Circular rna molecules of circovirus type 2, preparation of vaccines and use

Abstract

The application discloses a circular RNA molecule of type 2 circovirus, preparation and application of a vaccine, the vaccine comprising a circular RNA molecule encoding a Cap protein of type 2 circovirus and a pharmaceutically acceptable carrier. Further, the coding element of the circular RNA encodes a Cap truncated mutant protein. Further, the coding element encodes an optimized nucleotide sequence of the Cap truncated mutant protein. Further, the circular RNA is constructed and prepared through an optimized translation initiation element, an optimized intron element and an optimized insertion element. Research shows that the circular RNA provided by the application solves the problems of low virus neutralizing antibody level and inability to activate cellular immune response caused by using a wild type Cap protein and an RNA vaccine designed by a disclosed method; the vaccine preparation process can be scaled up industrially, the vaccine is good in effectiveness, safety and stability, and provides a basis for industrialized preparation and application of the type 2 circovirus RNA vaccine.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a circular RNA molecule of porcine circovirus type 2, the preparation and application of a vaccine, specifically to a circular RNA molecule encoding the Cap protein of porcine circovirus type 2 and the preparation and application of a vaccine; comprising a circular RNA encoding a truncated and mutant protein sequence of porcine circovirus type 2 Cap, linear RNA, recombinant plasmid, recombinant engineered Escherichia coli, and a method for preparing a circular RNA vaccine. Background Technology

[0002] Porcine circovirus type 2 (PCV2) infection causes porcine circovirus disease (PCVD), or "porcine circovirus type 2-related disease," which leads to decreased reproductive efficiency in breeding pigs, reduced growth performance in piglets, lower feed conversion ratios, and increased mortality. It is a significant economic disease causing substantial losses in pig farming. Currently, PCV2 is widespread in pig farms in my country, infecting domestic pigs of different ages and breeds. Infection damages the pig's immune system and can lead to secondary and concurrent infections with other pathogens.

[0003] Porcine circovirus type 2 (PCV2) is a non-enveloped, single-stranded, covalently circular DNA virus, 17–23 nm in diameter, with an icosahedral nucleocapsid structure. It has eight independent genotypes, with a gene size of 1766–1769 bp and 11 open reading frames (ORFs) in its genome. The proteins encoded by these ORFs range in size from 2 to 36 kDa, with ORF1 and ORF2 being the two main ORFs. ORF1 encodes the Rep and Rep' proteins, with a molecular weight of 35.8 kDa, and its main function is to participate in initiating viral replication. ORF2 encodes the Cap protein, with a molecular weight of 28 kDa, which is the virus's only structural protein and also its main antigenic protein.

[0004] Vaccination is currently an important means of preventing this disease. The vaccines that have been approved include whole-virus inactivated vaccines and genetically engineered subunit vaccines. Inactivated vaccines are prepared by treating PCV2 virus obtained from cell culture with physicochemical methods to make it lose its infectivity but retain its corresponding immunogenicity, and then adding adjuvants for emulsification. Genetically engineered subunit vaccines are prepared by expressing PCV2 Cap protein efficiently through genetic engineering methods such as prokaryotic or eukaryotic expression, extracting, purifying and inactivating Cap protein after high-density fermentation, and then emulsifying with an appropriate adjuvant. Vaccination has played an important role in the prevention and control of porcine circovirus type 2 in my country, but there are also some problems: (1) Using cell culture to produce viruses poses a risk of virus strain leakage and incomplete inactivation, which poses certain safety hazards. In addition, the requirements for quality control and process scale-up are high, and the production cost is high. (2) Using prokaryotic Cap protein expression is prone to forming inactive inclusion bodies, while using eukaryotic Cap protein expression has high yield and low cost, and the efficiency requirements for expression process are high. (3) With the selection of vaccines, the dominant genotypes of PCV2 that are prevalent are constantly changing, and vaccine products need to be rapidly iterated. Therefore, breakthroughs are still needed in the development of a novel circovirus type 2 vaccine that is more efficient, lower in cost, and easier to scale up.

[0005] RNA vaccines involve directly introducing RNA containing the encoded antigen protein into the body, where it is directly translated to express the target protein, thereby triggering a specific immune response. They have played a crucial role in the prevention of major respiratory infectious diseases in humans. Currently, the RNA used clinically or preclinically is mainly linear RNA. Compared to linear RNA, circular RNA molecules often have a longer half-life and better stability, showing significant promise for applications in protein expression and clinical treatment.

[0006] Currently, the most efficient technique for constructing circular RNA in vitro is the self-cleaving circularization system design technology (patent CN114574483A). The preparation process of circular RNA based on the self-cleaving circularization system is simpler and less expensive. It only involves circularization after transcription, eliminating the need for expensive capping and tailing enzymes for additional 5' cap and 3' polyadenylated tail modifications, and also avoiding the additional circularization process using T4 RNA ligase as is common in traditional circular RNA. Furthermore, it avoids introducing additional exon sequences into the circular RNA, improving the sequence accuracy of the circular RNA molecule.

[0007] There are currently no reports on the optimized design and application of circular RNA molecules from porcine circovirus type 2 (PCV2). Expression of the PCV2 Cap protein is a challenging area of ​​research. For example, its N-terminal amino acid sequence (positions 1-41) is a nuclear localization signal sequence rich in arginine, playing a crucial role in virus-like particle formation and immunogenicity. However, expression consumes more arginine, leading to decreased expression efficiency (doi: 10.1016 / j.ijbiomac.2022.07.204). Some studies have attempted to improve expression efficiency by removing the nuclear localization signal during expression design, performing complex codon optimization, or replacing the arginine in the nuclear localization signal with other amino acids (doi: 10.3389 / fmicb.2022.1077026), but the structure and immunogenicity of the Cap protein produced by these methods require further validation. Furthermore, virus-neutralizing antibodies and cellular immune responses are crucial for the immune protection against porcine circovirus and are positively correlated with viral clearance capacity (doi:10.1089 / vim.2005.18.333), while RNA vaccine design often fails to effectively elicit cellular immune responses (doi:10.1016 / j.vetmic.2020.108886). Therefore, the design of circular RNA vaccines against porcine circovirus type 2 needs to address the following issues: designing circular RNA molecules for porcine circovirus type 2 that can efficiently express the target protein in porcine somatic cells; ensuring efficient vaccine production processes that can be scaled up; ensuring the vaccine can induce high levels of humoral and cellular immune responses; and ensuring vaccine safety and stability. Summary of the Invention

[0008] The shortcomings of inactivated circovirus type 2 (PCV2) vaccines and genetically engineered subunit vaccines currently in clinical use are as follows: (1) Using cell culture to produce the virus poses risks of virus strain leakage and incomplete inactivation, resulting in certain safety hazards. Furthermore, high quality control and process scale-up requirements lead to high production costs. (2) Prokaryotic expression of the Cap protein easily forms inactive inclusion bodies, while eukaryotic expression of the Cap protein has high yield and low cost, requiring high efficiency in the expression process. (3) With vaccine immunization selection, the dominant PCV2 genotypes are constantly changing, necessitating rapid iteration of vaccine products. This invention provides a circular RNA molecule for PCV2, the preparation of a vaccine, and its application. This circular RNA molecule contains optimized coding elements for the PCV2 Cap protein and optimized translation initiation elements, solving the problems of low levels of virus-neutralizing antibodies and inability to activate cellular immune responses when using wild-type Cap protein and RNA molecules and vaccines designed using publicly available methods. Simultaneously, this invention provides a method for preparing a PCV2 circular RNA vaccine using the aforementioned circular RNA molecule, which employs optimized circular RNA molecules encoding the PCV2 Cap protein and optimized vaccine preparation processes. The vaccine process is highly efficient and can be scaled up; the vaccine has good efficacy, safety and stability, providing a foundation for the industrial preparation and application of porcine circovirus type 2 RNA vaccines.

[0009] Solution for solving the problem:

[0010] <Circular RNA>

[0011] This invention provides a circular RNA comprising a coding element encoding a polypeptide containing the Cap protein of porcine circovirus type 2 (PCV2). Further, among the Cap wild-type protein, Cap truncated protein, Cap mutant protein, and Cap truncated plus mutant protein, the coding element preferably encodes the Cap truncated plus mutant protein. The circular RNA of this invention can be prepared using a conventional PIE system or a clean PIE system.

[0012] In some embodiments, the coding element encodes the amino acid sequence of the circovirus type 2 Cap protein, which comprises the sequence shown in SEQ ID NO. 3, or has at least 90% sequence identity with the sequence shown in SEQ ID NO. 3, and has or partially has Cap protein activity.

[0013] In some embodiments, the coding element encodes any of the following: a 40-amino acid truncated N-terminus of the Cap protein of porcine circovirus type 2, a 16-amino acid truncated N-terminus, a 17-amino acid truncated N-terminus, RTIDYFQPNNKR(169-180) replaced with QGDRGVGSTAVILDDNFVT, containing mutant V166P, containing mutant V166A, containing mutant L167P, a 40-amino acid truncated N-terminus / containing mutant V166P, a 16-amino acid truncated N-terminus / containing mutant V166P, a 17-amino acid truncated N-terminus / containing mutant V166P, or wild-type Cap protein.

[0014] As a preferred embodiment, the coding element comprises an N-terminal truncated 16 amino acids / containing the mutant V166P and having an amino acid sequence as shown in SEQ ID NO.10.

[0015] In some embodiments, the coding element encodes a nucleotide sequence encoding the circovirus type 2 Cap protein that comprises the sequence shown in SEQ ID NO. 4, or has at least 90% sequence identity with the sequence shown in SEQ ID NO. 4, and encodes a polypeptide having or partially having the activity of the circovirus type 2 Cap protein.

[0016] In some embodiments, the coding element comprises a nucleotide sequence encoding any of the following: 40 amino acid truncated at the N-terminus of porcine circovirus type 2 Cap protein, 16 amino acid truncated at the N-terminus, 17 amino acid truncated at the N-terminus, RTIDYFQPNNKR(169-180) replaced with QGDRGVGSTAVILDDNFVT, containing mutant V166P, containing mutant V166A, containing mutant L167P, 40 amino acid truncated at the N-terminus / containing mutant V166P, 16 amino acid truncated at the N-terminus / containing mutant V166P, 17 amino acid truncated at the N-terminus / containing mutant V166P, wild-type Cap protein.

[0017] In some embodiments, the coding element comprises any one of the following: a nucleotide sequence as shown in SEQ ID NO.11, a nucleotide sequence 1 as shown in SEQ ID NO.12, a nucleotide sequence 2 as shown in SEQ ID NO.13, or a nucleotide sequence 3 as shown in SEQ ID NO.14.

[0018] In a preferred embodiment, the coding element comprises a nucleotide sequence 1 (SEQ ID NO. 12) encoding a 16-amino acid truncated N-terminus of the Cap protein of porcine circovirus type 2, containing the mutant V166P.

[0019] In some embodiments, the circular RNA of the present invention is prepared using a conventional PIE system, under which the circular RNA comprises elements arranged in the order shown in (a) or (b) below:

[0020] (a) Exon 1, Exon 2, 5' spacer, translation initiation element, coding element and 3' spacer;

[0021] (b) First exon, second exon, translation initiation element and coding element.

[0022] For the first exon, the second exon, the 5' spacer region, and the 3' spacer region, please refer to patent applications CN202011408937.4, CN202210200112.6 and CN202210200186.X, the entire contents of which are incorporated herein by reference.

[0023] In other embodiments, the circular RNA of the present invention is prepared using a clean PIE system, under which the circular RNA comprises elements arranged in the order shown in (c) or (d) below:

[0024] (c) Translate the start element and the encoding element;

[0025] (d) Translate the starting element, encoding element, and insertion element.

[0026] In some preferred embodiments, the circular RNA of the present invention is prepared using a clean PIE system, wherein the circular RNA comprises elements arranged in the order shown in (d) above. The clean PIE system for preparing circular RNA can be referenced to the contents shown in patents CN202210200112.6 and CN202210200186.X, the entire contents of which are incorporated herein by reference.

[0027] In some embodiments, the translation initiation element of the present invention can be any type of element capable of initiating the translation of coding elements in circular RNA.

[0028] In some specific embodiments, the translation initiation element of the present invention includes one or more sequences with translation initiation activity as shown below: IRES sequence, 5'UTR sequence, Kozak sequence, and sequences containing m 6 The sequence of A-modified (N(6)-methyladenosine modified) and the complementary sequence of ribosomal 18S rRNA.

