium is refreshed every 3-4 days. Cells are then collected and suspended in Maturation Mediumcontaining a base medium (e.g., Iscove s Modified Dulbecco s Medium, RPMI 1640,SFEMII, MEM), a serum-free supplement (e.g., recombinant human albumin, BIT 9500 serum substitute, B-27 supplement), Insulin-transferrin-selenium, 2- mercaptoethanol, Vitamin C (e.g., L-Ascorbic acid, L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate, and its other forms), human low density lipoproteins,IL-7, SCF, Flt3 ligand, IL-2, IL-15, IL-21, TGF- , SDF-1 , HSC self-renewal agonists(e.g., UM171, UM729), aryl hydrocarbon receptor inhibitors (e.g., PD98059, BAY- 218, StemRegenin 1, CH-223191), p38 MAPK inhibitors (e.g., Adezmapimod, Doramapimod, Losmapimod, SB202190), and other additives, seeded into the coated wells of a plate, and cultured for another 14-28 days. Maturation Medium is refreshed every 3-4 days. Stage 3:PSCMAIT cell expansion DifferentiatedPSCMAIT cells are stimulated with MAIT TCR specific antigens (e.g., RL-6-Me-7-OH, 5-OP-RU, 5-OE-RU, 3-F-SA, 5-OH-DCF, NV18.1, DB28), TCR cognate antigens (e.g., proteins, peptides, lipids, phospho-antigens, small molecules) or non-specific TCR stimulatory reagents (e.g., anti-CD3 / anti-CD28 antibodies or antibody-coated beads, Concanavalin A, PMA / Ionomycin), with or without the presence of antigen-presenting cells (e.g., irradiated healthy donor PBMCs, artificial APCs), and expanded for up to 1 month in T cell culture media. The cell culture base media can be, including but not limited to, CTS OpTmizer, TexMACS, RPMI, DMEM, X-Vivo15. The cell culture approach can be serum-free and feeder-free. The culture can be supplemented with T cell supporting cytokines (e.g., IL-2, IL-4, IL-7, IL-12, IL-15, IL-18, IL-21, TNF , TL-1A, SDF-1 , TGF- ), small molecules and additives (e.g., Wnt activators or glycogen synthase kinase-3 (GSK-3) inhibitors such as Wnt3A, CHIR99021, AR-A014418, TWS119, LY2090314, 9-ING-41, lithium chloride (LiCl), BIO (6-bromoindirubin-3-oxime, 6-Bromoindirubin-3'-oxime, or tyrosine kinase inhibitors such as dasatinib, ibrutinib, acalabrutinib, and zanubrutinib, or caspase inhibitors such as Emricasan, Z-VAD-FMK, and Z-VKD-FMK, AKTinhibitors (e.g., Capivasertib, Ipatasertib, Idelalisib, AKT inhibitor VIII), NF- Binhibitors (e.g., BAY 11-7082, IKK16, BMS-345541 hydrochloride, TPCA-1, JSH- 23)). Add-On Step: CD4 induction At the end of the Stage 2 culture, when the developingPSCMAIT cells reach the CD4 / CD8 double-positive (DP) stage, they can be further prompted to transition into CD4 SPPSCMAIT cells by culturing them on a TARGETc-coated plate with CD4 inducer (CD4i) Medium. This specialized medium, comprising TARGETm Medium supplemented with T cell activation molecules such as anti-CD3 / CD28 / CD2 antibodies, anti-CD3 / CD28 / CD2 beads, TCR stimulating antigens, phorbol 12-myristate 13- acetate (PMA) and ionomycin, as well as phytohaemagglutinin (PHA), is employed for a period of 10-48 hrs to transiently activate the cells. Following this activation phase, the CD4i Medium is replaced with fresh TARGETm Medium, and the cells are cultured for an additional 2-7 days. The TARGETm Medium is replenished every 3-4 days. Add-On Step: THpolarization During stage 3 culture, differentiated CD4 SPPSCMAIT cells can also be further polarized into different subsets of CD4PSCMAIT cells, including TH1 (e.g., additionally add IL-12, IL-18, and anti-CD4 antibody), TH2 (e.g., additionally add IL-4 and anti-IFN- antibody), TH17 (e.g., additionally add TGF- , IL-1 , IL-6, IL-23, anti-IFN-antibody, and anti-CD4 antibody), and TREG (e.g., additionally add TGF- and All-transretinoic acid) cells .PSCMAIT cell derivatives In some embodiments, PSC master cell lines / banks and their derived HSCs as well asPSCMAIT cells can be further engineered to express additional transgenes. In one embodiment, such transgenes encode disease targeting molecules such as chimeric antigen receptors (CARs), T-cell receptors (TCRs), and other native or synthetic receptor / ligands. In another embodiment, such transgenes can encode T cell regulatoryproteins such as IL-2, IL-4, IL-7, IL-10, IL-12, IL-15, IL-18, IFN- , TNF- , TL1A,CD27, CD28, 4-1BB, OX40, ICOS, DAP10, dominant negative (DN) form of the TGF- receptor 2 (TGFBR2-DN). In another embodiment, such transgenes can encode transcription factors such as Bcl11b, Batf3, ThPOK, FOXP3, Runx3. Transgenes can be introduced into post-expansionPSCMAIT cells or their progenitor cells (HSCs, newly differentiatedPSCMAIT cells, in-expansionPSCMAIT cells) at various culture stages. In some embodiments, PSC master cell lines / banks and their derived HSCs as well asPSCMAIT cells can be further engineered to disrupt selected genes using gene editing tools (CRISPR, TALEN, Zinc-Finger). In one embodiment, disrupted genes encode T cell immune checkpoint inhibitors (PD-1, CTLA-4, TIM-3, LAG-3, CD161). In another embodiment, disrupted genes encode T cell regulatory proteins (e.g., TET2,PI3K / , DGK, DNMT3a, Suv39h1, TGFBR2, CBLB, SOCS1, SOCS2, SOCS3,CISH, FAS, REGNASE-1, PTPN2, CUL5). Deficiency of these negative regulatory genes may enhance the disease fighting capacity ofPSCMAIT cells, making them resistance to disease-induced anergy and tolerance. In some embodiments, PSC master cell lines / banks and their derived HSCs as well asPSCMAIT cells or enhancedPSCMAIT cells can be further engineered to make them suitable for allogeneic adoptive transfer, thereby suitable for serving as off-the- shelf cellular products. In one embodiment, genes encoding MHC molecules or MHC expression / display regulatory molecules [MHC molecules, B2M, CIITA (Class II transcription activator control induction of MHC class II mRNA expression)]. Lack of MHC molecule expression onPSCMAIT cells makes them resistant to allogeneic host T cell-mediated depletion. In another embodiment, MHC class-I deficientPSCMAIT cells will be further engineered to overexpress an HLA-C, HLA-E, HLA-G, and CD47 gene that will endow them resistant to host NK cell-mediated depletion. The gene-engineered PSC master cell lines / banks can be cryopreserved for storage, or maintained in culture via passaging; the PSC-derived HSCs can be used freshly or cryopreserved for future usage; thePSCMAIT cell products and derivatives can also be used freshly or cryopreserved for further usage. Moreover, various intermediate cellular products generated during PSC-to-PSCMAIT cell culture can be paused for cryopreservation, stored and recovered for continued production. Embodiments of the invention have a number of novel features and advantages over conventional technologies. Unique features of thePSCMAIT cell differentiation culture include, for example: (1) It is Ex Vivo and Feeder-Free; (2) No need to purify and sort CD34+ HSC after PSC to HSC differentiation because of high CD34+ purity; (3) It can generate human CD8 SP and CD4 SPPSCMAIT cells. The CD4 SPPSCMAIT cells can be further polarized into TH2PSCMAIT cells; (4) It has no risk of GvHD, becausePSCMAIT cells carry monoclonal MAIT TCR; (5) It supports the synchronized differentiation of transgenicPSCMAIT cells, thereby eliminating the presence of un- differentiated progenitor cells and other lineages of bystander immune cells; (6) As a result, thePSCMAIT cell product comprises a homogenous and pure population of monoclonal MAIT TCR-armed MAIT cells. No escaped random T cells, no other lineages of immune cells, and no un-differentiated progenitor cells. Therefore, no need for a purification step; (7) Unlimited supply of the source PSC to producePSCMAIT cells; and (8) Unique phenotype ofPSCMAIT cells- monoclonal MAIT TCR+random TCR-CD3+. The studies presented herein show the successful generation the successful generation ofPSCMAIT cells and derivatives. Further engineering ofPSCMAIT cells to additionally express a BCMA CAR (PSCBCAR-MAIT cell product) and together with IL-15 (PSC15BCAR-MAIT cell product) were also proved successful. Pilot CMC, pharmacology, efficacy, and safety studies were performed analyzing these cell products. SEQUENCES OF ILLUSTRATIVE EMBODIMENTS OF THE INVENTION pMNDW-MAIT TCR2 DNA sequenceTCR -F2A-TCRcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaa taaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggc attttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacat cgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgct atgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgag tactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataac actgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaact cgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaa caacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagt tgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggt atcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaa cgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagatt gatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgtt ccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaa aaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcg cagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctct gctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataag gcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacct acagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcgga acaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgag cgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggcctttt gctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctc gccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctcc ccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaat gtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaat ttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctgcaa gcttggccattgcatacgttgtatccatatcataatatgtacatttatattggctcatgtccaacattaccgccatgttgacattgattat tgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggc ccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttc cattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctatt gacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgt attagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaa gtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgcccca ttgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccggggtctctctggttag accagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagt agtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgc ccgaacagggacctgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacgg caagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgag agcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaatt aaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagac aaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgt gtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccacc gcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaag tagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtggga ataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcctcaatgacgctgacggtacaggccag acaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtct ggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttg ctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagattggaatcacacgac ctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaa gaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaatta ttcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcacc attatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagag acagagacagatccattcgattagtgaacggatctcgacggtatcgataagctaattcacaaatggcagtattcatccacaatttta aaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaat tacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagagatccagtttgggaattagcttgatcgatta gtccaatttgttaaagacaggatatcagtggtccaggctctagttttgactcaacaatatcaccagctgaagcctatagagtacga gccatagatagaataaaagattttatttagtctccagaaaaaggggggaatgaaagaccccacctgtaggtttggcaagctagg atcaaggttaggaacagagagacagcagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggc caagaacagttggaacagcagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaac agatggtccccagatgcggtcccgccctcagcagtttctagagaaccatcagatgtttccagggtgccccaaggacctgaaat gaccctgtgccttatttgaactaaccaatcagttcgcttctcgcttctgttcgcgcgcttctgctccccgagctcaataaaagagcc cacaacccctcactcggcgcgatctagatctcgaatcgaattcgccaccATGTGGGGTGTGTTTTTGTTGT ATGTGAGCATGAAGATGGGGGGGACCACGGGGCAAAATATTGACCAACCT ACCGAGATGACGGCCACGGAGGGCGCAATCGTACAGATCAACTGCACGTA CCAGACTTCCGGATTCAATGGACTGTTCTGGTACCAACAACACGCCGGGGA AGCGCCTACCTTTTTGAGCTATAACGTACTCGATGGGCTTGAGGAGAAAGG TCGGTTCTCCAGTTTTTTGTCCCGAAGTAAGGGCTACTCATATTTGCTCTTGA AGGAACTTCAGATGAAAGATTCCGCTTCCTACTTGTGCGCCgtgcgtGACTCAA ATTACCAACTGATATGGGGTGCAGGGACTAAGCTGATTATCAAGCCTgacatcc agaaccccgatcctgccgtgtaccagctgcgcgactctaagtctagcgataagagcgtgtgcctgttcaccgactttgatagcc agacaaacgtgagccagtctaaggactccgacgtgtacatcaccgacaagacagtgctggatatgaggagcatggacttcaa gagcaactccgccgtggcctggtccaataagtctgacttcgcctgcgccaatgcctttaacaattctatcatccctgaggatacct

