Methods and kits for determining a target polynucleotide, and probe sets

By designing a probe set containing non-natural nucleotides and using the current blocking characteristics of transmembrane pores, the problem of determining the presence, absence or amount of target polynucleotides in samples containing additional components is solved, achieving efficient and accurate detection results.

CN117343990BActive Publication Date: 2025-05-30OXFORD NANOPORE TECH LTD
View PDF 20 Cites 0 Cited by

Patent Information

Application Number
CN202311313578.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2016-10-21
Filing Date
2017-10-20
Publication Date
2025-05-30
Estimated Expiration
2037-10-20

AI Technical Summary

Technical Problem

It is difficult for prior art to effectively determine the presence, absence or amount of target polynucleotide in samples containing additional components.

Method used

By designing a probe set to contact the sample under suitable conditions, the probe set includes a non-hybridization region and a hybridization region, where the hybridization region contains a non-natural nucleotide to regulate the hybridization time of the probe to the target polynucleotide, and applying a potential through the membrane pore to interact with the pores, the hybridization probe in the sample interacts with the pores, and the current blockage within the defining window is measured to determine the presence or amount of the target polynucleotide.

Benefits of technology

Accurate determination of the presence, absence or amount of target polynucleotides in samples containing additional components is achieved, improving the specificity and sensitivity of the detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004488661090000231
    Figure BDA0004488661090000231
  • Figure BDA0004488661090000301
    Figure BDA0004488661090000301
  • Figure BDA0004488661090000302
    Figure BDA0004488661090000302
Patent Text Reader

Abstract

A method for determining the presence, absence or amount of two or more target polynucleotides in a sample comprising additional components, the method comprising: (i) contacting the sample with a set of two or more probes under conditions suitable for hybridization of the target polynucleotide with the probe; (ii) contacting the sample prepared in step (i) with a transmembrane pore through which single-stranded polynucleotides but not double-stranded polynucleotides can pass, and applying a potential difference across the transmembrane pore such that the hybridized probes in the sample interact with the pore; (iii) measuring a current blockade having a duration within a defined window; and (iv) correlating the measured current blockade with the probe to thereby determine the presence, absence or amount of the two or more target polynucleotides in the sample.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of a Chinese patent application with an application date of October 20, 2017, an application number of 201780064931X, and an invention title of "Method". Technical Field

[0002] The present invention relates to methods for determining the presence, absence, or amount of a target polynucleotide in a sample. The present invention also relates to a set of probes for use in the methods and a kit for performing the methods. Background Art

[0003] Transmembrane pores (nanopores) have great potential as direct electron biosensors for various analytes such as polymers and small molecules. When a potential is applied across the nanopore, the current changes when a molecule such as a polynucleotide transiently resides in the barrel or channel of the nanopore for a period of time. A particular molecule, such as a particular polynucleotide, gives a current change with known characteristics and duration. This current change can be used to identify the polynucleotide present in the pore.

[0004] Transmembrane pores can be used in multiplex assays to determine the presence or absence of each analyte in a set of two or more analytes. Multiplex assays use a set of probes. Each probe in the set includes a tail that is capable of entering the pore and affecting the current flowing through the pore and an analyte binding region. Each tail affects the current flowing through the pore in a different and unique way, depending on whether the probe binds to one of the analytes of interest. The effect of each probe in the set on the current flowing through the pore is also different, so the characteristics of each probe can be detected. Summary of the Invention

[0005] The inventors have developed an assay for using a transmembrane pore to determine the presence, absence, or concentration / amount of one or more target polynucleotides. The assay uses a set of probes, each probe including a region capable of hybridizing to a target polynucleotide and a non-hybridizing region (tail). When the probe hybridizes to its target polynucleotide and contacts a transmembrane pore across which an electric field is applied, the non-hybridizing region will enter the transmembrane pore and remain there until the target polynucleotide dissociates from the probe. The residence time can be defined as the length of the current blockage, where the current blockage is a reduction in the ionic current flowing through the pore due to the presence of components in the sample that interact with the pore. The length of the current blockage can be defined as the time period between when a component in the sample causes a decrease in the ionic current until the component no longer causes the current decrease. For a given pore and potential, the residence time depends on the time it takes for the target polynucleotide to dissociate from the probe under the force of the applied potential. The intensity of the applied potential and the size of the pore also affect the residence time.

[0006] The inventors have recognized that probe sets can be constructed to provide substantially the same dwell times and can be used in transmembrane pore-based assays to determine the presence, absence, or amount of a target polynucleotide. This is particularly advantageous, for example, when a sample containing the target polynucleotide also contains other components that interact with the transmembrane pore. Only certain dwell times of current blockades need to be analyzed in the method. Longer and / or shorter current blockades can be excluded from the analysis. The inventors have found that probe sets with substantially the same dwell times can be designed by modulating the composition of the hybridization regions of one or more probes in the set. The inventors have found that the length of time that a probe remains hybridized to its target polynucleotide can be increased or decreased by introducing unnatural nucleotides into the hybridization region.

[0007] Accordingly, in one aspect, the present invention provides a method for determining the presence, absence, or amount of two or more target polynucleotides in a sample comprising additional components, the method comprising:

[0008] (i) contacting the sample with a set of two or more probes under conditions suitable for hybridization of the target polynucleotide to the probe, wherein:

[0009] (a) each probe comprises a non-hybridizing region and a hybridization region that specifically hybridizes to one of the target polynucleotides to form a hybridized probe; and

[0010] (b) the hybridization regions of the probes in the set comprise one or more unnatural nucleotides;

[0011] (ii) contacting the sample prepared in step (i) with a transmembrane pore through which single-stranded polynucleotides but not double-stranded polynucleotides can pass, and

[0012] applying a potential difference across the transmembrane pore such that the hybridized probes in the sample interact with the pore;

[0013] (iii) measuring current blockades having a duration within a defined window, wherein:

[0014] (a) the one or more unnatural nucleotides present in the hybridization region of the probe increase or decrease the duration of the current blockade due to hybridization of the probe to its target polynucleotide such that the proportion of current blockades occurring within the window due to interaction of the hybridized probe with the pore is increased compared to when a corresponding one or more natural nucleotides are present in the hybridization region; and

[0015] (b) each hybridized probe produces a current blockade indicative of the probe; and

[0016] (iv) Associate the measured current blockade with the probe to determine the presence, absence, or amount of the two or more target polynucleotides in the sample.