[0029] In some preferred embodiments, the translation initiation element of the present invention comprises an IRES sequence. Exemplary examples include, but are not limited to, IRES sequences derived from Echovirus, Human poliovirus, Human Enterovirus, Coxsackievirus, Human rhinovirus, Canine picornavirus, Turdivirus 3, Hepatovirus, Passerivirus, Picornaviridae, Tremovirus A, Feline kobuvirus, Murine kobuvirus, Kobuvirus sewage Kathmandu, Ferret kobuvirus, Marmot kobuvirus, Humanparechovirus, Chicken picornavirus, Falcon picornavirus, Feline picornavirus, French Guiana picornavirus, and the like.

[0030] In some embodiments, the insertion element described in this invention can be used to regulate the transcription of recombinant nucleic acid molecules, to regulate the translation of circular RNA, to achieve specific expression of circular RNA in different tissues, or to purify circular RNA, etc.

[0031] In some specific embodiments, the insertion element of the present invention comprises one or more of the following sequences: untranslated region sequence, polyN sequence, aptamer sequence, ribosome switch sequence, and sequence for binding transcription regulatory factors; wherein, in the polyN sequence, N is selected from at least one of A, T, G, and C.

[0032] In some preferred embodiments, the insert element of the present invention comprises a polyAC sequence; preferably, the polyAC sequence comprises sequence A-polyAC as shown in SEQ ID NO.5 and sequence B-polyAC as shown in SEQ ID NO.25.

[0033] In some preferred embodiments, the circular RNA of the present invention has a nucleotide sequence as shown in any one of SEQ ID NO. 8-9, SEQ ID NO. 15-18, SEQ ID NO. 26, and SEQ ID NO. 29.

[0034] In some preferred embodiments, the circular RNA of the present invention has a sequence as shown in SEQ ID NO.26 or SEQ ID NO.29.

[0035] <linear RNA>

[0036] This invention provides a linear RNA that undergoes a self-cleavage reaction and then circularizes to form the aforementioned circular RNA. Accordingly, the linear RNA is also referred to as circularized precursor RNA.

[0037] In some embodiments, the linear RNA of the present invention is derived from a conventional PIE system, under which the linear RNA comprises elements arranged in the following order (e) or (f):

[0038] (e) 5' homologous arm, intron segment II, second exon, 5' spacer, translation initiation element, coding element, 3' spacer, first exon, intron segment I and 3' homologous arm;

[0039] (f) 5' homologous arm, intron segment II, second exon, translation initiation element, coding element, first exon, intron segment I and 3' homologous arm.

[0040] Linear RNA molecules with the above structure can utilize the ribozyme activity of class I introns to undergo a self-cleaving circularization reaction in vitro, yielding circular RNA. Specifically, under the initiation of GTP, the junction between the 5' intron and the first exon breaks; the ribozyme cleft in the first exon further attacks the junction between the 3' intron and the second exon, causing it to break, the 3' intron dissociates, and the first and second exons ligate to form circular RNA.

[0041] In other embodiments, the linear RNA of the present invention is derived from the clean PIE system, under which the linear RNA comprises elements arranged in the following order (g), (h), or (i):

[0042] (g) Intron fragment II, translation start element truncated fragment II, coding element, translation start element truncated fragment I, intron fragment I;

[0043] (h) Intended sub-fragment II, translation start element truncated sub-fragment II, coding element, insertion element, translation start element truncated sub-fragment I, intended sub-fragment I;

[0044] (i) Intron fragment II, translation start element truncated fragment II, coding element, polyAC, translation start element truncated fragment I, intron fragment I.

[0045] When linear RNA molecules with the above structure are used to prepare circular RNA, the ribozyme recognizes the junction of translation initiation element truncated fragment I (IRES fragment I) and intron fragment I, causing a break first and releasing intron fragment I; then the ribozyme recognizes the junction of translation initiation element truncated fragment II (IRES fragment II) and intron fragment II, causing a break and releasing intron fragment II. The 3' end of translation initiation element truncated fragment I and the 5' end of translation initiation element truncated fragment II are then joined to form a circular molecule.

[0046] In some preferred embodiments, the linear RNA of the present invention is derived from the clean PIE system, and the linear RNA comprises elements arranged in the order shown in (i) above.

[0047] In some specific embodiments, the translation initiation element truncated fragment II of the present invention comprises the sequence shown in any one of SEQ ID NO. 19, SEQ ID NO. 2, and SEQ ID NO. 27. In some specific embodiments, the translation initiation element truncated fragment I of the present invention comprises the sequence shown in any one of SEQ ID NO. 20, SEQ ID NO. 6, and SEQ ID NO. 28. The nucleotide sequence of translation initiation element truncated fragment I and the nucleotide sequence of translation initiation element truncated fragment II can be linked to obtain the translation initiation element sequence.

[0048] In some preferred embodiments, the translation initiation element truncated fragment II of the present invention is the sequence shown in SEQ ID NO.27; the translation initiation element truncated fragment I of the present invention is the sequence shown in SEQ ID NO.28.

[0049] In some specific implementations, the termination codon of the present invention is as shown in (TAA)x(TAG)y(TGA)z, where x+y+z≥1, x, y, and z are each an independent integer greater than or equal to 0, and the preferred sequence is TGA.

[0050] In some specific embodiments, the polyAC described in this invention is sequence A-polyAC as shown in SEQ ID NO.5 and sequence B-polyAC as shown in SEQ ID NO.25.

[0051] <Recombinant Nucleic Acid Molecules>

[0052] The present invention provides a recombinant nucleic acid molecule, which, after transcription, forms the above-mentioned linear RNA.

[0053] In some embodiments, the recombinant nucleic acid molecule of the present invention may include, in addition to the elements contained in the linear RNA described above, a regulatory sequence. For example, the regulatory sequence is the T7 promoter.

[0054] <Recombinant Escherichia coli engineered bacteria>

[0055] This invention provides a recombinant engineered Escherichia coli strain, which is obtained by transforming the above-mentioned recombinant nucleic acid molecule into E. coli.

[0056] <Nucleic Acid Lipid Nanoparticle Composition>

[0057] The present invention provides a nucleic acid lipid nanoparticle composition comprising lipid nanoparticles and the above-mentioned circular RNA.

[0058] By encapsulating the aforementioned circular RNA into lipid nanoparticles, the uptake efficiency of the circular RNA by the body can be improved, while the storage stability of the circular RNA is also enhanced, which helps in the development and application of porcine circovirus type 2 vaccines.

[0059] The present invention provides a circovirus type 2 vaccine comprising the above-mentioned circular RNA, wherein the circovirus type 2 vaccine comprises a circular RNA molecule encoding a truncated and mutant protein of circovirus type 2 and a pharmaceutically acceptable vector.

[0060] As one embodiment of the present invention, the amino acid sequence of the truncated and mutant protein of the porcine circovirus type 2 is shown in SEQ ID No. 10 or its degenerate sequence.

[0061] As one embodiment of the present invention, the optimized nucleotide sequence of the truncated and mutant protein of the porcine circovirus type 2 (PCV2) is shown in SEQ ID No. 12 or its degenerate sequence.

[0062] As one embodiment of the present invention, the nucleotide sequence of the circular RNA molecule is any one of the following: (SVDV-Cap-1221) as shown in SEQ ID NO.26, (SVDV2-Cap-1221) as shown in SEQ ID No.29.

[0063] As a preferred embodiment, the nucleotide sequence of the RNA molecule is shown in SEQ ID No. 29.

[0064] As one embodiment of the present invention, the circular RNA molecule encoding the Cap truncated and mutant protein of circovirus type 2 is formed by transcriptional circularization of vector DNA containing elements arranged in any of the following (1) to (2):

[0065] (1) Intron fragment II as shown in SEQ ID NO.1, translation initiation element truncated fragment II as shown in SEQ ID NO.27, coding element as shown in SEQ ID NO.12, polyAC as shown in SEQ ID NO.5, translation initiation element truncated fragment I as shown in SEQ ID NO.28, and intron fragment I as shown in SEQ ID NO.7;

[0066] (2) Intron fragment II as shown in SEQ ID NO.23, translation initiation element truncated fragment II as shown in SEQ ID NO.27, coding element as shown in SEQ ID NO.12, polyAC as shown in SEQ ID NO.25, translation initiation element truncated fragment I as shown in SEQ ID NO.28, and intron fragment I as shown in SEQ ID NO.24.

[0067] In a preferred embodiment, the linear RNA comprises the following elements: intron fragment II as shown in SEQ ID NO.23, translation initiation element truncated fragment II as shown in SEQ ID NO.27, coding element as shown in SEQ ID NO.12, polyAC as shown in SEQ ID NO.25, translation initiation element truncated fragment I as shown in SEQ ID NO.28, and intron fragment I as shown in SEQ ID NO.24.

[0068] In one embodiment of the present invention, the amount of circular RNA molecule (SVDV2-Cap-1221) in the porcine circovirus type 2 vaccine is 30-200 μg / vaccine. This includes 30-60 μg / vaccine, 60-90 μg / vaccine, 90-120 μg / vaccine, 120-150 μg / vaccine, 150-180 μg / vaccine, and 180-200 μg / vaccine; preferably 60-100 μg / vaccine.

[0069] As one embodiment of the present invention, the pharmaceutically acceptable carrier includes lipid nanoparticles.

[0070] As one embodiment of the present invention, the ratio of lipid nanoparticles to circular RNA molecules in the porcine circovirus type 2 vaccine is 1:1 to 1:3 (V / V).

[0071] As one embodiment of the present invention, the raw material composition of the lipid nanoparticles, by molar percentage, includes: 45%-55% cationic lipids, 35%-44% cholesterol, 3%-10% neutral lipids, and 0.8%-1.8% PEG-modified lipids.

[0072] As one embodiment of the present invention, the cationic lipid is CMAX4(4-[(3-{[3-({3-[bis(3-{4-[(2-butyloctanoyl)oxy]butoxy}-3-oxypropyl)amino]propyl}(methyl)amino)propyl](3-{4-[(2-butyloctanoyl)oxy]butoxy}-3-oxypropyl)amino}propoxy)oxy]butyl 2-octanoate) or SM-102(1-octylnonyl 8-[(2-hydroxyethyl)[6-O-6-(undecanoxy)hexyl]amino]-octanoate).

[0073] In one embodiment of the present invention, the cholesterol is 5-cholestyr-3β-ol.

[0074] As one embodiment of the present invention, the neutral lipid is DSPC (distearylphosphatidylcholine) or DOPE (dioleoylphosphatidylethanolamine).

[0075] As one embodiment of the present invention, the PEG-modified lipid is PEG-DMG (polyethylene glycol-dimyristate glyceryl ester), PEG-DSG (bis(distearate-rac-glycerol-polyethylene glycol)), or PEG-DPG (polyethylene glycol diphosphoglycerate).

[0076] As one embodiment of the present invention, the method for preparing the lipid nanoparticles, by molar percentage, includes: dissolving 45%-55% cationic lipids, 35%-44% cholesterol, 3%-10% neutral lipids, and 0.8%-1.8% PEG-modified lipids in ethanol.

[0077] In one embodiment of the present invention, the cationic lipid is CMAX4; the cholesterol is 5-cholestene-3β-ol; the neutral lipid is DSPC; the PEG-modified lipid is PEG-DMG; and the molar ratio of CMAX4:5-cholestene-3β-ol:DSPC:PEG-DMG is 45.9:42.4:9.2:1.5.

[0078] This invention also provides a method for preparing a porcine circovirus type 2 vaccine, the method comprising the following steps:

[0079] S1. The gene containing the truncated and mutant Cap protein of type 2 circovirus and the circular element was synthesized and cloned into a recombinant vector to obtain a recombinant vector containing the gene containing the truncated and mutant Cap protein of type 2 circovirus and the circular element.

[0080] S2. Transform or transduce the host with the recombinant vector containing the truncated Cap gene of porcine circovirus type 2 and the circular element obtained in step S1 to obtain a recombinant containing the recombinant vector.

[0081] S3. Cultivate the recombinants obtained in step S2 to prepare plasmids containing the truncated and mutant Cap protein gene of porcine circovirus type 2 and circular elements;

[0082] S4. Using the plasmid containing the truncated and mutant Cap protein gene of circovirus type 2 and the circular element obtained in step S3, a circular RNA encoding the truncated and mutant Cap protein of circovirus type 2 is prepared.

[0083] S5. The circular RNA encoding the truncated and mutant protein of circovirus type 2 virus Cap obtained in step S4 is added to a pharmaceutically acceptable vector to obtain the circovirus type 2 vaccine.