[0003] GTGCGGATACGCAGTATTTCGGCCCAGGTACTCGACTTACCGTCCTCGAAG ACctgaataaggtgttcccccctgaggtggccgtgtttgagcccagcgaggccgagatctcccacacccagaaggccaccc tggtgtgcctggcaaccggcttctttcccgaccacgtggagctgtcctggtgggtgaacggcaaggaggtgcactccggcgtg tctacagacccccagcctctgaaggagcagcctgccctgaatgatagccggtactgcctgagctcccggctgagagtgtccgc caccttttggcagaacccacggaatcacttcagatgtcaggtgcagttttatggcctgtctgagaacgatgagtggacacagga cagggcaaagccagtgacccagatcgtgagcgccgaggcatggggaagagcagactgcggcttcacctccgtgtcttacca gcagggcgtgctgtccgccacaatcctgtacgagatcctgctgggcaaggccaccctgtatgccgtgctggtgtctgccctggt gctgatggccatggtgaagaggaaggatttttgaggatcccccggggtcgacaatcaacctctggattacaaaatttgtgaaag attgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatgg ctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgca ctgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctcccta ttgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtg ttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtccctt cggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcaga cgagtcggatctccctttgggccgcctccccgcctggaattaattcgagctcggtacctttaagaccaatgacttacaaggcagc tgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatctgctttttgctt gtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaag cttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtgg aaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaactt gtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggt ttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatcccgcccctaactccgccca gttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccaga agtagtgaggaggcttttttggaggcctaggcttttgcgtcgagacgtacccaattcgccctatagtgagtcgtattacgcgcgct cactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgcc agctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgcgacgcg ccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgccc gctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccg atttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttt tcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttt tgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatatt aacgtttacaatttcc (SEQ ID NO: ) Table 1: MAIT TCR CLONES FROM DONOR 1 H4 Table 2: MAIT TCR CLONES FROM DONOR 2 H5 Although the present disclosure and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the design as defined by the appended claims. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the process, machine, manufacture, composition of matter, means, methods and steps described in the specification. As one of ordinary skill in the art will readily appreciate from the present disclosure, processes, machines, manufacture, compositions of matter, means, methods, or steps, presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present disclosure. Accordingly, the appended claims are intended to include within their scope such processes, machines, manufacture, compositions of matter, means, methods, or steps. All patents and publications mentioned in the specification are indicative of the level of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. PATENTS AND PATENT APPLICATIONS U.S. Patent No.5,843,780 U.S. Patent No.6,200,806 U.S. Patent No.6,506,559 U.S. Patent No.6,573,099 U.S. Patent No.6,833,269 U.S. Patent No.7,029,913 U.S. Patent No.7,795,404 U.S. Patent No.8,021,867 U.S. Patent No.8,377,886 U.S. Patent No.8,628,767 U.S. Patent No.10,927,160 U.S. Patent Application Publication 2002 / 0168707 U.S. Patent Application Publication 2003 / 0159161 U.S. Patent Application Publication 2003 / 0022367 U.S. Patent Application Publication 2003 / 0051263 U.S. Patent Application Publication 2003 / 0055020 U.S. Patent Application Publication 2004 / 0014191 U.S. Patent Application Publication 2004 / 0265839 U.S. Patent Application Publication 2004 / 0064842 U.S. Patent Application Publication 2014 / 0369979 U.S. Patent Application Publication 2014 / 0242033 PCT Patent Application No. PCT / US94 / 09760 PCT Patent Application No.PCT / US94 / 08574 PCT Patent Application No.PCT / US94 / 10501 PCT Patent Application No. PCT / US2020 / 037486 PCT Patent Application No. PCT / US19 / 36786