[0017] Additional aspects of the present invention include:

[0018] - A method for diagnosing a disease, wherein the method comprises performing the method for determining the presence, absence, or amount of two or more target polynucleotides, wherein the target polynucleotides are markers of the disease;

[0019] - A set of two or more probes for use in a method for determining the presence, absence, or amount of two or more target polynucleotides; and

[0020] - Use of a set of probes of the present invention in a method for detecting the presence, absence, or amount of two or more target polynucleotides. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] It should be understood that the drawings are only for illustrating specific embodiments of the present invention and are not intended to be restrictive.

[0022] Figure 1 Shows the calibration duplex (formed with microRNA 192 and labeled Y) and the average current blockade length of each microRNA 150 variant and duplex.

[0023] Figure 2 Shows the calibration duplex (formed with microRNA 192, labeled Y) and the average current blockade length of each microRNA 182 variant and duplex.

[0024] Figure 3 Shows the successful adjustment of miRNA:DNA hybrid duplexes. Group 1 shows the current block ratio and dwell time of the unmodified 342_3T_3SPRNA duplex. Group 2 shows the addition of the dwell-adjusted 342_3T_3SP duplex (labeled X as 342 3T_3Sp_all_enh) to the original sample. It can be observed that the modification of the hybridization region (where all nucleotides in the hybridization region are unnatural nucleotides) has shifted the average dwell of the clusters into the desired window centered at 1 second. Group 3 shows the addition of the calibration duplex (labeled Y), which is used for comparison between experiments.

[0025] Figure 4 Shows how three metrics are used to determine the identity of the clusters corresponding to a specific microRNA: current blockade length (or dwell) (Part A); "variant" or standard deviation (Part B); and current blockade noise (Part C).

[0026] Sequence Listing Description

[0027] SEQ ID NO: 1 is an example of a quadruplex-forming sequence.

[0028] SEQ ID NO: 2 is a polynucleotide sequence encoding a monomer of α-hemolysin-E111N / K147N (α-HL-NN; Stoddart et al., Proceedings of the National Academy of Sciences of the United States of America (PNAS), 2009; 106(19):7702-7707).

[0029] SEQ ID NO: 3 is the amino acid sequence of a monomer of α-HL-NN.

[0030] SEQ ID No: 4 to 26 show the polynucleotide sequences used in the examples.

[0031] It should be understood that the sequences are not intended to be limiting. Detailed Description

[0032] It should be understood that different applications of the disclosed products and methods can be customized according to the specific needs of the art. It should also be understood that the terms used herein are for the purpose of describing specific embodiments of the invention only and are not intended to be limiting.

[0033] Furthermore, as used in this specification, unless the context clearly indicates otherwise, the singular forms "a", "an", and "the" include plural referents. Thus, reference to "a pore" includes two or more such pores, reference to "a tail" includes two or more such tails, reference to "a polynucleotide" includes two or more such polynucleotides, and so on.

[0034] All publications, patents, and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

[0035] Methods

[0036] The inventors have developed assays for detecting and / or analyzing one or more target polynucleotides, e.g., determining the presence, absence, or concentration / amount of one or more target polynucleotides using transmembrane pores. In one aspect, provided herein is an assay that uses a set of probes, each probe including a region capable of hybridizing to a target polynucleotide (e.g., a hybridization region) and a non-hybridization region. When hybridization occurs between the hybridization region of the probe and a portion of the target polynucleotide, a potential is applied across the transmembrane pore to cause at least a portion of the non-hybridization region of the probe to enter the transmembrane pore and interact with the transmembrane pore, thereby reducing the ionic current passing through the transmembrane pore. A portion of the non-hybridization region that interacts with the pore remains within the transmembrane pore until the target polynucleotide dissociates from the hybridization region of the probe. Dissociation is caused by the melting effect of the pore (i.e., the voltage applied across the membrane). Measurements are made when the target and the probe are hybridized, but eventually the target will completely dissociate from the hybridization region of the probe. The length of time that the portion of the non-hybridization region that interacts with the transmembrane pore remains within the transmembrane pore generally corresponds to the length of time that current blockade occurs. This is referred to as the "dwell time". Thus, the dwell time can be defined as the length of time that current blockade occurs, where current blockade indicates a reduction in the ionic current flowing through the pore due to the presence of a component in the sample that interacts with the pore. The length of time that current blockade occurs can be defined as the time period between when a component in the sample causes a reduction in the ionic current passing through the transmembrane pore and when the component no longer does so. For a given transmembrane pore and potential, the dwell time can depend on the time it takes for the target polynucleotide to dissociate from the hybridization region of the probe under the force of the applied potential. In some embodiments, the strength of the applied potential and / or the size of the pore can also affect the dwell time. In some embodiments, the binding affinity between the hybridization region of the probe and the corresponding portion of the target polynucleotide can also affect the dwell time.

[0037] The inventors have recognized that constructing sets of probes that provide substantially the same dwell time (e.g., within 10% difference, within 5% difference, or within 1% difference) can be used in transmembrane pore-based assays to determine the presence, absence, or amount of one or more target polynucleotides. The dwell time window generally ranges from 1 nanosecond to 100 seconds, 10 microseconds to 10 seconds. A dwell time window of about 0.5 seconds is optimal.