[0084] As one embodiment of the present invention, the ring-forming element of the present invention includes intronic sub-fragments I and II, translation initiation element, truncated sub-fragments I and II, and insertion element.

[0085] <Medical Uses>

[0086] The use of the above-mentioned circular RNA, linear RNA, recombinant nucleic acid molecules, recombinant engineered Escherichia coli, and / or nucleic acid lipid nanoparticle compositions (vaccines) provided by the present invention in the preparation of medicaments for the prevention and / or treatment of porcine circovirus type 2.

[0087] The present invention provides a method for preventing and / or treating porcine circovirus type 2, comprising administering to a subject an effective amount of the above-mentioned circular RNA, linear RNA, recombinant nucleic acid molecule and / or nucleic acid lipid nanoparticle composition; preferably, the administration is by injection.

[0088] Compared with the prior art, the present invention has the following beneficial effects:

[0089] 1) There are currently no reports of circovirus type 2 RNA vaccines. The circular RNA vaccine against circovirus type 2 prepared by this invention uses an optimized circular RNA molecule encoding a truncated and mutant protein of circovirus type 2, an optimized RNA preparation process, and an optimized vaccine preparation process. It has many advantages such as high efficiency, safety, and effectiveness.

[0090] 2) First, the present invention provides a preferred truncated and mutant protein sequence of the circovirus type 2 Cap protein (amino acid sequence see SEQ ID NO. 10) and a circular RNA molecule encoding the protein (number CKV-Cap-1047, nucleotide sequence see SEQ ID NO. 9). The vaccine corresponding to the preferred RNA molecule successfully increased the titer of circovirus type 2 neutralizing antibodies in mice.

[0091] 3) Further, for the Cap truncated and mutant protein, the present invention provides a preferred nucleotide sequence (see SEQ ID NO. 12) and a circular RNA molecule encoding the preferred nucleotide sequence (number CKV-Cap-1221, nucleotide sequence see SEQ ID NO. 15), which successfully increases the expression level and duration of the target protein in cells.

[0092] 4) Further, regarding the preferred nucleotide sequence of the truncated and mutant Cap protein (see SEQ ID NO. 12), this invention provides a circular RNA molecule (number SVDV-Cap-1221, nucleotide sequence see SEQ ID NO. 26) constructed using preferred translation initiation elements. Compared to vaccines corresponding to RNA molecules encoding wild-type Cap protein constructed using reported elements (number CKV-Cap-357), which failed to activate cellular immune responses and produced low levels of neutralizing antibodies, the vaccine corresponding to the preferred RNA molecule provided in this study successfully induced high levels of neutralizing antibodies and activated cellular immune responses.

[0093] 5) Further, regarding the preferred nucleotide sequence of the Cap truncated and mutant protein (see SEQ ID NO. 12), this invention provides a circular RNA molecule (numbered SVDV2-Cap-1221, nucleotide sequence of which is shown in SEQ ID NO. 29) prepared using a more preferred combination of elements (including a preferred translation initiation element, a preferred intron element, and a preferred insertion element). Compared with SVDV-Cap-1221, the total yield of the circular RNA molecule corresponding to SVDV2-Cap-1221 is increased, and the expression level of the target protein in porcine cells is further increased.

[0094] 6) Compared with commercial vaccines, injection of low-dose circular RNA vaccine (containing 80 μg of RNA per animal) can induce animals to produce high levels of virus-neutralizing antibodies and cellular immune responses.

[0095] 7) The circular RNA vaccine of porcine circovirus type 2 provided by the present invention is safe for use in piglets and sows.

[0096] 8) The circular RNA vaccine of type 2 circovirus prepared by the optimized process of this invention is stable after being stored at -20℃ for 6 months, providing a basis for the industrial preparation and application of vaccines. Attached Figure Description

[0097] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0098] Figure 1 A schematic diagram of the precursor sequence and the circular RNA sequence used to generate circular RNA of porcine circovirus type 2;

[0099] Figure 2 For the capillary electrophoresis analysis of RNA molecules in Example 4;

[0100] Figure 3 The titer of virus-neutralizing antibodies in the blood after vaccination in Example 3;

[0101] Figure 4 The content of PCV2-specific IFN-γ secreting cells in PBMCs after vaccination in Example 3;

[0102] Figure 5 The viral DNA content in the blood after vaccination and challenge in Example 3;

[0103] Figure 6 The changes in virus-neutralizing antibody titers in the blood after vaccination and challenge in Example 4;

[0104] Figure 7 The changes in the content of PCV2-specific IFN-γ secreting cells in PBMCs after vaccination and challenge in Example 4;

[0105] Figure 8 The changes in viral DNA content in the blood after vaccination and challenge in Example 4 are shown. Detailed Implementation

[0106] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. The following examples are implemented under the premise of the technical solution of the present invention, providing detailed implementation methods and specific operating procedures, which will help those skilled in the art to further understand the present invention. It should be noted that the scope of protection of the present invention is not limited to the following embodiments; any adjustments and improvements made under the concept of the present invention are all within the scope of protection of the present invention.

[0107] In this invention, the terms "a", "an", or "the" may refer to "one", "one or more", "at least one", or "one or more".

[0108] In this invention, the terms "comprising," "having," "including," or "containing" can mean included or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising," "having," "including," or "containing" can also mean closed-ended, excluding additional, uncited elements or method steps.

[0109] In this invention, the word "may" has two meanings: to perform a certain process and not to perform a certain process.

[0110] In this invention, "optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes both cases in which the event occurs and cases in which the event does not occur.

[0111] In this invention, the term "about" can mean that a value includes the standard deviation of the error of the apparatus or method used to determine that value. Unless otherwise expressly stated, it should be understood that all ranges, quantities, numerical values, and percentages used in this invention are modified by "about".

[0112] In this invention, the terms "polypeptide," "peptide," and "protein" are used interchangeably herein and refer to amino acid polymers of any length. The polymer may be linear or branched, may contain modified amino acids, and may be separated by non-amino acid segments. The term also includes amino acid polymers that have been modified (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with labeled components).

[0113] In this invention, the term "circular RNA" refers to an RNA molecule that is in a closed circular shape. The circular RNA used in this invention has protein translation activity and can also be referred to as "circular RNA".

[0114] In this invention, the term "linear RNA" refers to an RNA precursor capable of circularization to form circular RNA, which is generally transcribed from linear DNA molecules and is also known as "linear RNA".

[0115] In this invention, the term "linear RNA" refers to RNA with translational function that includes structures such as a 5' cap, a 3' polyA tail, a 5' untranslated region (5'UTR), a 3' untranslated region (3'UTR), and an open reading frame (ORF), and can also be called "linear RNA".

[0116] In this invention, the term "recombinant nucleic acid molecule" refers to a polynucleotide having a sequence that is not linked together in nature. Recombinant polynucleotides may be contained in a suitable vector, which can be used to transform into a suitable host cell. The polynucleotide is then expressed in the recombinant host cell to produce, for example, a "recombinant polypeptide," a "recombinant protein," a "fusion protein," etc. In this invention, the recombinant nucleic acid molecule comprises a coding element encoding a target polypeptide and a translation initiation element linked upstream of said coding element.

[0117] In this invention, the term "translation initiation element" refers to any sequence capable of recruiting ribosomes to initiate the translation process of RNA molecules. Exemplary examples include IRES sequences, m6A-modified sequences, or initiation sequences for rolling circle translation, etc.

[0118] In this invention, the term "IRES" (Internal Ribosome Entry Site) is also known as the internal ribosome entry site. An internal ribosome entry site (IRES) is a translation control sequence, typically located at the 5' end of the gene of interest, enabling cap-independent RNA translation. Transcribed IRES directly binds to ribosomal subunits, allowing the RNA start codon to be properly oriented within the ribosome for translation. The IRES sequence is typically located in the 5' UTR of the RNA (directly upstream of the start codon). IRES functionally replaces the need for various protein factors that interact with eukaryotic translation mechanisms.

[0119] In this invention, the term "expression" includes any step involved in polypeptide production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0120] In this invention, the terms "wild type" and "naturally occurring" are synonyms, referring to objects that can be found in nature and have not been modified by humans.

[0121] In this invention, the terms "variant" and "mutant" are used interchangeably and refer to a polynucleotide or polypeptide that contains altered (i.e., substituted, inserted, and / or deleted) nucleotides or amino acids at one or more (e.g., several) positions relative to the "wild-type" polynucleotide or polypeptide. Substitution refers to replacing a nucleotide / amino acid occupying a position with a different nucleotide / amino acid. Deletion refers to removing a nucleotide / amino acid occupying a position. Insertion refers to adding a nucleotide / amino acid adjacent to and immediately following the nucleotide / amino acid occupying the position.

[0122] In this invention, the terms "sequence identity" and "identity percentage" refer to the percentage of identical (i.e., the same) nucleotides or amino acids between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be determined by aligning the nucleotide or amino acid sequences of the polynucleotide or polypeptide and scoring the number of positions in the aligned polynucleotide or polypeptide containing the same nucleotide or amino acid residues, comparing this to the number of positions in the aligned polynucleotide or polypeptide containing different nucleotide or amino acid residues. Polynucleotides may differ at a position, for example, by containing different nucleotides (i.e., substitution or mutation) or deleted nucleotides (i.e., nucleotide insertion or deletion in one or two polynucleotides). Polypeptides may differ at a position, for example, by containing different amino acids (i.e., substitution or mutation) or deleted amino acids (i.e., amino acid insertion or deletion in one or two polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residues by the total number of amino acid residues in the polynucleotide or polypeptide. For example, the percentage of identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residues by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide and then multiplying by 100.

[0123] In this invention, the terms "individual," "patient," or "subject" include mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., human and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0124] In this invention, "treatment" means, after contracting a disease, exposing (e.g., administering medication) the RNA molecules described in this invention to a subject, thereby alleviating the symptoms of the disease compared to when not exposed, without implying the necessity of completely suppressing the symptoms. Contracting a disease means that the body exhibits symptoms of a disease.

[0125] In this invention, "prevention" means that before a subject develops a disease, by exposing the subject to the RNA molecules described in this invention, the probability of developing the disease is reduced and / or the symptoms after developing the disease are alleviated compared to when the subject is not exposed, and does not mean that it is necessary to completely suppress the disease.

[0126] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise specified, all units used in this specification are International Standard Units (SI), and all numerical values ​​and ranges appearing in this invention should be understood to include unavoidable systematic errors.

[0127] Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. All reagents or instruments without a specified manufacturer are commercially available, conventional products. Numerous specific details are provided in the following detailed embodiments to better illustrate the invention. Those skilled in the art should understand that the invention can be practiced even without certain specific details. In other embodiments, methods, means, equipment, and steps well-known to those skilled in the art are not described in detail in order to highlight the spirit of the invention.

[0128] Example 1: Design and amino acid sequence optimization of circular RNA of porcine circovirus type 2

[0129] Cap protein is the main antigenic protein on the surface of porcine circovirus particles. However, direct expression of wild-type Cap protein has problems such as low antigen expression level, poor immunogenicity, and decoy epitopes (reported sites include amino acids 169-180) that consume the body's immune resources, leading to insufficient effective immune response. In this study, we analyzed the spatial structure and antigenicity of porcine circovirus type 2 Cap protein using molecular dynamics, dominant B cell epitope prediction, and T cell epitope prediction methods, which helped us screen for the correct amino acid sequence for RNA vaccine molecules.

[0130] 1.1 Gene Design and Synthesis

[0131] The design of a circular RNA vector for the Cap protein of circovirus type 2 (PCV2) was based primarily on patent CN114574483A. The translation initiation element was obtained by mutating the G at position 80 of the Caprine kobuvirus IRES sequence to T, the A at position 81 to C, and the G at position 82 to T, resulting in a mutated sequence (numbered CKV). Specifically, each DNA vector contained the following elements along the 5' to 3' direction: intron fragment II, translation initiation element truncated fragment II (numbered CKV-II), protein-coding element, insertion element, translation initiation element truncated fragment I (numbered CKV-I), and intron fragment I. Among these:

[0132] The nucleotide sequence of intron fragment II (A-II) is shown in SEQ ID NO.1;

[0133] The nucleotide sequence of the translation initiation element truncated fragment II (CKV-II) is shown in SEQ ID NO.2;

[0134] The protein-coding element includes: a nucleotide sequence encoding the wild-type Cap protein of porcine circovirus type 2 (as shown in SEQ ID NO. 4) or one of the other 10 Cap protein mutants obtained through pre-screening (corresponding nucleotide information is shown in Table 1), and a stop codon (as shown in (TAA)x(TAG)y(TGA)z, where x+y+z≥1, x, y, and z are each independent integers greater than or equal to 0, and the stop codon is preferably TGA);

[0135] The nucleotide sequence of the insert element (A-polyAC) is shown in SEQ ID NO.5;

[0136] The nucleotide sequence of the translation initiation element truncated fragment I (CKV-I) is shown in SEQ ID NO. 6;

[0137] The nucleotide sequence of intron fragment I (AI) is shown in SEQ ID NO.7.