Claims

CLAIMS What is claimed is:

1. A composition of gene-engineered matter comprising a polynucleotide encoding a T cell receptor (TCR) alpha chain polypeptide and / or beta chain polypeptide; wherein: the polynucleotide-encoded TCR recognizes the MR1 molecule; and the polynucleotide is part of the matter’s endogenous genome, or the polynucleotide is introduced into the matter as a transgene.

2. The composition of claim 1, wherein: the transgene encodes a TCR alpha chain polypeptide and / or beta chain polypeptide derived from a human mucosal-associated invariant T (MAIT) cell; and / or the transgene encodes a TCR alpha chain polypeptide and / or beta chain polypeptide comprising at least one polypeptide sequence shown in Table 1 or Table 2; and the transgene is introduced into the matter via a wide variety of gene delivery vectors (e.g., lentivector, retrovector, adenovector, AAV) and / or vector-free systems (e.g., CRISPR, TALEN, Zinc-Finger).

3. The composition of claim 1, wherein the matter is a gene-engineered human leukocyte.

4. The composition of claim 3, wherein the human leukocyte is a gene-engineered mucosal-associated invariant T (eMAIT) cell.

5. The composition of claim 2, wherein the transgene is introduced into the matter via a vector comprising a promoter selected for its ability to resist silencing in MAIT cells, and / or in CD34+ hematopoietic stem and progenitor cells (HSPCs or HSCs; both terms are alternatively used in this invention document), and / or in pluripotent stem cells (PSCs).

6. The composition of claim 5, wherein the promoter is an MNDU3 promoter, or a CAGpromoter, or an EF1 promoter, or a ubiquitin promoter.

7. The composition of claim 4, wherein the eMAIT cell comprises a transgenic polynucleotide encoding a polypeptide that stimulates T cells or disrupts T cell inhibitoryfactors, or / and comprises a disrupted endogenous polynucleotide encoding a polypeptide that inhibit T cells.

8. The composition of claim 4, wherein the eMAIT cell comprises a polynucleotide encoding a polypeptide comprising a further receptor.

9. The composition of claim 8, wherein the further receptor comprises a chimeric antigen receptor (CAR).

10. A method of making a gene-engineered mucosal-associated invariant T (eMAIT) cell product comprising: making an eMAIT cell product from human peripheral blood mononuclear cells (PBMCs); or making an eMAIT cell product from human CD34+ hematopoietic stem and progenitor cells (HSPCs or HSCs; both terms are alternatively used in this invention document); or making an eMAIT cell product from human pluripotent stem cells (PSCs).

11. The method of claim 10, wherein human MAIT cells are gene-engineered and expanded to make an eMAIT cell product in cell culture comprising: MAIT cells are isolated from human peripheral blood or cord blood; and the cell culture medium contains a MAIT TCR agonist antigen [e.g., 5-(2- oxopropylideneamino)-6-D-ribitylaminouracil (5-OP-RU), 5-(2-oxoethylideneamino)-6-D- ribitylaminouracil (5-OE-RU), 5-amino-6-ribitylamino-2,4-(1H,3H)-pyrimidinedione (5-A- RU)], and / or antigen-presenting cells [e.g., irradiated human PBMCs or artificial antigen presenting cells (aAPCs)], and / or T cell expansion factors (e.g., IL-2, IL-7, IL-15, IL-12, IL- 18).

12. The method of claim 10, wherein human CD34+ HSPCs are gene-engineered, differentiated, and expanded to make an eMAIT cell product in cell culture comprising: HSPCs are isolated from human cord blood or G-CSF mobilized peripheral blood; and the cell culture comprises Stage 0 that supports the HSPC maintenance and gene engineering, Stage 1 that supports the engineered HSPC expansion, Stage 2 that supports the eMAIT cell differentiation, Stage 3 that supports the eMAIT cell expansion, an optional “CD4-Induction Step” that can be added between the Stage 2 and Stage 3 cultures to enablethe generation of CD4 single-positive (CD4 SP) eMAIT cells, and another optional “TH- Polarization Step” that can be further added in Stage 3 culture to enable the generation of TH- polarized CD4 SP eMAIT cells.

13. The method of claim 10, wherein human PSCs are gene-engineered, differentiated, and expanded to make an eMAIT cell product in cell culture comprising: PSCs are embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs); and the cell culture comprises Stage 0 that supports the PSC maintenance and gene engineering, Stage 1 that supports the engineered PSCs differentiation into CD34+ HSPCs, Stage 2 that supports the optional further gene engineering, expansion, and differentiation of HSPCs into eMAIT cells, Stage 3 that supports the eMAIT cell expansion, an optional “CD4- Induction Step” that can be added between the Stage 2 and Stage 3 cultures to enable the generation of CD4 single-positive (CD4 SP) eMAIT cells, and another optional “TH- Polarization Step” that can be further added in Stage 3 culture to enable the generation of TH- polarized CD4 SP eMAIT cells.

14. The method of claim 10, wherein: all cell culture stages can be feeder-free and / or serum-free; or some culture stages can contain feeder cells (e.g., irradiated human donor PBMCs, or artificial antigen presenting cells, aAPCs); and / or the cell culture media can comprise a base medium supplemented with one or more factors selected to facilitate the eMAIT cell differentiation, expansion, and sublineage commitment; and / or all cell culture stages can achieve high purity, eliminating the need for in-process purification steps; and / or an eMAIT cell product or its intermediate cell product(s) can be cultured freshly or cryopreserved and then thawed for continued culture; and / or gene engineering can occur all at once at a single cell culture stage or stepwise at multiple cell culture stages (All-in-One vs Assembly-Line gene engineering strategy, or AO- Engineering vs. AL-Engineering strategy).