[0038] This is particularly advantageous, for example, when a sample containing the target polynucleotide also contains other components (e.g., non-target polynucleotides and / or non-target analytes) that can interact with the transmembrane pore. Only the current blockades for certain dwell times need to be analyzed to determine the presence, absence, or amount of one or more target polynucleotides. Longer and / or shorter current blockades can be excluded from the analysis.

[0039] Probe sets having substantially the same dwell time window can be designed by varying the composition or constitution of the hybridization region of one or more probes in the set. The inventors have found that by introducing appropriate types, patterns, and / or amounts of unnatural nucleotides into the hybridization region, the length of time that the hybridization region of a probe remains hybridized to the corresponding portion of a target polynucleotide can be increased or decreased.

[0040] The inventors have also shown that probe sets can be designed to perform multiplex polynucleotide assays (e.g., to distinguish a first target polynucleotide from a second target polynucleotide). For example, by designing the non-hybridization region of each probe in the set to confer a unique signal pattern indicative of a different target polynucleotide, in combination with the characteristics of probes having a dwell time window substantially the same as described above, the current blockade signal patterns occurring within a defined dwell time window can be analyzed to detect multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) different target polynucleotides in a sample. In addition to probes having substantially the same dwell time window, the non-hybridization region of each probe should be constructed to confer a unique signal pattern indicative of a different target polynucleotide to allow for multiplex assays. In one embodiment, the non-hybridization region of each probe can include poly-T or abasic nucleotides. Abasic nucleotides have neither a purine nor a pyrimidine base.

[0041] In one aspect, the present invention provides a method for determining the presence, absence, or amount of two or more target polynucleotides in a sample comprising additional components.

[0042] The method includes contacting the sample with a set of two or more probes. This step is carried out under conditions suitable for hybridization of the target polynucleotide to the probes. Each probe in the set specifically binds to a target polynucleotide and includes a non-hybridization region and a hybridization region. The hybridization region specifically hybridizes to the target polynucleotide. The non-hybridization region is capable of entering a transmembrane pore through which single-stranded polynucleotides, but not double-stranded polynucleotides, can pass under an applied potential difference. The non-hybridization region has a different effect on the current flowing through the pore, depending on whether the probe is hybridized to its target polynucleotide.

[0043] If the target polynucleotides are present in a sample, the probes are typically contacted with the sample under conditions that permit the probes to hybridize to their respective target polynucleotides. Conditions that permit hybridization are well known in the art (e.g., Sambrook et al., 2001, Molecular Cloning: a laboratory manual, 3rd ed., Cold Spring Harbor Laboratory Press; and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al. eds., Greene Publishing and Wiley-Interscience, New York, (1995)). Hybridization can be carried out under low stringency conditions, such as in a buffer solution containing 30% to 35% formamide, 1 M NaCl, and 1% SDS (sodium dodecyl sulfate) at 37°C, followed by washing in 1X (0.1650 M Na+) to 2X (0.33 M Na+) SSC (standard sodium citrate) at 50°C. Hybridization can be carried out under medium stringency conditions, such as in a buffer solution containing 40% to 45% formamide, 1 M NaCl, and 1% SDS at 37°C, followed by washing in 0.5X (0.0825 M Na+) to 1X (0.1650 M Na+) SSC at 55°C. Hybridization can be carried out under high stringency conditions, such as in a buffer solution containing 50% formamide, 1 M NaCl, 1% SDS at 37°C, followed by washing in 0.1X (0.0165 M Na+) SSC at 60°C.

[0044] Suitable hybridization conditions comprise 40 mM KCl, 10 mM HEPES, pH 8, for 2.5 minutes at about 97°C. Then the temperature is decreased by 0.1°C every 5 seconds until the temperature reaches 20°C. Preferred hybridization conditions are those described in the examples. In a specific example, the hybridization conditions are 50 mM NaCl, 10 mM Tris pH 7.5, for 2.5 minutes at about 95°C. Then the temperature is decreased by 0.1°C every 5 seconds until the temperature reaches about 18°C. After hybridization, the probes can be maintained at about 4°C prior to analysis.

[0045] The method includes contacting a sample with a transmembrane pore through which single-stranded polynucleotides but not double-stranded polynucleotides can pass. When contacting the sample and a probe set with the transmembrane pore, a potential is preferably applied across the pore. This allows the hybridization probes in the sample to interact with the pore. The potential applied can be a voltage potential. Alternatively, the potential applied can be a chemical potential. An example of this is using a salt gradient across an amphiphilic layer. The salt gradient is disclosed in Holden et al., Journal of the American Chemical Society (J Am Chem Soc.), 2007 Jul 11:129(27):8650-5.

[0046] Generally, the hybridization region is complementary to a sequence within the target polynucleotide by at least about 80%, such as at least about 85%, at least about 90%, at least about 95%, at least about 97% or 100%.

[0047] The method further includes measuring an ionic current flowing through the pore to determine which probes, if any, in the set have bound to the target polynucleotide and thereby determine the presence or absence, and optionally the concentration / amount, of one or more target polynucleotides in the sample. Measuring the ionic current can include measuring the current or measuring an optical signal indicative of flow. Any method known in the art can be used to measure the current. When hybridized to their respective target polynucleotides, different probes in the set affect the current flowing through the pore in different and unique ways. This allows identification of a specific probe in the set. Since the characteristics of the probe and its binding to the target polynucleotide can be measured, the presence or absence and optionally the amount of the target polynucleotide in the sample can be determined. Thus, the method includes correlating the measured current blockade with the probe to determine the presence or absence and optionally the amount of two or more target polynucleotides in the sample.