[0138] The vector DNA containing the above-mentioned elements and gene fragments is numbered as shown in Table 1. Linear RNA was transcribed from each vector DNA. The linear RNA further formed circular RNA according to the following mechanism: Ribozymes recognize the junction of translation initiation element truncated fragment I (IRES fragment I) and intron fragment I, resulting in a break and releasing intron fragment I; then, ribozymes recognize the junction of translation initiation element truncated fragment II (IRES fragment II) and intron fragment II, resulting in a break and releasing intron fragment II. The 3' end of translation initiation element truncated fragment I and the 5' end of translation initiation element truncated fragment II ligate to form a circular molecule (…). Figure 1 ).

[0139] The aforementioned gene fragment was synthesized by Suzhou Genewise Biotechnology Co., Ltd. and cloned into the pUC57 vector, and its correctness was verified by gene sequencing.

[0140] Table 1. Optimization of amino acid sequences for each DNA vector and Cap protein.

[0141]

[0142]

[0143] 1.2 Preparation of circular RNA

[0144] The DNA vector obtained in step 1.1 of this embodiment was prepared into circular RNA.

[0145] (1) Test methods

[0146] a) Strain preparation: The synthesized DNA vectors were transformed into DH5α competent cells and plated on LB agar plates containing 100 μg / ml ampicillin. The plates were incubated at 37°C. When the colonies on the plates were clearly visible, a single colony was picked and placed in 3 ml of LB liquid medium containing 100 μg / ml ampicillin. The culture was incubated at 37°C. 1 ml of the culture was taken and glycerol was added to a final concentration of 8%. The culture was then frozen at -80°C to obtain engineered bacteria, which were used as seeds for subsequent experiments.

[0147] b) Plasmid extraction: The externally constructed stab bacteria were activated at 37℃ / 220rpm for 3-4 hours; the activated bacterial solution was taken for large-scale culture under the following conditions: overnight culture with shaking at 37℃ / 220rpm; plasmid extraction was performed using a commercial kit (Tiangen endotoxin-free plasmid large-scale extraction kit).

[0148] c) Plasmid digestion and purification: The plasmid was digested with the restriction endonucleases BsaI (nearshore protein) / BsaI (Takara). The digestion system was as follows: 10× buffer: 100 μl, plasmid: 5 mg, BsaI: 150 μl (5000 U), water to a final volume of 1000 μl, digested overnight at 37°C. After digestion, the digestion products were purified by column chromatography using a commercial DNA recovery kit (TIANGEN) to obtain linearized plasmids.

[0149] d) In vitro transcription: The transcription system was prepared as shown in Table 2 below:

[0150] Table 2

[0151] 10× Reaction Buffer 2ml ATP (100mM) 2ml CTP (100mM) 2ml UTP (100mM) 2ml GTP (100mM) 2ml Linearized plasmid (1.5 mg / ml) 600μl T7 RNA polymerase (25 U / μl) 2ml RNase inhibitor (10 U / μl) 2ml Nuclease-free water Total 20ml

[0152] Reaction conditions: The reaction was carried out at 37℃ / 220rpm with constant temperature shaking for 2-4 hours. Then, 2 ml of deoxyribonuclease I (DNase I) was added to the transcription system and the reaction was carried out at 37℃ / 220rpm with constant temperature shaking for 15 minutes.

[0153] e) RNA precipitation of transcription products: Add LiCl solution to the transcription products obtained in a) above and place at -20℃ overnight for precipitation; centrifuge the overnight treated solution to obtain RNA precipitate, dry at room temperature and resuspend the precipitate in enzyme-free water to obtain an aqueous solution of linear RNA.

[0154] f) RNA cyclization and condensation: The cyclization system and conditions are shown in Table 3 below.

[0155] Table 3

[0156]

[0157] Mix the above solutions thoroughly and heat at 55°C for 15 minutes. Concentrate the circularized RNA product by ultrafiltration and discard the filtrate; transfer the ultrafiltered liquid to a new centrifuge tube.

[0158] g) HPLC purification of circular RNA: A certain amount of circular RNA was separated by passing it through a SEC-1000 (SEPAX) column in a 150mM phosphate buffer mobile phase, and the main peak components were collected.

[0159] h) Ultrafiltration concentration of purified circular RNA: Centrifuge the circular RNA tube through an ultrafiltration tube to concentrate it, and discard the filtrate; add enzyme-free water to the ultrafiltration tube, wash the circular RNA twice, and concentrate the circular RNA to the required concentration; transfer the ultrafiltered liquid to a new centrifuge tube.

[0160] (2) Test Results

[0161] Through the above process, various circular RNA molecules were successfully prepared (see Table 4). The nucleotide sequence of CKV-Cap-357 is shown in SEQ ID NO.8. The other groups were prepared by replacing the wild-type Cap protein nucleotide sequence of CKV-Cap-357 (see SEQ ID NO.4) with the nucleotide sequences of the mutant proteins in Table 1.

[0162] Table 4. Optimization of circular RNA molecules and amino acid sequences.

[0163]

[0164]

[0165] 1.3 In vitro expression validation

[0166] The circular RNAs prepared in step 1.2 of this embodiment were transfected into PK15 cells. After 48 hours of transfection, the antigens in the cell supernatant were quantitatively detected using a His-tagged ELISA kit to assess the expression and secretion of each circular RNA in each cell.

[0167] (1) Test methods

[0168] 1) Cell culture: PK15 cells were cultured at a rate of 1×10⁻⁶. 5 Cells were seeded per well in 24-well cell culture plates and cultured in DMEM high-glucose medium containing 10% fetal bovine serum and 1% penicillin-dextrose antibiotics at 37°C in a 5% CO2 incubator. Transfection was performed when cells reached 70% confluence.

[0169] 2) Cell transfection: Dilute 0.75-1.5 μL of MessengerMax (Thermo Fisher Scientific) to 25 μL with Opti-MEM (Thermo Fisher Scientific) per well and incubate at room temperature for 10 min. Dilute 0.5 μg of each circular RNA to 25 μL with Opti-MEM per well. Mix 25 μL of the prepared MessengerMax / Opti-MEM solution (incubated at room temperature) with 25 μL of the circular RNA / Opti-MEM solution at a 1:1 ratio and incubate at room temperature for 5 min.

[0170] Add 50 μL of the prepared mixed reagent to each 24-well cell culture plate and incubate at 37°C in a 5% CO2 incubator. Collect the cell supernatant after 48 hours of culture and freeze at -80°C.

[0171] The supernatant of PK15 cells that were not transfected with circular RNA was used as a negative control group (NC group).

[0172] 3) Antigen content detection using His-labeled ELISA kit: The antigen content in the cell supernatant from step 2) was quantitatively detected using the His-labeled ELISA kit (Nanjing Genscript Biotech Co., Ltd., catalog number L00436) according to the instructions.

[0173] (2) Test Results

[0174] The results are shown in Table 5. 24 h after transfection, except for CKV-Cap-1044, all other groups showed significant expression of the target protein.

[0175] Table 5 Cap protein expression validation / ng / ml

[0176] CKV-Cap-357 11.3 3.2 CKV-Cap-1043 19.4 6.9 CKV-Cap-1039 14.6 4.4 CKV-Cap-1044 3.7 1.1 CKV-Cap-1040 13.4 5.2 CKV-Cap-1045 10.5 5.2 CKV-Cap-1041 14.4 3.1 CKV-Cap-1046 13.4 3.8 CKV-Cap-1042 18.7 3.2 CKV-Cap-1047 26.4 4.2 Untransfected control 1.2 0.8 CKV-Cap-1048 25.9 5.1

[0177] 1.4 LNP-RNA Preparation

[0178] The circular RNA molecules obtained in step 1.3 were prepared into LNP-encapsulated RNAs using commercially available LNPs to prepare for further animal experiments.

[0179] (1) Test methods

[0180] The main reference for LNP-RNA preparation is doi: 10.1016 / j.cell.2022.03.044, and the specific process is as follows:

[0181] a) Dilute the circular RNA to a final concentration of 170 μg / mL using PNI preparation buffer (Precision NanoSystems, catalog number NWW0043).

[0182] b) On a NanoAssembler Ignite (Precision NanoSystems), commercial LNP (Precision NanoSystems, GenVoy-ILM) was mixed with circular RNA at a volume ratio of 1:3 using Ignite NxGenCartridge (Precision NanoSystems, catalog number NIT0002).

[0183] c) The buffer environment was replaced with PBS at pH 7.4 using tangential flow technology to remove ethanol, and LNP-RNA was prepared. After filtration, sterilization, and quantification, it was used for later use. A total of 10 experimental vaccines were obtained, numbered LNP / CKV-Cap-357, LNP / CKV-Cap-1039, LNP / CKV-Cap-1040, LNP / CKV-Cap-1041, LNP / CKV-Cap-1043, LNP / CKV-Cap-1044, LNP / CKV-Cap-1045, LNP / CKV-Cap-1046, LNP / CKV-Cap-1047, and LNP / CKV-Cap-1048.

[0184] d) Using Quant-iT TM RiboGreen TM RNA Assay Kit (Invitrogen) TM Encapsulation efficiency was determined using R11490. The particle size, PDI, and surface potential of LNP particles were measured using dynamic light scattering on a Malvern Zetasizer Nano-ZEN 3600 (Malvern) potential-laser particle size analyzer.

[0185] (2) Test Results

[0186] The LNP test results of the RNA prepared in this step are satisfactory: the particle size distribution is uniform (average 64 nm), the encapsulation efficiency is greater than 90%, the surface potential is electronegative, avoiding the cytotoxicity caused by the positive charge on the surface of the nanoparticles, and the biosafety is good.

[0187] 1.5 Mouse Immunization and Antibody Assay

[0188] (1) Experimental methods

[0189] Female BABL / c mice aged 6–8 weeks were randomly divided into 12 groups of 4 mice each. Eleven groups of LNP-encapsulated circular RNA vaccines prepared in step 1.4 of this embodiment were administered intramuscularly to the mice at a dose of 10 μg / mouse. Mice vaccinated with LNP served as negative controls. A booster immunization was performed 14 days post-immunization. Blood was collected on day 28 after the final immunization to separate serum, and the titers of porcine circovirus type 2 (PCV2) Cap protein IgG and virus-neutralizing antibodies were measured. The PCV2 Cap protein IgG titer was determined using the Porcine Circovirus type 2 Antibody test kit (BioCheck). The virus-neutralizing antibody titer was obtained using the Reed-Muench method, detailed in the reference (doi: 10.1089 / vim.2000.13.143).

[0190] (2) Experimental Results

[0191] The results are shown in Table 6. This study unexpectedly found that truncating the N-terminus of the Cap protein by 16 amino acids and including the mutant V166P (CKV-Cap-1047 group) effectively increased the titers of Cap protein IgG and neutralizing antibodies: compared with the control group (CKV-Cap-357 group), the Cap protein IgG antibody value increased by 5.2 times, and the viral neutralizing antibody titer increased by 2.7 times. Truncation of only 16 amino acids from the N-terminus of the Cap protein and including the mutant V166P upstream of the decoy epitope (169-180) may facilitate the decoy epitope's hiding within the protein during expression folding, while better preserving the virus-like particle structure, thereby increasing the neutralizing antibody titer.

[0192] The nucleotide sequence of the RNA molecule corresponding to the CKV-Cap-1047 group is shown in SEQ ID NO.9, the amino acid sequence of the protein encoded is shown in SEQ ID NO.10, and the nucleotide sequence of the protein encoded is shown in SEQ ID NO.11; the nucleotide sequence of the RNA molecule corresponding to the CKV-Cap-357 group is shown in SEQ ID NO.8, the amino acid sequence of the protein encoded is shown in SEQ ID NO.3, and the nucleotide sequence of the protein encoded is shown in SEQ ID NO.4.