15. The method of claim 10, wherein an eMAIT cell product comprises a gene expression profile characterized as being at least one of: monoclonal MAIT TCR-positive CD3-postive,HLA-I / II-low / negative, expression of one or more immune modulatory transgene(s), and / or disrupted expression of one or more endogenous immune modulatory gene(s).

16. The method of claim 10, wherein (a) the immune regulatory transgene(s) delivered into an eMAIT cell product can encode any one or more of the following: immune targeting molecules (e.g., chimeric antigen receptors, CARs; T-cell receptors, TCRs; native or synthetic receptor / ligands), immuneregulatory molecules (e.g., IL-2, IL-4, IL-7, IL-10, IL-12, IL-15, IL-18, IL-21, IFN- , TNF- ,TL1A, CD27, CD28, 4-1BB, OX40, ICOS, DAP10, Bcl11b, Batf3, ThPOK, FOXP3, Runx3,dominant negative (DN) form of the TGF- receptor 2 (TGFBR2-DN)), immune allorejectionresistance molecules (e.g., HLA-C, HLA-E, HLA-G, CD47), and / or suicide control and imaging marker molecules (e.g., sr39TK, iCasp9, CD20); and (b) the endogenous gene(s) disrupted in an eMAIT cell product can encode any of the following: immune checkpoint molecules (e.g., PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, TIGIT, B7-H3 / B7-H4, BTLA, VISTA, NKG2A, A2aR, PVRIG, IDO, CD73, CD39, CD96,CD161), immune regulatory molecules (e.g., TET2, PI3K / , DGK, DNMT3a, Suv39h1,TGFBR2, CBLB, SOCS1, SOCS2, SOCS3, CISH, FAS, REGNASE-1, PTPN2, CUL5), or / and immune allorejection molecules (e.g., HLA-I / II, B2M, CIITA).

17. The method of claim 10, wherein all the desired gene modifications intended for a designated eMAIT cell product: (a) are performed at a single cell culture stage via an All-in-One engineering (AO- Engineering) strategy, or (b) are performed stepwise at multiple cell culture stages via an Assembly-Line Engineering (AL-Engineering) strategy, and / or (c) a single transgene or multiple transgenes can be incorporated into an eMAIT cell product via any of a wide variety of gene delivery vectors (e.g., lentivector, retrovector, adenovector, AAV) and / or vector-free systems (e.g., CRISPR, TALEN, Zinc-Finger), and / or (d) a single endogenous gene or multiple endogenous genes of an eMAIT cell product can be disrupted from expression via any of a wide variety of gene editing tools (e.g., CRISPR, TALEN, Zinc-Finger).

18. The method of claim 10, wherein: an eMAIT cell product produced by the methods described herein can be cryopreserved; and / or the cryo-recovered cell product can be stable at room temperature for at least one hour; and / or the cryo-recovered cell product is stable at room temperature for at least 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 24, 30, or 48 hours (or any derivable range therein); and / or a cell product contains a solution comprising dextrose, one or more electrolytes, albumin, dextran, and / or DMSO; and / or a cell product is in a solution that is sterile, nonpyogenic, and isotonic.

19. The method of claim 10, wherein a TARGET cell product can be used for treating patients: the patient has a cancer; and / or the patient has a viral, bacterial, fungal or parasitic infection; and / or the patient has a disease or condition involving inflammation, which, in some embodiments, excludes cancer; and / or the patient has an autoimmune disease or condition; and / or the eMAIT cell product is allogeneic with respect to the patient; and / or the patient does not exhibit signs of rejection or depletion of the eMAIT cells; and / or some therapeutic methods further include administering to the patient a stimulatory reagent that activates eMAIT cells, or a reagent that triggers the suicide gene kill-switch.

20. The method of claim 10, wherein the eMAIT cell product contains exogenous polynucleotide encodes at least one MAIT TCR polypeptide sequence shown in Table 1 or Table 2.

Citation Information

Cited By

  • Application of JSH-23 in expansion and / or function enhancement of human circulating hematopoietic stem / progenitor cells

    CN122128240A

  • Use of jsh-23 in the expansion and / or functional enhancement of human circulating hematopoietic stem / progenitor cells

    CN122128240B