[0048] The hybridization region of at least one probe of the group includes one or more unnatural nucleotides. The one or more unnatural nucleotides present in the hybridization region of the probe increase or decrease the duration of the current blockage due to the hybridization of the probe with its target polynucleotide, such that the proportion of current blockages occurring within a defined window is increased due to the interaction of the hybridized probe with the pore, as compared to when corresponding one or more natural nucleotides are present in the hybridization region. The duration of the current blockage obtained using a hybridization sequence containing unnatural nucleotides can be increased or decreased, for example, by about 50%, about 20%, about 10%, about 5% or about 1% compared to the duration of the current blockage obtained using a hybridization sequence without unnatural nucleotides. This allows the determination of the presence or absence of the target polynucleotide by measuring only the current blockages falling within the defined window. Current blockages caused by components in the sample can be excluded from the analysis, apart from those in the hybridized pores. The additional components can include, for example, one or more of non-target polynucleotides, folded and unfolded proteins, peptides, carbohydrates, short polymers, and cell debris. Thus, the method of the present invention is particularly suitable for analyzing dirty samples or samples with complex matrices, such as biological samples and / or samples containing one or more of the target polynucleotides at low concentrations. The low concentration can be, for example, a concentration measured in femtomoles, attomoles, micromoles or nanomoles.

[0049] The output from the assay can be analyzed in real time, allowing the assay to be stopped when sufficient information has been obtained. The method allows the detection of multiple polynucleotides in a single sample with minimal or no sample preparation, such as a bodily fluid sample taken directly from a patient, thus allowing the method to be performed by personnel with minimal training or qualification. This removes or reduces the need for steps involving washing steps or removing unbound probes and / or polynucleotides in sample preparation.

[0050] Sample

[0051] The sample can be any suitable sample. A suitable sample is one that is suitable for the method described herein. The method is typically performed on a sample known or suspected to contain at least one of the target polynucleotides, such as at least two or more. The method allows the detection of the target polynucleotide in the presence of other components in the sample. The method filters out the current blockages generated by the interaction of the probe with its target polypeptide from the current blockages generated by other components present in the sample. Such other components include, but are not limited to, for example, one or more of the following: proteins, peptides, carbohydrates, polymers such as non-target polynucleotides, which can be folded or unfolded; and cell debris.

[0052] The sample can be a biological sample. This method can be carried out in vitro on a sample obtained or extracted from any organism or microorganism. The organism or microorganism is usually an archaeon, a prokaryotic or eukaryotic microorganism, and usually belongs to one of the following five kingdoms: Plantae, Animalia, Fungi, Prokaryotae, and Protista. This invention can be carried out in vitro on a sample obtained or extracted from any virus.

[0053] The sample can be a fluid sample. In one embodiment, the sample can include a body fluid. The body fluid can be obtained from a human or an animal. The human or animal may have, be suspected of having, or be at risk of having a disease. The sample can be urine, lymph fluid, saliva, mucus, semen, or amniotic fluid, but preferably is whole blood, plasma, or serum. Usually, the sample is derived from a human, but alternatively it can be from another mammal, such as from a commercially farmed animal, such as a horse, cow, sheep, or pig, or alternatively can be a pet, such as a cat or dog. The sample can be a cell suspension or a tissue homogenate.

[0054] Alternatively, a sample derived from a plant is usually obtained from an economic crop, such as a cereal, legume, fruit, or vegetable, for example wheat, barley, oats, rapeseed, corn, soybeans, rice, bananas, apples, tomatoes, potatoes, grapes, tobacco, kidney beans, lentils, sugarcane, cocoa, cotton, tea, or coffee.

[0055] The sample can be a non-biological sample. The non-biological sample is preferably a fluid sample. Examples of non-biological samples include surgical fluids, water, such as drinking water, seawater, or river water, and laboratory test reagents.

[0056] The sample can be processed before the assay, for example by centrifugation or filtration through a membrane to remove unwanted molecules or cells such as red blood cells. The measurement can be carried out immediately after the sample is taken. Usually, the sample can also be stored before the assay, for example at -70 °C or at a temperature below -70 °C.

[0057] Target polynucleotide

[0058] A probe set or probe can be used to determine the presence, absence, or amount of one or more target polynucleotides, such as 1, 2, 5, 10, 15, 20, 30, 40, 50, 100, 500, 1000, 1500, 1750, 2000, or more target polynucleotides. Preferably, the probe set or probe can be used to determine the presence, absence, or amount of about 1 to about 2000 polynucleotides, such as about 5 to about 1500 polynucleotides, about 10 to about 1000 polynucleotides, about 20 to about 500 polynucleotides, or about 50 to about 100 polynucleotides.

[0059] A polynucleotide is a macromolecule that includes two or more nucleotides. A target polynucleotide can include any combination of any nucleotides. The nucleotides can be naturally occurring or artificial. One or more nucleotides in the target polynucleotide can be oxidized or methylated. One or more nucleotides in the target polynucleotide can be damaged. For example, the polynucleotide can include pyrimidine dimers. Such dimers are typically associated with damage caused by ultraviolet light and are a major cause of cutaneous melanoma. One or more nucleotides in the target polynucleotide can be modified, for example, with a label or tag.

[0060] The target polynucleotide can be single-stranded or double-stranded. At least a portion of the polynucleotide can be double-stranded. The target polynucleotide is preferably single-stranded. The target polynucleotide can be one strand from a double-stranded polynucleotide. The polynucleotide can be a nucleic acid, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The polynucleotide can include an RNA strand that hybridizes to a DNA strand. The polynucleotide can be any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), or other synthetic polymers having nucleotide side chains. The polynucleotide can include any of the nucleotides discussed herein, including abasic and modified nucleotides.