[0193] Table 6 Antibody Response in Mice

[0194]

[0195] Example 2 Nucleotide Sequence Optimization

[0196] A protein can theoretically be encoded by countless nucleotides, making the selection of the optimal nucleotide sequence a challenge. This study analyzed the higher-order structure of RNA using methods such as molecular dynamics calculations, thus enabling the correct design of the nucleotide sequence encoding the target protein.

[0197] 2.1 Gene design and circular RNA preparation

[0198] The Cap protein truncated mutant obtained in Example 1 (16 amino acids truncated at the N-terminus and containing the mutant V166P, amino acid sequence shown in SEQ ID NO.10, nucleotide sequence shown in SEQ ID NO.11) was screened to obtain three nucleotide sequences: nucleotide sequence 1 (SEQ ID NO.12), nucleotide sequence 2 (SEQ ID NO.13), and nucleotide sequence 3 (SEQ ID NO.14). Corresponding DNA vectors were designed according to the method in step 1.1 of Example 1. Each DNA vector was synthesized and cloned by Suzhou Genewiz Biotechnology Co., Ltd., and corresponding circular RNAs were prepared according to the method in step 1.2 of Example 1 (see Table 7).

[0199] Table 7 Optimization of Circular RNA Molecules and Nucleotide Sequences

[0200]

[0201]

[0202] 2.2 In vitro expression validation

[0203] Circular RNA molecules were transfected into PK15 cells. On days 1, 2, 3, 4, and 5 after transfection, the antigens in the cell supernatant were quantitatively detected using a His-tagged ELISA kit to assess the persistence of expression and secretion of each circular RNA in each cell. The procedure is described in step 1.3 of Example 1.

[0204] The results are shown in Table 8. Compared with the control CKV-Cap-1047, CKV-Cap-1221 and CKV-Cap-1222 significantly improved the expression level and duration of the target protein. Among them, the CKV-Cap-1221 group showed the greatest improvement and was the preferred choice, indicating that it was effective for nucleotide optimization.

[0205] Table 8 Cap protein expression validation / ng / ml

[0206]

[0207] Example 3 Translation Start Element Optimization

[0208] Existing circular RNA molecules using preferred translation initiation elements include the Caprine kobuvirus IRES sequence (designated CKV in this invention). Circular RNAs containing these translation initiation elements are highly expressed in human cell lines (human alveolar basal epithelial cells A549 for lung cancer or human renal epithelial cell line 293T cells), but their effectiveness in porcine cells is unknown. Furthermore, there are at least thousands of known translation initiation elements, making it extremely difficult to select the optimal one. This study employed methods such as combinatorial libraries and site-directed mutagenesis libraries to analyze and compare translation initiation element sequences, thus finding a more suitable translation initiation element for the optimized circovirus type 2 Cap protein nucleotide sequence.

[0209] 3.1 Design of translation initiation elements and preparation of circular RNA

[0210] Candidate translation initiation elements (numbered PPV and SVDV, respectively) were obtained through pre-screening. Vector DNA was prepared according to the method in step 2.1 of Example 2, specifically by replacing the translation initiation element (numbered CKV) in the preferred circular RNA molecule (numbered CKV-Cap-1221, nucleotide sequence SEQ ID NO. 15) with candidate translation initiation elements (numbered PPV or SVDV) and further preparing circular RNA molecules (see Table 9).

[0211] Table 9 Optimization of circular RNA molecules and translation initiation elements

[0212]

[0213] The nucleotide sequence of translation initiation element truncated fragment II (PPV-II) is shown in SEQ ID NO.19;

[0214] The nucleotide sequence of the translation initiation element truncated fragment I (PPV-I) is shown in SEQ ID NO.20;

[0215] The nucleotide sequence of the translation initiation element truncated fragment II (SVDV-II) is shown in SEQ ID NO.27;

[0216] The nucleotide sequence of the translation initiation element truncated fragment I (SVDV-I) is shown in SEQ ID NO.28;

[0217] To compare the effects of the circular RNA prepared in this study with molecules constructed using commercially available circular RNA elements, a control circular RNA molecule (cRNA-Cap-1221) was prepared using a circular RNA cloning kit (Shanghai Keweichuang). This molecule encodes a truncated mutant protein of porcine circovirus type 2 (nucleotide sequence shown in SEQ ID NO. 12). For specific methods, please refer to the kit instructions.

[0218] 3.2 LNP-RNA Preparation

[0219] The circular RNA molecules prepared in this embodiment were used to prepare lipid nanoparticle / RNA compositions using commercially available LNPs, as detailed in step 1.4 of Example 1. This yielded LNP-encapsulated CKV-Cap-1221, LNP-encapsulated PPV-Cap-1221, LNP-encapsulated SVDV-Cap-1221, and LNP-encapsulated cRNA-Cap-1221. The results met the requirements: the LNPs encapsulating RNA in each group had a uniform particle size distribution and an encapsulation efficiency greater than 90%; the surface potential was electronegative, avoiding cytotoxicity caused by positively charged nanoparticles, and demonstrating good biocompatibility.

[0220] 3.3 Animal Immunization and Efficacy Evaluation

[0221] Thirty weaned piglets aged 4–6 weeks (negative for porcine circovirus type 2 antigen) were divided into 6 groups of 5 piglets each and vaccinated via the neck muscle. After initial dosage adjustments, the RNA vaccine dosage was initially set at 100 μg / piglet in this experiment.

[0222] Group 1: Inoculated with LNP-wrapped CKV-Cap-1221, immunization dose 100μg / animal.

[0223] Group 2: Inoculated with LNP-wrapped CKV-Cap-357, immunization dose 100μg / animal.

[0224] Group 3: Inoculated with LNP-coated PPV-Cap-1221, immunization dose 100μg / animal.

[0225] Group 4: Inoculated with LNP-wrapped SVDV-Cap-1221, immunization dose 100μg / animal.

[0226] Group 5: Inoculated with LNP-packaged cRNA-Cap-1221, immunization dose 100μg / animal;

[0227] Group 6: Inoculated with sterile PBS, immunization dose 1ml / animal.

[0228] The RNA group was boosted with the same dose on day 14 (day 14) after the primary immunization (day 0), and the commercial vaccine was administered according to the instructions. Challenge was performed 28 days post-vaccination (day 42). Serum samples were collected on days 7 (day 49), 14 (day 56), 21 (day 63), 42 (day 84), and 70 (day 112) post-challenge to measure viral DNA load and assess the preventive effect against viral infection. Serum samples were also collected on days 7 (day 0), 14 (day 14), 42 (day 42), 70 (day 112) post-challenge to measure virus-neutralizing antibodies and the level of PCV2-specific IFN-γ secreting cells in PBMCs to assess humoral and cellular immune responses.

[0229] The viral challenge procedure was referenced in (Development and Immunoefficacy Evaluation of Porcine Circovirus Type 2 Inactivated Vaccine (YZ Strain) [D], 2017); the viral DNA content in the blood was determined by quantitative real-time PCR, with the procedure referenced in (doi: 10.1089 / vim.2014.0121), upstream primer: TTAGTCTTC CAATCACGCTTCTGC (see SEQ ID NO.21), downstream primer: ACGGAGTGACCTGTCTACTGCTG (see SEQ ID NO.22); the viral neutralizing antibody titer was determined by Reed-Muench. The calculation method was the same as step 1.5 in Example 1. The content of PCV2-specific IFN-γ secreting cells was detected by the ELISPOT method, and the operation was referenced in (PMID:28725106). The stimulating antigen was the PCV2 Cap protein peptide pool (composed of 15 mes of 11 overlapping amino acids, spanning the entire PCV2 Cap protein, with a peptide purity of over 85%, synthesized and provided by Shenlian Biotechnology). All results are expressed as mean values.

[0230] See results Figures 3-5 Compared with the PBS group, the CKV-Cap-357 and cRNA-Cap-1221 groups induced lower neutralizing antibodies and almost failed to elicit a cellular immune response, while the SVDV-Cap-1221, PPV-Cap-1221, and CKV-Cap-1221 groups successfully increased neutralizing antibody titers. Figure 3 ), and increase the number of PCV2-specific IFN-γ secreting cells per unit PBMC ( Figure 4 ), and reduce viral DNA load in the blood ( Figure 5This indicates successful activation of humoral and cellular immune responses and effective prevention of viral infection; the SVDV-Cap-1221 group was superior, significantly outperforming other groups in stimulating IFN-γ secretory cell levels, indicating a stronger cellular immune response. According to the literature (doi:10.1089 / vim.2005.18.333), virus-neutralizing antibodies and cellular immune responses are crucial for immune protection and are positively correlated with the ability to clear porcine circovirus. This study optimized and obtained circular RNA molecules, providing a foundation for the development of a porcine circovirus type 2 circular RNA vaccine.

[0231] Example 4: Design, optimization, and preparation of a porcine circovirus type 2 RNA vaccine

[0232] 4.1 Vector DNA Design and Construction

[0233] Different vector DNA plasmids were designed to target the Cap protein of porcine circovirus type 2 (see Table 10). The vector DNA contains circular elements arranged in the following order along the 5' to 3' direction: intron fragment II, translation initiation element truncation fragment-II, protein-coding element, insertion element, translation initiation element truncation fragment-I, and intron fragment I.

[0234] Table 10 Vector DNA Design and Construction

[0235]

[0236] Among them, intron II (numbered B-II), intron I (numbered BI), and inserted element (B-polyAC) were obtained through design optimization screening, and the specific information is as follows:

[0237] The nucleotide sequence of intron fragment II (numbered B-II) is shown in SEQ ID NO.23.

[0238] The nucleotide sequence of intron fragment I (number BI) is shown in SEQ ID NO.24.

[0239] The nucleotide sequence of the insert element (B-polyAC) is shown in SEQ ID NO.25.

[0240] The aforementioned gene was synthesized and cloned by Suzhou Genewise Biotechnology Co., Ltd. The resulting gene fragment was ligated into the BsaI restriction site of the pUC57 vector, and the correctness was verified by gene sequencing.

[0241] 4.2 Construction of recombinant bacteria

[0242] 4.2.1 Construction of the original seed. The vector DNA molecules pSVDV-Cap-1221 and pSVDV2-Cap-1221 were transformed into E. coli DH5α competent cells, respectively, and plated on LB agar plates containing the corresponding antibiotic (100 μg / ml ampicillin). The plates were incubated at 37°C. When the colonies on the plates were clearly visible, a single colony containing a high copy number of plasmid was picked and placed in 3 ml of liquid LB agar containing the corresponding antibiotic (100 μg / ml ampicillin). The culture was incubated at 37°C. 1 ml of the bacterial culture was taken and glycerol was added to a final concentration of 8%. The culture was then frozen at -80°C to obtain recombinant engineered bacteria (numbered b-pSVDV-Cap-1221 and b-pSVDV2-Cap-1221, respectively), which served as the original seed bank.

[0243] 4.2.2 Identification of the original seeds.

[0244] (1) Morphology and biochemical characteristics: The engineered bacteria are Gram-negative short rods. They can ferment and decompose glucose, producing acid and gas; the indole test and methyl red test are both positive; the Voges-Proskauer test (VP test) and citrate test are both negative.

[0245] (2) Culture characteristics: When grown on LB solid medium, it forms smooth colonies that are round, with neat edges, raised, milky white and shiny.

[0246] (3) Purity test: The test was conducted according to the purity test method in the appendix of the Pharmacopoeia of the People's Republic of China, and the result was pure.

[0247] (4) Identification: Sequencing analysis was performed, and the nucleotide sequence was consistent with the target sequence.

[0248] 4.3 Fermentation of recombinant bacteria

[0249] Strains b-pSVDV-Cap-1221 and b-pSVDV2-Cap-1221 were inoculated into 500 mL of LB medium containing the corresponding antibiotic (100 μg / mL ampicillin). The culture was incubated with shaking at 28–32 °C until the OD600 value reached approximately 2.0–4.0. Then, at an inoculation rate of 0.5–3%, the seed culture was transferred to a 5 L fermenter for fermentation. When the OD600 value of the bacterial cells reached approximately 80–100, the wet weight of the bacterial cells was collected by centrifugation, approximately 1000 g.

[0250] 4.4 Plasmid DNA Preparation and Testing

[0251] 4.4.1 Cell lysis

[0252] (1) Take 200g of Escherichia coli fermentation cells harvested in step 4.3, add 1.6L of Solution I stored at 4℃ at a mass-to-volume ratio of 1:8 between the cells and Solution I (50mM Tris-HCl, 10mM EDTA, pH 8.0), and stir until dissolved.