[0061] The target polynucleotide can be a polynucleotide secreted from a cell. Alternatively, the target polynucleotide can be a polynucleotide present inside a cell, such that the polynucleotide must be extracted from the cell before the present invention can be carried out.

[0062] The target polynucleotide can be of any length. For example, the length of the polynucleotide can be at least 7, at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400 or at least 500 nucleotides or nucleotide pairs. For example, the length of the polynucleotide can be from about 7 to about 200 nucleotides, from about 10 to about 500 nucleotides, from about 50 to about 400 nucleotides, from about 100 to about 300 nucleotides or from about 150 to about 250 nucleotides. The polynucleotide can be up to about 1000 or more nucleotides, up to about 5000 or more nucleotides or up to about 100000 or more nucleotides. The target polynucleotide can be an oligonucleotide. An oligonucleotide is a short nucleotide polymer which typically has 50 or fewer nucleotides, such as 40 or fewer, 30 or fewer, 20 or fewer, 10 or fewer or 5 or fewer nucleotides. The length of the target oligonucleotide is preferably from about 15 to about 30 nucleotides, such as a length of from about 20 to about 25 nucleotides. For example, the length of the oligonucleotide can be about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29 or about 30 nucleotides.

[0063] The target polynucleotide can be any set of polynucleotides. For example, the set can be associated with a particular phenotype. The set can be associated with a particular type of cell. For example, the set can indicate bacterial cells. The set can indicate viruses, fungi or parasites.

[0064] The target polynucleotide can be a set composed of two or more polynucleotides which are biomarkers associated with a particular disease or condition. Biomarkers can be used to diagnose or predict a disease or condition. Suitable sets of biomarkers are known in the art, such as those described in Edwards et al. (2008) Mol. Cell. Proteomics, 7, p1824 - 1837; Jacquet et al. (2009) Mol. Cell. Proteomics, 8, p2687 - 2699; Anderson et al. (2010) Clin. Chem. 56, 177 - 185. The disease or condition is preferably cancer, heart disease, including coronary heart disease and cardiovascular disease, or an infectious disease such as sepsis.

[0065] The target oligonucleotide or polynucleotide is preferably a microRNA (or miRNA) or siRNA. siRNA is a class of double-stranded RNA molecules, 20 to 25 base pairs in length, similar to miRNA. A group of two or more target oligonucleotides or polynucleotides is preferably a group of two or more miRNAs. miRNAs suitable for use in the present invention are well known in the art. For example, suitable miRNAs are stored in publicly available databases (Jiang et al., (2009) “miR2Disease: A manually curated database for microRNA dysregulation in human diseases” Nucleic Acids Res. 37 (Database issue): D98 to 104).

[0066] Probe set

[0067] The method includes contacting a sample with a group of two or more probes. In one aspect, the present invention also provides a group of two or more probes. The group of two or more probes can be used to determine the presence, absence, or amount of one or more target polynucleotides in a sample. Each of the two or more probes includes a non-hybridizing region and a hybridizing region, as described below. Each probe in the group can further include an anchor that allows it to be attached to a membrane. Exemplary anchors are lipid-binding molecules such as cholesterol.

[0068] In a probe set, the non-hybridizing regions of at least two of the probes, such as at least three, at least four, at least five, or more of the probes in the group, are different from each other. In a method of determining the presence, absence, or amount of at least two target polynucleotides using such a probe set, the target polynucleotides hybridize to each of the at least two probes. In one embodiment, each probe (i.e., each type of probe) in the group includes a unique non-hybridizing region. The differences between the different non-hybridizing regions of the probes in the group may contribute to the uniqueness of the effect of each probe on the current flowing through the pore.

[0069] A probe set generally includes multiple copies of each or every probe in the group. If a target polynucleotide is present in a sample, there are almost certainly multiple instances of the target polynucleotide present in the sample.

[0070] Preferably, each of the hybridizing regions of each of the probes is unique such that when multiple copies of a target polynucleotide are present in a sample, the target polynucleotide hybridizes only to one type of probe in the sample. In other words, preferably no two probes (i.e., no two types of probes) in the group include the same hybridizing region. This means that when a target polynucleotide is present in a sample, it always produces the same unique current blockage, which is primarily determined by the non-hybridizing region of the probe to which it binds.

[0071] In one embodiment, two or more probes in a group can include the same hybridization region and different non-hybridization regions. In this embodiment, the distinctiveness of the effect of each probe on the current flowing through the pore is typically provided by the differences between the non-hybridization regions. In this embodiment, two (or more) probes target the same target polynucleotide. This can provide an internal control because positive signals from both probes are required to infer the presence of the target polynucleotide in the sample.

[0072] Two or more probes in a group can include different hybridization regions and the same non-hybridization regions. In this embodiment, the distinctiveness of the effect of each probe on the current flowing through the pore is typically provided by the differences in the hybridization regions. The hybridization regions are designed such that they produce current blockades with similar durations. Thus, any differences can be subtle. Accordingly, this embodiment is particularly suitable for situations where it is not desired to distinguish between different target polynucleotides, or where the hybridization regions bind to different parts of the same target polynucleotide.

[0073] In one embodiment, each probe (i.e., each type of probe) in a group includes a different hybridization region and a different non-hybridization region. In other words, each probe in the group has a unique hybridization region and a unique non-hybridization region. In this embodiment, both the hybridization region and the different non-hybridization regions typically contribute to the distinctiveness of the effect of each of two or more probes on the current flowing through the pore. This helps to distinguish different target polynucleotides present in the sample.

[0074] The group can include any number of two or more probes, such as 2, 5, 10, 15, 20, 30, 40, 50, 100 or more probes. The group preferably has from about 4 to about 100 probes, such as from about 5 to about 80 probes, from about 10 to about 60 probes or from about 20 to about 50 probes. The number of probes in the group (i.e., the types of probes) is typically the same as or greater than the number of target polynucleotides to be detected. If the number of probes in the group is greater than the number of target polynucleotides, two or more probes can target the same target polynucleotide, and the method of the present invention includes an internal control as described above.