[0253] (2) After dissolving, add 1.6L of solution II (0.2M NaOH, 1.0% SDS), stir slowly, and then let it stand to react for 3-10 minutes.

[0254] (3) After the reaction is complete, add 1.6L of solution III (3M KAC, pH 5.5, pre-cooled at 4℃), shake well, and let stand for 30 minutes to react.

[0255] (4) After the reaction is complete, add 1.6 L of 2M CaCl2 solution, shake gently, and let stand for 1 h to react. The pyrolysis solution will be divided into two layers, with the upper layer being solid and the lower layer being liquid. The liquid will be pumped out and filtered through a filter cartridge with a pore size of 1.0 μm to remove impurities.

[0256] 4.4.2 Ultrafiltration Concentration

[0257] The lysate was separated by a Quickstand ultrafiltration system using a 300 kDa hollow fiber ultrafiltration membrane (GE Healthcare Life Science, USA, membrane area 850 cm²). 2 The membrane fiber tube (1 mm in diameter) is filtered, and the membrane negative pressure (TMP) is 1 psi. The operation time is 1.5 h, and the concentration factor is 5-10 times the volume.

[0258] 4.4.3 Ion Exchange Chromatography

[0259] plasmids were purified using AKTA purifier TM Purification was performed using a 100 purification system, Capto TM DEAE (GE Healthcare Life Science, USA) was used to purify the plasmid. Before purification, the column was equilibrated with 5 column volumes of washing buffer (0.55M NaCl, 50M Tris-HCl, 10M EDTA, pH 8.0). After loading the sample, the column was washed with washing buffer (0.55M NaCl, 50M Tris-HCl, 10M EDTA, pH 8.0). Then, the column was eluted with a gradient of elution buffer (0.65M NaCl, 50M Tris-HCl, 10M EDTA, pH 8.0), and the eluted sample was collected. The column was then regenerated by washing with CIP (2M NaCl, 0.5M NaOH) and equilibrated with equilibration buffer.

[0260] 4.4.4 Gel Filtration Chromatography

[0261] First Capto TM The Core 700 (GE Healthcare Life Science, USA) column was equilibrated for three column volumes with PBS (NaCl 8.5 g / L, Na2HPO4·12H2O 2.9 g / L, KH2PO4 0.25 g / L, pH 7.4). The sample purified and collected via the ion exchange column was then loaded onto the Capto column. TM After loading the sample into the Core 700, elute with PBS and collect the eluted sample.

[0262] 4.4.5 Ultrafiltration and Percolation

[0263] The 100 kDa hollow fiber ultrafiltration membrane (GE Healthcare Life Science, USA, membrane area 500 cm²) was used in the Quickstand ultrafiltration system for separation. 2 (Membrane fiber tube diameter 1mm) Concentration and percolation, with a membrane negative pressure (TMP) of 1psi, concentration ratio of 5-10 times volume, and percolation ratio of 4-12 times.

[0264] 4.4.6 Plasmid DNA yield and efficiency / Impurity removal effect

[0265] For plasmid DNA (pSVDV2-Cap-1221), in accordance with the "Technical Guidelines for Preclinical Research of Preventive DNA Vaccines", the plasmid DNA concentration was determined by spectrophotometry, bacterial endotoxin residues were detected by Limulus amebocyte lysate (LAL) gel electrophoresis, RNA residues were detected by agarose gel electrophoresis, and protein residues were tested by the BCA method to confirm the process.

[0266] By optimizing the culture medium and conditions, the *E. coli* DH5α strain was cultured on a large scale to obtain bacterial cells. A lysis method was used, with the addition of calcium chloride to remove large RNA and protein impurities, yielding a crude plasmid DNA extract. Ultrafiltration and chromatography were then used to further remove impurities.

[0267] The quality inspection results are shown in Table 11. For the pSVDV2-Cap-1221 plasmid, using the optimized process, the yields of lysis, ultrafiltration concentration, ion exchange chromatography, gel filtration chromatography, and ultrafiltration percolation reached 82%, 91%, 92%, 93%, and 82%, respectively, with a total yield of 52.4%. The production process meets the requirements.

[0268] Table 11 Plasmid DNA Yield (pSVDV2-Cap-1221)

[0269]

[0270] 4.4.7 Plasmid testing

[0271] The plasmids (pSVDV-Cap-1221 and pSVDV2-Cap-1221) were tested according to the Analytical Procedures for mRNA Vaccine Quality 2nd USP, and all indicators met the requirements.

[0272] (1) Identification: The plasmid was sequenced and analyzed, and the sequence was consistent with the target sequence.

[0273] (2) Concentration analysis: The concentration of plasmid was determined by ultraviolet spectrophotometer, and the results are shown in Table 12.

[0274] (3) Purity analysis: A260 / A280, supercoil content, and impurity residue were analyzed according to the methods specified in the regulations. The A260 / A280 was between 1.8 and 2.0, the supercoil content was not less than 90%, the host RNA residue was less than 100 pg / ml, the host DNA residue was less than 1 ng / ml, the host protein residue was less than 100 pg / ml, and the antibiotic residue activity was negative.

[0275] (4) Safety: Endotoxin test results were obtained by analyzing the endotoxin content according to the methods specified in the regulations, and the endotoxin content was less than 10 EU / ml.

[0276] (5) Other: Analyze the appearance and pH according to the methods specified in the regulations. The appearance inspection showed no foreign matter and the pH value was between 6.5 and 7.5.

[0277] Table 12 DNA plasmid yield and purity

[0278]

[0279] 4.5 Preparation and Detection of Circular RNA

[0280] 4.5.1 Preparation of Circular RNA

[0281] (1) Plasmid digestion and purification: The plasmid was digested with restriction endonucleases BsaI (nearshore protein) / BsaI (Takara). The digestion system was as follows: 10× buffer: 2 ml, plasmid: 100 mg, BsaI: 3 ml, water to a final volume of 20 ml, digested overnight at 37°C. After digestion, the plasmid was purified by chromatography using a Capto Q ImpRes (Source 30Q) column (Cytiva) to obtain a linearized plasmid.

[0282] (2) In vitro transcription: The transcription system was prepared as shown in Table 13 below:

[0283] Table 13

[0284] 10× Reaction Buffer 100ml ATP 100ml CTP 100ml UTP 100ml GTP 100ml Linearized plasmids 30ml T7 RNA polymerase 100ml RNase inhibitor (40 U / μl) 100ml Nuclease-free water Total 1000ml

[0285] Reaction conditions: The reaction was carried out at 20-40℃ / 220rpm with constant temperature shaking for 1-4 hours. Then, 100ml of deoxyribonuclease I (DNase I) (1000U / ml) was added to the transcription system and the reaction was carried out at 37℃ / 220rpm with constant temperature shaking for 15 minutes.

[0286] Longer linear RNA molecules are difficult to obtain stable and intact RNA molecules using conventional in vitro transcription systems. In this study, the following conditions were optimized sequentially for plasmid pSVDV2-Cap-1221 to obtain optimal transcription conditions:

[0287] 1) Optimization of linearized plasmid template concentration: The final concentrations of plasmid templates in the system were set to 25 mg, 50 mg, 75 mg, and 100 mg in sequence.

[0288] 2) Nucleotide concentration optimization: The final concentrations of GTP / ATP / CTP / UTP in the system were set sequentially as follows: 8mM / 8mM / 8mM / 8mM, 32mM / 8mM / 8mM / 8mM, 16mM / 32mM / 8mM / 8mM, and 16mM / 16mM / 8mM / 8mM.

[0289] 3) Optimization of T7 RNA polymerase concentration: The concentrations of T7 RNA polymerase in the system were set to 750 kU, 900 kU, 1000 kU and 1250 kU respectively.

[0290] 4) Optimization of enzyme reaction temperature: The enzyme reaction temperatures were set to 20℃, 30℃, 37℃ and 40℃ respectively.

[0291] 5) Optimization of enzyme reaction time: The enzyme reaction time was set to 1h, 2h, 3h and 4h in sequence.

[0292] RNA content was determined by ultraviolet spectrophotometry, and RNA integrity was analyzed by capillary electrophoresis.

[0293] The above conditions have a significant impact on the results of in vitro RNA transcription. Without optimization, the RNA content obtained from in vitro transcription of plasmid pSVDV2-Cap-1221 was less than 0.5g / 1000ml, and it contained a large amount of incomplete RNA.

[0294] The optimal in vitro transcription conditions were determined through experimental screening: linearized plasmid template concentration of 50 mg, final GTP / ATP / CTP / UTP concentrations of 32 mM / 8 mM / 8 mM / 8 mM, final T7 RNA polymerase concentration of 1000 KU, enzyme reaction temperature of 37℃, and enzyme reaction duration of 2 h. Under these conditions, the RNA content obtained from in vitro transcription of plasmid pSVDV2-Cap-1221 could be increased to 3.5 g / 1000 ml of reaction solution, and the production process met the requirements.

[0295] (3) RNA precipitation of transcription products: LiCl solution was added to the above transcription products and the mixture was placed at -20℃ overnight for precipitation; the overnight treatment solution was centrifuged to obtain RNA precipitate, dried at room temperature and then resuspended in enzyme-free water to obtain linear RNA aqueous solution.

[0296] (4) RNA cyclization and concentration: The cyclization system and conditions are shown in Table 14 below:

[0297] Table 14

[0298]

[0299] Mix the above solutions thoroughly and heat at 48–60°C for 8–20 min. Concentrate the circularized RNA product by ultrafiltration and discard the filtrate; transfer the ultrafiltered liquid to a new centrifuge tube.

[0300] Circular RNA molecules are difficult to obtain stably and intact using conventional reaction systems. This study optimized the following conditions sequentially for plasmid pSVDV2-Cap-1221 to obtain the optimal circularization conditions:

[0301] (1) Linear RNA concentration optimization: The final concentrations of linear RNA in the system were set to 3g, 3.5g and 4g.

[0302] (2) Optimization of magnesium ion concentration: The final concentrations of magnesium ions in the system were set to 5mM, 8mM, 10mM, 12mM and 15mM.

[0303] (3) Optimization of cyclization reaction temperature: The reaction temperatures were set to 48℃, 52℃, 55℃, 58℃ and 62℃ respectively.

[0304] (4) Optimization of cyclization reaction time: The reaction time was set to 8 min, 10 min, 12 min, 15 min and 20 min respectively.

[0305] The above conditions significantly affect the RNA circularization results; without optimization, complete circular RNA cannot be prepared. Optimal circularization conditions were determined through experimentation: linear RNA concentration of 3.5 g, magnesium ion concentration of 8 mM, circularization reaction temperature of 52℃, and circularization reaction time of 15 min. Under these conditions, the circular RNA content obtained from in vitro transcription and circularization of plasmid pSVDV2-Cap-1221 reached 3.1 g / 1000 ml, and the production process met the requirements.

[0306] (5) Circular RNA HPLC purification: A certain amount of circular RNA was separated by passing it through a SEC-1000 (SEPAX) column in a 150mM phosphate buffer mobile phase, and the main peak components were collected.

[0307] (6) Concentration of purified circular RNA: The circular RNA tubes were concentrated to the desired concentration using a TFF capsule (LV Centramate, PALL). The TFF capsule membrane area was 0.02m². 2 The flow rate was 120 mL / min. The ultrafiltered liquid was then transferred to a new sample bottle after sterilization filtration.

[0308] Through the above optimized process, circular RNA containing the following sequence structure was successfully prepared:

[0309] A circular RNA, named SVDV-Cap-1221, was prepared from the DNA plasmid pSVDV-Cap-1221, and its sequence is shown in SEQ ID NO.26.

[0310] A circular RNA, named SVDV2-Cap-1221, was prepared from the DNA plasmid pSVDV2-Cap-1221, and its sequence is shown in SEQ ID NO.29.

[0311] 4.5.2 RNA test

[0312] The circular RNA was tested according to the Analytical Procedures for mRNA Vaccine Quality 2nd USP, and all indicators met the requirements.

[0313] (1) Identification: The RNA is sequenced and the sequence matches the target sequence.

[0314] (2) Concentration analysis: The concentration of RNA was determined by ultraviolet spectrophotometer, and the results are shown in Table 15.

[0315] (3) Integrity analysis: RNA integrity was determined by capillary gel electrophoresis (CGE), with a minimum of 80%. The results are shown in Table 15 and... Figure 2 As shown.