[0075] The probes can be of any length. For example, the length of the probes can be from about 17 to about 240 nucleotides. For example, from about 20 to about 200 nucleotides, from about 30 to about 150, from about 40 to about 100 or from about 50 to about 70 nucleotides. The probes can be single-stranded, or can include one or more, such as two or three single-stranded portions and one or more, such as two or three double-stranded portions. The probes can include one or more linkers between the hybridization region and the non-hybridization region.

[0076] The hybridizing region and the non-hybridizing region can be located anywhere in the probe. The non-hybridizing region can be 3' or 5' of the hybridizing region. Preferably, the non-hybridizing region is 5' of at least one of the probes in the group and preferably all of the hybridizing regions.

[0077] In one embodiment, at least one of the probes comprises a single hybridizing region and a single non-hybridizing region, e.g., the probe consists of or consists essentially of a single hybridizing region and a single non-hybridizing region. Generally, all of the probes in the group have the same basic structure, e.g., contain the same number of hybridizing regions and non-hybridizing regions in the same orientation within the probe.

[0078] In some embodiments, at least one of the probes can further comprise a second non-hybridizing region and a second hybridizing region, a quadruplex-forming sequence, or a double-stranded region between the first non-hybridizing region and the second non-hybridizing region, in addition to the first non-hybridizing region.

[0079] Preferably, all of the probes in the group have the same overall structure. For example, all of the probes can have the same arrangement of hybridizing and non-hybridizing regions and, if present, can have a quadruplex-forming sequence and / or a double-stranded region. In this embodiment, the window of measured current blockage can encompass the current blockage resulting from the interaction of the entire probe with the pore. This is preferably the case where all of the probes have the same overall structure. Alternatively, the current blockage within the measured window can be a partial current blockage, each block corresponding to the time that the non-hybridizing region of the probe interacts with the barrel or channel of the pore before the hybridizing region adjacent to the non-hybridizing region in the pore dehybridizes. This is preferably the case where the probes have different overall structures, particularly where the probes have different numbers of hybridizing regions.

[0080] The two hybridizing regions can bind to the same target polynucleotide or two different target polynucleotides. When the two hybridizing regions bind to different target polynucleotides, the target polynucleotides are preferably related in some way, e.g., indicating the same disease or condition.

[0081] Preferably, both of the hybridizing regions bind to the same target polynucleotide and can be the same such that they bind to the same region of the target polynucleotide or can bind to different portions of the same target polynucleotide. In either case, the non-hybridizing region preferably results in a current blockage within a predefined window.

[0082] When the probe comprises a quadruplex-forming region or a double-stranded region, the quadruplex or double-stranded region cannot pass through the pore, causing the second non-hybridizing region to remain in the pore and enabling the measurement of the current characteristics of the second non-hybridizing region. The time that the second non-hybridizing region remains in the pore generally results in a current blockage within the same window as the current blockage resulting from the hybridization of the target polynucleotide with the hybridizing region of the probe holding the first non-hybridizing region in the pore.

[0083] Thus, when the target polynucleotide is present in a sample, it will result in a current blockage having a portion characteristic of the first non-hybridizing region and another portion characteristic of the second non-hybridizing region. The first non-hybridizing region and the second non-hybridizing region can be the same or different.

[0084] Using the second non-hybridizing region to bind to a second hybridizing region, a quadruplex-forming region, or a double-stranded region enables the discrimination of a greater number of target polynucleotides using the same number of different non-hybridizing regions. For example, when each probe in a set includes a single hybridizing region and a single non-hybridizing region, six different non-hybridizing regions, each including a different "barcode", can be used to discriminate six different target polynucleotides. However, when each probe in a set includes two non-hybridizing regions, 36 different combinations of non-hybridizing regions are possible, and thus the set can be used to detect 36 different target polynucleotides.

[0085] In at least one, and preferably all, of the probes in the set, the hybridizing region or regions are located at the end of the probe, which can be the 3'-end or the 5'-end.

[0086] The hybridizing and non-hybridizing regions of the probe can be attached directly or can be linked by a linker. Any suitable linker can be used. The linker is preferably a polymer. The polymer is preferably a polynucleotide, a polypeptide, or polyethylene glycol (PEG).

[0087] In one preferred embodiment, one or more of the probes further includes an anchor that allows it to be coupled to a membrane.

[0088] Hybridizing region

[0089] The hybridizing region specifically binds to the target polynucleotide. Preferably, the hybridizing region binds to the target polynucleotide with an affinity that is at least 10-fold greater, such as at least 50-fold, at least 100-fold, at least 200-fold, at least 300-fold, at least 400-fold, at least 500-fold, at least 1000-fold, or at least 10,000-fold greater, than its affinity for other (non-target) polynucleotides, for example under conditions suitable for performing the methods described herein. Affinity can be measured using known binding assays, such as those utilizing fluorescence and radioisotopes. Competitive binding assays are also known in the art. Preferably, the hybridizing region does not bind to any other oligonucleotide or polynucleotide (any non-target polynucleotide) by base pairing.

[0090] Most preferably, even under high stringency conditions, the hybridizing region does not hybridize to any other oligonucleotide or polynucleotide (any non-target polynucleotide).

[0091] The hybridization region typically comprises a nucleic acid sequence that is at least partially complementary to the target polynucleotide. In a preferred embodiment, the hybridization region is a polynucleotide, such as DNA or RNA. The hybridization is typically single-stranded.