[0316] (4) Purity analysis: each impurity residue was analyzed according to the prescribed method. The dsRNA content was less than 0.5%, the DNA template residue was less than 100 pg / mg RNA, the free nucleotide residue was less than 100 pg / mg RNA, and the T7 RNA polymerase residue was less than 50 ppm.

[0317] (5) Efficacy analysis: PK15 cells were transfected according to the prescribed method, and the expression of the target protein was detected by the conventional Cap protein detection method. 48 hours after transfection, the expression levels of the target protein in the SVDV-Cap-1221 group and the SVDV2-Cap-1221 group reached 112.7 ng / ml and 123.2 ng / ml, respectively. The protein expression level in the SVDV2-Cap-1221 group was significantly higher than that in the SVDV-Cap-1221 group, indicating that the optimization of coding elements, translation initiation elements, and insertion elements was effective and significantly improved the expression efficiency of the target protein in porcine somatic cells.

[0318] (6) Safety: Endotoxin content is less than 0.1 EU / ml when analyzed according to the prescribed method.

[0319] (7) Other: Analyze the appearance and pH according to the prescribed methods. The appearance inspection shows no foreign matter and the pH value is between 6.5 and 7.5.

[0320] Compared with the SVDV-Cap-1221 group encoding the same protein sequence, the RNA yield of the SVDV2-Cap-1221 group was increased by 1.7 times (see Table 15), indicating that optimization of the non-coding region was effective and necessary, successfully improving the yield. Therefore, the circular RNA molecule (numbered SVDV2-Cap-1221), plasmid DNA molecule (numbered pSVDV2-Cap-1221), and E. coli strain containing the plasmid DNA molecule (numbered b-SVDV2-Cap-1221) corresponding to the SVDV 2-Cap-1221 group are preferred.

[0321] Table 15. Yield and purity of circular RNA molecules

[0322]

[0323] 4.6 Research on LNP-RNA Production Process

[0324] This section investigates the production process of LNP-encapsulated RNA.

[0325] 4.6.1 LNP-RNA Preparation

[0326] (1) Preparation of solution I: Dissolve cationic lipids, cholesterol, neutral lipids and PEG-modified lipids in ethanol to obtain solution I.

[0327] (2) Preparation of solution II: Dissolve the preferred circular RNA (SVDV2-Cap-1221) from step 4.5 in a 10 mM citrate buffer solution at pH 4.0.

[0328] (3) Using microfluidic technology, the two phases were rapidly mixed, and tangential flow technology was used to replace the buffer environment with PBS at pH 7.4 to remove ethanol, thus preparing LNP-RNA. In this section, the liposome preparation and vaccine preparation processes were optimized, specifically involving the liposome components and their proportions, and the LNP to RNA ratio, as follows:

[0329] 3.1) Screening of liposome components and formulation conditions: Solution I was prepared according to different components and formulations, specifically including cationic lipids (CMAX4(4-[(3-{[3-({3-[bis(3-{4-[(2-butyloctanoyl)oxy]butoxy}-3-oxypropyl)amino]propyl}(methyl)amino)propyl](3-{4-[(2-butyloctanoyl)oxy]butoxy}-3-oxypropyl)amino}propoxy)oxy]butyl 2-octanoate butyl ester) or SM-102(1-octylnonyl 8-[(2-hydroxyethyl)[6-O-6-(undecyloxy)hexyl]amino]-octanoate)) set at 45%–55%, cholesterol (5-cholesterol-3β-ol) set at 35%–44%, neutral lipids ( The concentrations of DSPC (distearylphosphatidylcholine) or DOPE (dioleoylphosphatidylethanolamine) were set at 3%–10%, and the concentrations of PEG-modified lipids (PEG-DMG (polyethylene glycol-dimyristate glycerol), PEG-DSG (bisdistearyl-rac-glycerol-polyethylene glycol), or PEG-DPG (polyethylene glycol diphosphoglycerate)) were set at 0.8%–1.8%. The cationic lipid CMAX4 was purchased from Suzhou Kerui Med Biomedical Technology Co., Ltd., and the remaining lipids were purchased from Aivito (Shanghai) Pharmaceutical Technology Co., Ltd. Circular RNA molecules encapsulated by LNPs were prepared using a 1:1 volume ratio of LNPs to circular RNA (SVDV2-Cap-1221). The particle size and encapsulation efficiency of each group were compared.

[0330] The results showed that the composition and ratio of liposomes had a significant impact on the outcome: for example, the combination of CMAX4 / cholesterol / DOPE / PEG-DPG in a ratio of 54.5:36.5:9.2:1.8 was ineffective, with an encapsulation rate of less than 10%.

[0331] The optimal liposome composition obtained through experiments was CMAX4 / cholesterol / DSPC / PEG-DMG, with an optimal ratio of 45.9:42.4:9.2:1.5. At this ratio, the molecular particle size was the most uniform (average 71 nm), the encapsulation efficiency reached 94%, and the production process met the requirements.

[0332] 3.2) Optimization of LNP / RNA Ratio: LNPs and circular RNA (SVDV2-Cap-1221) were mixed at different ratios (volume ratios of solution I:II: 1:1, 1:2, 1:3, 1:4, 1:5, and 1:6), and the optimal LNP / RNA ratio was verified using gel retardation assays. The results showed that when the volume ratio of liposome nanomaterials (LNP) to circular RNA molecules (SVDV2-Cap-1221) was greater than 1:3, the migration of SVDV2-Cap-1221 could be completely blocked. Therefore, the volume ratio of LNP / circular RNA molecules was set at 1:3.

[0333] (4) The circular RNA molecule (numbered SVDV2-Cap-1221) was encapsulated with LNP under the above preferred conditions, and then sucrose was added to a final concentration of 8%. After sterile filtration, the RNA vaccine was obtained, numbered LNP / SVDV2-Cap-1221.

[0334] (5) Using Quant-iT TM RiboGreen TM RNA Assay Kit (Invitrogen) TM Encapsulation efficiency was determined using R11490. Particle size, polydispersity index (PDI), and surface potential of LNP particles were measured using dynamic light scattering on a Malvern Zetasizer Nano-ZEN 3600 (Malvern) potential-laser particle size analyzer.

[0335] 4.6.2 Experimental Results

[0336] The results are shown in Table 17. All indicators of the LNP-encapsulated RNA passed the tests: particle size was less than 80 nm, PDI was less than 0.15, and encapsulation efficiency was greater than 90%; the surface potential was electronegative. The overall particle size was small and uniformly distributed, and the electronegativity of the surface avoided the cytotoxicity caused by positive charges on the nanoparticle surface, resulting in good biosafety and providing a feasible basis for large-scale vaccine preparation.

[0337] Table 17 Characterization of LNP-RNA samples

[0338] LNP / SVDV2-Cap-1221 71 0.14 -7.7 94

[0339] 4.7 Evaluation of the Immunotherapy Effect of LNP-Encapsulated RNA

[0340] The immunization efficacy of the vaccine prepared using the preferred LNP in step 4.6 was evaluated and the immunization dose was determined.

[0341] 4.7.1 Mouse Immunization and Antibody Assay

[0342] (1) Experimental methods

[0343] Female C57BL / 6 mice aged 6–8 weeks were randomly divided into 3 groups of 5 mice each. The mice were immunized with LNP / SVDV2-Cap-1221 prepared with preferred LNP and c-LNP / SVDV2-Cap-1221 prepared with commercial LNP (preparation method is described in step 1.4 of Example 1). The dose of the inoculation was 3 μg / mouse. Mice inoculated with LNP were used as negative controls. Blood was collected on day 21 after immunization to separate serum and detect porcine circovirus type 2 G protein IgG antibody and virus neutralizing antibody.

[0344] (2) Experimental Results

[0345] The results are shown in Table 18. The LNP prepared using the optimized process was superior to commercially available LNP, successfully increasing the neutralizing antibody titer in mice and providing a feasible basis for further research.

[0346] Table 18 Antibody Response in Mice

[0347]

[0348] 4.7.2 Pig immunization, immunization route, and determination of immunization dosage

[0349] The selection criteria for experimental pigs are shown in Table 19 below. A total of 28 piglets were selected.

[0350] Table 19 Screening criteria for experimental pigs

[0351]

[0352]

[0353] The experimental animals were divided into four groups of seven each.

[0354] Group 1: Pigs (neck muscles) inoculated with LNP / SVDV2-Cap-1221 prepared in step 4.6, with an immunization dose of 60 μg / pig, numbered SVDV2-Cap-1221-60 μg.

[0355] Group 2: Pigs (neck muscles) inoculated with LNP / SVDV2-Cap-1221 prepared in step 4.6, with an immunization dose of 80 μg / pig, numbered SVDV2-Cap-1221-80 μg.

[0356] Group 3: Pigs (neck muscles) inoculated with LNP / SVDV2-Cap-1221 prepared in step 4.6, with an immunization dose of 100 μg / pig, numbered SVDV2-Cap-1221-100 μg.

[0357] Group 4: Immunized with PBS only, immunization dose 1 ml / animal, numbered PBS group.

[0358] A booster immunization was administered 14 days after the initial immunization. Serum was collected 28 days after the second immunization for testing of porcine circovirus type 2 Cap protein IgG antibody and virus neutralizing antibody. Serum was also collected 14 days after the second immunization, and the levels of IFN-γ and IL-4 in each group's serum were measured using the MILLIPLEX MAP Porcine Cytokine and Chemokine Magnetic Bead Panel-Immunology Multiplex Assay Kit (MERCK, catalog number PCYTMAG-23K-09) to preliminarily assess the cellular immune response. Specific procedures were performed according to the kit's instruction manual.

[0359] (2) Test Results

[0360] The results of antibody detection in pig blood are shown in Table 20. No antibodies were produced in the PBS group, while the SVDV2-Cap-1221 group was effectively induced to produce high levels of virus-neutralizing antibodies with low-dose immunization (80 μg), indicating that the vaccine is highly effective.

[0361] The levels of various cytokines in porcine blood are shown in Table 21. Compared with the PBS group, the SVDV2-Cap-1221 group effectively increased the levels of IFN-γ and IL-4 in porcine serum, suggesting effective activation of cellular immune responses and further improvement of the protective effect of the vaccine, providing a basis for further research.

[0362] Table 20 Antibody Response in Pigs

[0363]

[0364] Table 21. IFN-γ and IL-4 levels in porcine serum (mean ± SD) (pg / ml)

[0365]

[0366]

[0367] 4.8 Animal Immunization and Efficacy Assessment

[0368] Twenty weaned piglets aged 4-6 weeks (negative for porcine circovirus type 2 antigen) were divided into four groups of five each and vaccinated via neck muscle.

[0369] Group 1: Inoculated with LNP-encapsulated CKV-Cap-357, prepared using an optimized LNP process, with an immunization dose of 80 μg / animal.

[0370] Group 2: Inoculated with LNP-wrapped SVDV2-Cap-1221, immunization dose 80μg / animal.

[0371] Group 3: Received the commercially available porcine circovirus subunit vaccine CircoFLEX, 1 ml immunization dose.

[0372] Group 4: Inoculated with sterile PBS, immunization dose 1ml / animal.

[0373] The RNA group was given a booster immunization at the same dose on day 14 (day 14) following the initial immunization (day 0). Commercial vaccines were administered according to the instructions. Viral challenge was performed 28 days post-vaccination (day 42). Serum samples were collected on days 7 (day 49), 14 (day 56), 21 (day 63), 42 (day 84), and 70 (day 112) post-challenge to measure viral DNA load and assess the preventive effect against viral infection. Serum samples were collected on the following days: primary immunization (day 0), secondary immunization (day 14), challenge (day 42), day 7 post-challenge (day 49), day 14 post-challenge (day 56), day 21 post-challenge (day 63), day 42 post-challenge (day 84), and day 70 post-challenge (day 112) to detect virus neutralizing antibodies and the levels of PCV2-specific IFN-γ secreting cells in PBMCs, in order to assess humoral and cellular immune responses. For specific procedures, please refer to step 3.3 of Example 3.