[0092] The hybridization region can have at least 90%, such as at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% nucleotide identity with the complementary sequence of the target polynucleotide over the entire length of the target polynucleotide or within a region of at least 10, 20 or 30 nucleotides of the target polynucleotide. The hybridization region can be identical to the complementary sequence of the target polynucleotide over its entire length or identical to a region of at least 10, 20 or 30 nucleotides of the target polynucleotide, except at one or more sites where one or more natural nucleotides are replaced by one or more unnatural nucleotides.

[0093] Different hybridization regions bind to the target polynucleotide to different extents, e.g., having different binding constants. A hybridization region that binds to the target polynucleotide with greater strength will generally prevent the probe from moving through the pore for a longer period of time, and this can be identified by measuring the current flowing through the pore. The converse is also true, e.g., a hybridization region that binds to the target polynucleotide with less strength will prevent the probe from moving through the pore for a shorter time, and this can be identified by measuring the current flowing through the pore.

[0094] By introducing one or more base pair mismatches, the strength of binding to the target polynucleotide can be reduced under the conditions used in methods for determining the presence, absence or amount of two or more target polynucleotides. In a preferred embodiment, when used in a method for determining the presence, absence or amount of two or more target polynucleotides as described herein by introducing one or more unnatural nucleotides into the hybridization region of the probe, the binding strength of the probe to its target polynucleotide can be adjusted to provide a defined dwell time for the hybridization probe. The hybridization region of at least one of the probes comprises one or more unnatural amino acids to increase or decrease the binding strength, e.g., to increase or decrease the length of time the hybridization probe interacts with the pore.

[0095] When the non-hybridization region of the probe is within the barrel of the transmembrane pore, the site at which the unnatural amino acid is introduced can be important for determining the length of time the probe remains bound to the target polynucleotide. For example, an unnatural amino acid that weakens the interaction between the hybridization region of the probe and the target polynucleotide can be present at the end of the hybridization region that abuts the non-hybridization region to facilitate dehybridization and shorten the dwell time of the hybridization probe.

[0096] Design a probe set such that when contacting a transmembrane pore under an applied potential, the hybridization region of each probe in the set remains bound to its respective target polynucleotide for a similar period of time. This is achieved by introducing at least one unnatural nucleotide into the hybridization region of one or more probes in the set. One or more unnatural nucleotides can be introduced into the hybridization region of some or all of the probes in the set. For example, two to 100, such as five to 80 or 10 to 50 probes in the set can contain one or more unnatural nucleotides. The exact number depends on the size of the set and the length and sequence of the hybridization region. For example, about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the probes in the set can include one or more unnatural nucleotides.

[0097] The hybridization region can be of any length provided that the desired residence time is achieved. For example, when contacting a transmembrane pore under an applied potential, when bound to its respective target polynucleotide, the residence time of the probes in the set is similar. The length of the hybridization region is typically at least 10 nucleotides, such as about 15 to about 50, about 20 to about 40 or about 25 to about 30 nucleotides in length, preferably about 18 to about 25 nucleotides.

[0098] All or some of the nucleotides in the hybridization region can be unnatural nucleotides. The hybridization region can, for example, include one to about 50, such as two to about 40, three to about 30 or five to about 20 or about 10 to about 15 unnatural nucleotides, such as six, seven, eight or nine unnatural nucleotides, to achieve the desired dehybridization. For example, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20% or more, such as up to about 50% of the nucleotides in the hybridization region can be unnatural. In the probe set, zero, one, two or more of the probes can include only natural nucleotides in the hybridization region, provided that at least one, such as two or more, for example three, four, five, six, seven, eight, nine or 10 or more of the probes include a hybridization region that includes at least one unnatural nucleotide.

[0099] Unnatural nucleotides are nucleotides that do not exist in nature. Unnatural nucleotides generally contain a nucleobase, a sugar, and at least one phosphate group, wherein one of the components of the nucleotide is modified. Unnatural nucleotides can include modified sugars and / or modified nucleobases. Preferably, unnatural nucleotides include modified sugars or modified nucleobases. Modified sugars include, but are not limited to, 2'-O-methyl ribose. Unnatural nucleotides can be peptide nucleic acids (PNA), locked nucleic acids (LNA), unlocked nucleic acids (UNA), bridged nucleic acids (BNA), or morpholino, phosphorothioate, or methylphosphonate. Modified nucleobases of unnatural nucleotides include, but are not limited to, tricyclic cytosine analogs, 2-aminopurine, 5-methylcytosine, C(5)-propargyl cytosine, C(5)-propargyl uracil, 2-aminopurine, and 6-azapyrimidine.

[0100] Unnatural nucleotides can be nucleotides that hybridize to all nucleotides in a target polynucleotide to some extent. Unnatural nucleotides are preferably nucleotides that hybridize to nucleotides including nucleoside adenosine (A), thymine (T), uracil (U), guanine (G), and cytosine (C).

[0101] Unnatural nucleotides can be universal nucleotides. Universal nucleotides can be included in a hybridization region, but specificity is impaired. Universal nucleotides can be included in a hybridization region where it is desired to detect more than one target polynucleotide, where discrimination between similar target polynucleotides is not necessary. Universal nucleotides are nucleotides that hybridize or bind to all nucleotides in a template polynucleotide to some extent. Universal nucleotides are preferably nucleotides that hybridize or bind to nucleotides including nucleoside adenosine (A), thymine (T), uracil (U), guanine (G), and cytosine (C). Compared to the hybridization or binding strength with other nucleotides, universal nucleotides can hybridize or bind to some nucleotides with greater strength. For example, a universal nucleotide (I) including a nucleoside and 2'-deoxy will show a preferential order of pairings of I-C > I-A > I-G ≈ I-T.