[0374] See results Figures 6-8 Compared to the PBS group, the CKV-Cap-357 group induced lower neutralizing antibody levels, while the SVDV2-Cap-1221 group successfully increased neutralizing antibody titers. Figure 6 ), and increase the number of PCV2-specific IFN-γ secreting cells per unit PBMC ( Figure 7 ), and reduce viral DNA load in the blood ( Figure 8 This indicates successful activation of humoral and cellular immune responses and effective prevention of viral infection. The SVDV2-Cap-1221 group achieved levels similar to commercial vaccines in controlling viral DNA load in the blood and stimulating neutralizing antibody titers, while significantly outperforming commercial vaccines in stimulating IFN-γ secretory cell levels. Figure 8This indicates that it can induce a stronger cellular immune response. According to the literature (doi:10.1089 / vim.2005.18.333), virus-neutralizing antibodies and cellular immune responses are crucial for immune protection and are positively correlated with the ability to clear porcine circovirus. In this study, we optimized the preparation of circular RNA molecules and used an optimized formulation process to prepare an LNP-encapsulated RNA vaccine, which successfully induced high levels of virus-neutralizing antibodies and cellular immune responses, controlling viral infection and providing a foundation for the development of highly effective circular RNA vaccines to prevent porcine circovirus type 2 infection.

[0375] 4.9 Vaccine Safety Trials

[0376] Three batches of RNA vaccine were produced in the laboratory using the optimized formulation process described above for the SVDV2-Cap-1221 molecule. The batch numbers were P2-001, P2-002, and P2-003. The vaccines passed physical properties and sterility tests. The vaccines were then dispensed into 25ml vials and stored at -20℃ for later use. Preliminary safety studies were conducted on piglets and sows.

[0377] 4.9.1 Single-dose immunization trial of piglets

[0378] Forty healthy, non-immunized piglets were selected. Each batch of vaccine was divided into one group: groups 1-3 were the immunization test groups, with 10 piglets in each group; group 4 was the unvaccinated control group, with 10 piglets. The immunization test group pigs were injected intramuscularly into the neck with one dose of vaccine (0.5 ml / pig). A 28-day clinical observation period was conducted to assess safety, and the clinical manifestations of the experimental pigs were recorded.

[0379] 4.9.2 Single-dose repeated immunization trial of piglets

[0380] After the single-dose vaccination test group is completed, a second single-dose repeated immunization test will be conducted. Each pig will be injected intramuscularly with one dose (0.5 ml / pig) in the neck according to the same batch of vaccine. The pigs will be observed for 28 days after vaccination, and their clinical manifestations will be recorded.

[0381] 4.9.3 High-dose immunization trial of piglets

[0382] Forty healthy, non-immunized piglets (10 piglets / litter) were selected. Each batch of vaccine was divided into one group: groups 1-3 were the immunization test groups, with 10 piglets in each group; group 4 was the unvaccinated control group, with 10 piglets. The immunization test group pigs were injected intramuscularly into the neck with two doses of vaccine (0.5 ml / pig). A 28-day clinical observation period was conducted to assess safety, and the clinical manifestations of the experimental pigs were recorded.

[0383] 4.9.4 Sow Immunization Safety Trial

[0384] Twenty primiparous sows were selected. Each batch of vaccine was divided into one group: groups 1-3 were the experimental immunization groups, with 5 sows in each group; group 4 was the control group, with 5 sows, which were not vaccinated. Sows were vaccinated once before mating and again 20 days before farrowing, with a dose of 0.5 ml per sow. Observation of sows covered the entire lactation period, continuing until weaning. The focus of the study was to determine the survival rate of piglets, including weak piglets and stillbirths.

[0385] 4.9.5 Safety Test Judgment Standards

[0386] The vaccine did not cause clinical symptoms in the experimental pigs, such as progressive emaciation, pale skin, rough coat, enlarged superficial lymph nodes, difficulty breathing, indigestion, or fever. The vaccine's local reaction after injection and its impact on feed intake and weight gain were also assessed. Passive immunization was also observed in sows for farrowing survival and lactation weight gain.

[0387] The results are shown in Tables 22-25. After 28 days of clinical observation following single-dose vaccination, no local reactions caused by vaccine injection were observed in the vaccinated pigs, nor were any other adverse reactions observed. Body temperature and weight measurements showed no significant differences compared to the control group, demonstrating that the single-dose vaccination group was safe (Table 22).

[0388] Pigs were vaccinated with a single dose, and 21 days later, each group was vaccinated again with the same batch of vaccine, at the same dose and route. No allergic reactions were observed during the second vaccination. After 28 days of clinical observation, no local reactions caused by vaccine injection were observed, nor were any other adverse reactions observed in the vaccinated pigs; body temperature and weight were not significantly different from the control group, proving that the single-dose repeated vaccination was safe for the experimental pigs (Table 23).

[0389] After 28 days of clinical observation following vaccination of pigs with high doses, no local reactions caused by vaccine injection were observed, nor were any other adverse reactions observed in the vaccinated pigs; the body temperature and weight test results were not significantly different from those of the control group, proving that the high-dose vaccination group was safe (Table 24).

[0390] When pregnant sows were vaccinated, the vaccine did not cause any clinical reproductive disorders such as abortion or stillbirth. Compared with the blank control group, the vaccine-immunized sows had no significant effect on litter size or weight gain, with litter sizes ranging from 9 to 12 piglets, which is within the normal range. The piglets produced were healthy and active, with good survival rates and no toxic side effects, proving that the vaccine is safe for pregnant sows (Table 25).

[0391] Table 22 Results of routine safety tests

[0392]

[0393] Table 23 Results of the dual-dose safety test

[0394]

[0395] Table 24 Results of High-Dose Safety Tests

[0396]

[0397]

[0398] Table 25 Results of the sow immune safety trial

[0399]

[0400] 4.10 Vaccine stability study

[0401] Three batches of RNA vaccine were produced in the laboratory using the optimized formulation process described above for the SVDV2-Cap-1221 molecule. The batch numbers were P2-001, P2-002, and P2-003. The vaccines passed physical properties and sterility tests. They were then dispensed into 25ml vials and stored at -20℃ for later use. Samples were taken for testing at 0 days, 1 month, 2 months, 3 months, and 6 months.

[0402] Using Quant-iT TM RiboGreen TM RNA Assay Kit (Invitrogen) TM RNA content and encapsulation efficiency were determined using R11490. The particle size of LNP particles was measured using a Malvern Zetasizer Nano-ZEN 3600 (Malvern) potentiometric laser particle size analyzer. pH and appearance were then examined.

[0403] The test results are shown in Table 26. The vaccine remained stable after being stored at -20℃ for 6 months, with no significant changes in encapsulation rate, particle size, RNA content, pH, or appearance. This stability provides a foundation for large-scale vaccine preparation and application.

[0404] Table 26 Vaccine Storage Stability

[0405]

[0406]

[0407] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A circular RNA, characterized in that, The circular RNA contains a coding element that encodes any one of the following nucleotide sequences encoding a 16-amino acid truncated N-terminus of the Cap protein of type 2 circovirus and the mutant V166P: the nucleotide sequence shown in SEQ ID NO. 11, nucleotide sequence 1 shown in SEQ ID NO. 12, nucleotide sequence 2 shown in SEQ ID NO. 13, or nucleotide sequence 3 shown in SEQ ID NO.

14.

2. The circular RNA according to claim 1, characterized in that, The circular RNA comprises elements arranged in any of the following (a) to (d): (a) Exon 1, Exon 2, 5' spacer, translation initiation element, coding element, and 3' spacer; (b) Exon 1, Exon 2, translation initiation element, and coding element; (c) Translate the starting element and the encoding element; (d) Translate the starting element, encoding element, and insertion element; The translation initiation element comprises one or more sequences with translation initiation activity as shown below: IRES sequence, 5'UTR sequence, Kozak sequence, and sequences containing m 6 The A-modified sequence, the complementary sequence of ribosomal 18S rRNA; the insertion element comprises one or more of the following sequences: untranslated region sequence, polyN sequence, aptamer sequence, ribosomal switch sequence, and sequence for binding transcription regulatory factors; wherein the polyN sequence is selected from polyAC as shown in SEQ ID NO.5 or polyAC as shown in SEQ ID NO.

25.

3. The circular RNA according to claim 2, characterized in that, The nucleotide sequence of the circular RNA is any one of the following: the nucleotide sequence shown in SEQ ID NO.9, the nucleotide sequence shown in SEQ ID NO.15, the nucleotide sequence shown in SEQ ID NO.16, the nucleotide sequence shown in SEQ ID NO.17, the nucleotide sequence shown in SEQ ID NO.18, the nucleotide sequence shown in SEQ ID NO.26, or the nucleotide sequence shown in SEQ ID NO.

29.

4. A linear RNA, characterized in that, The linear RNA undergoes a self-cleavage reaction and then circularizes to form a circular RNA as described in any one of claims 1-3.

5. A recombinant nucleic acid molecule, characterized in that, The recombinant nucleic acid molecule is transcribed to form linear RNA; the linear RNA is as described in claim 4.

6. A recombinant engineered Escherichia coli strain, characterized in that, The engineered bacteria are obtained by transforming E. coli with the recombinant nucleic acid molecule as described in claim 5.

7. A circovirus type 2 vaccine comprising the circular RNA as described in any one of claims 1-3, characterized in that, The porcine circovirus type 2 vaccine comprises a circular RNA molecule encoding a truncated and mutant porcine circovirus type 2 Cap protein and a pharmaceutically acceptable vector. The amino acid sequence of the truncated and mutant porcine circovirus type 2 Cap protein is shown in SEQ ID No. 10, and the nucleotide sequence of the truncated and mutant porcine circovirus type 2 Cap protein is shown in any one of SEQ ID Nos. 11-14.

8. The porcine circovirus type 2 vaccine according to claim 7, characterized in that, The nucleotide sequence of the circular RNA molecule is any one of the following: the nucleotide sequence shown in SEQ ID NO.26, or the nucleotide sequence shown in SEQ ID NO.

29.

9. The porcine circovirus type 2 vaccine according to claim 7, characterized in that, The circular RNA molecule encoding the Cap truncated and mutant protein of circovirus type 2 is formed by the transcriptional circularization of vector DNA containing elements arranged in any of the following (1) to (2): (1) Intron fragment II as shown in SEQ ID NO.1, translation initiation element truncated fragment II as shown in SEQ ID NO.27, coding element as shown in SEQ ID NO.12, polyAC as shown in SEQ ID NO.5, translation initiation element truncated fragment I as shown in SEQ ID NO.28, and intron fragment I as shown in SEQ ID NO.7; (2) Intron fragment II as shown in SEQ ID NO.23, translation initiation element truncated fragment II as shown in SEQ ID NO.27, coding element as shown in SEQ ID NO.12, polyAC as shown in SEQ ID NO.25, translation initiation element truncated fragment I as shown in SEQ ID NO.28, and intron fragment I as shown in SEQ ID NO.

24.

10. The porcine circovirus type 2 vaccine according to claim 7, characterized in that, The pharmaceutically acceptable carrier includes lipid nanoparticles, which, by molar percentage, consist of: 45%-55% cationic lipids, 35%-44% cholesterol, 3%-10% neutral lipids, and 0.8%-1.8% PEG-modified lipids; the cationic lipids are CMAX4 or SM-102; the cholesterol is 5-cholestyr-3β-ol; the neutral lipids are DSPC or DOPE; and the PEG-modified lipids are PEG-DMG, PEG-DSG, or PEG-DPG.

11. A method for preparing a porcine circovirus type 2 vaccine according to any one of claims 7-10, characterized in that, The method includes the following steps: S1. The gene containing the truncated and mutant Cap protein of type 2 circovirus and the circular element was synthesized and cloned into a recombinant vector to obtain a recombinant vector containing the gene containing the truncated and mutant Cap protein of type 2 circovirus and the circular element. S2. Transform or transduce the host with the recombinant vector containing the truncated Cap gene of porcine circovirus type 2 and the circular element obtained in step S1 to obtain a recombinant containing the recombinant vector. S3. Cultivate the recombinants obtained in step S2 to prepare plasmids containing the truncated and mutant Cap protein gene of porcine circovirus type 2 and circular elements; S4. Using the plasmid containing the truncated and mutant Cap protein gene of circovirus type 2 and the circular element obtained in step S3, a circular RNA encoding the truncated and mutant Cap protein of circovirus type 2 is prepared. S5. The circular RNA encoding the truncated and mutant protein of circovirus type 2 virus Cap obtained in step S4 is added to a pharmaceutically acceptable vector to obtain the circovirus type 2 vaccine.

12. Use of a circular RNA as described in any one of claims 1-3, or a linear RNA as described in claim 4, or a recombinant nucleic acid molecule as described in claim 5, or a recombinant engineered Escherichia coli as described in claim 6, or a circovirus type 2 vaccine as described in any one of claims 7-10, or a circovirus type 2 vaccine prepared by the method described in claim 11, in the preparation of a medicament for the prevention of circovirus type 2.

Images