[0102] Unnatural nucleotides in a probe can be attached to other unnatural nucleotides or natural nucleotides in the probe in any manner. Unnatural nucleotides and natural nucleotides are generally attached through their sugars and phosphate groups, as in nucleic acids. Unnatural nucleotides or natural nucleotides can be linked through their nucleobases, as in pyrimidine dimers.

[0103] Non-natural nucleotides can be introduced into a probe to increase the residence time of the probe upon hybridization to its target polynucleotide. The term non-natural nucleotides is intended to include all nucleotides other than guanine, cytosine, thymine, and adenine. Non-natural nucleotides include modified or non-classical bases. Non-natural nucleotides that increase residence time include, but are not limited to, 2'-O-methyl-RNA bases. Other non-natural nucleotides include, for example, locked nucleic acid (LNA), peptide nucleic acid (PNA), bridged nucleic acid (BNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), morpholino, propenyl deoxyuridine, and propenyl deoxycytidine. In fact, the nucleotides introduced into the probe can be natural or non-natural, as long as the Tm of the duplex is altered / improved to change the residence time.

[0104] If the residence time of a hybridization probe containing non-natural nucleotides is greater than the residence time of a hybridization probe, the residence time of the hybridization probe is considered to have increased. The hybridization probe is different from a hybridization probe containing only non-natural nucleotides in that it includes natural nucleotides complementary to the target sequence at the position of the non-natural nucleotides.

[0105] Non-natural nucleotides can be introduced into a probe to decrease the residence time of the probe upon hybridization to its target polynucleotide. Non-natural nucleotides that decrease the residence time of a repeat unit include, but are not limited to, 2-aminopurine, unlocked nucleic acid (UNA), phosphorothioate, methylphosphonate, and 6-azapyrimidine. 2-Aminopurine can replace dA in an oligonucleotide. It is a natural fluorescent base sensitive to the local environment, making it a useful probe for monitoring the structure and dynamics of DNA hairpins and detecting the base stacking state of duplexes. 2-Aminopurine can be labile and can slightly decrease the Tm. The effect of UNA on the Tm depends on the construct, sugar type, and position. However, typically, each replacement of UNA decreases the Tm by 5 °C to 10 °C. However, excessive UNA modification in an oligonucleotide can hinder duplex hybridization. Generally, phosphorothioate slightly decreases the Tm of an RNA duplex, methylphosphonate decreases the Tm more, and UNA will have the greatest effect. If the residence time of a hybridization probe containing non-natural nucleotides is less than the residence time of a hybridization probe, the residence time of the hybridization probe is considered to have decreased. The hybridization probe is different from a hybridization probe containing only non-natural nucleotides in that it includes natural nucleotides complementary to the target sequence at the position of the non-natural nucleotides.

[0106] The unnatural nucleotide can be a nucleobase - free nucleotide. By including one or more nucleobase - free nucleotides in the hybridization region, the residence time can be reduced. However, the inclusion of nucleobase - free residues will compromise specificity. Nucleobase - free nucleotides can be included in the hybridization region where it is desired to detect more than one target polynucleotide, but it is not necessary to distinguish between similar target polynucleotides. A nucleobase - free nucleotide is a nucleotide lacking a nucleobase. Nucleobase - free nucleotides generally contain a sugar and at least one phosphate group. The sugar is usually a pentose, such as ribose and deoxyribose. Nucleobase - free nucleotides are generally nucleobase - free ribonucleotides or nucleobase - free deoxyribonucleotides. Nucleobase - free nucleotides generally contain a monophosphate, diphosphate, or triphosphate. The phosphate can be attached to the 5' or 3' side of the nucleobase - free nucleotide.

[0107] By including one or more base - pair mismatches in the hybridization region, the residence time can be reduced. However, the inclusion of base - pair mismatches will compromise specificity. Base - pair mismatches can be included in the hybridization region where it is desired to detect more than one target polynucleotide, but it is not necessary to distinguish between similar target polynucleotides.

[0108] The residence time can be fine - tuned by varying the number of unnatural nucleotides in the hybridization region and / or by varying the distribution pattern of the unnatural nucleotides in the hybridization region. Generally, increasing the number of unnatural nucleotides that increase the residence time in the hybridization region will further increase the residence time.

[0109] For example, a hybridization region with unnatural nucleotides that increase the residence time, uniformly distributed along the length of the hybridization region, will result in a longer residence time than a hybridization region with the same number of the same unnatural nucleotides aggregated at one end of the hybridization region. Increasing the number of adjacent unnatural nucleotides, which increases the residence time in the hybridization region, will further increase the residence time in the pattern. For example, a hybridization region with a pattern of unnatural and natural nucleotides with a sequence of Z X N Y or N Y Z X , where Z is an unnatural nucleotide and N is a natural nucleotide, where X is 1 and Y is 1 will result in a shorter residence time than X is 2 and Y is 1, and where X is 2 and Y is 1 will result in a shorter residence time than X is 3 and Y is 1.

[0110] The hybridization region can comprise or consist of a pattern of natural and unnatural nucleotides. The hybridization region preferably comprises Z X N Y and / or NY Z X The pattern of one or more instances of, or consisting of, Z, where Z is a non-natural nucleotide and N is a natural nucleotide. The pattern can be regular or irregular. The hybridization region can include Z X N Y One or more instances of, or consisting of, N. The hybridization region can include N Y Z X One or more instances of, or consisting of, Z. The hybridization region can include Z X N Y and N Y Z X One or more instances of, or consisting of, Z. The hybridization region preferably includes Z X N Y and / or N Y Z X Two, three, four, five, six, seven, eight, nine, or ten instances of, or consisting of, Z.

[0111] If there are two or more non-natural nucleotides in the hybridization region, the non-natural nucleotides can be the same or different. Preferably, all instances of Z in the hybridization region are the same type of non-natural nucleotide.

[0112] N is typically complementary to one of the nucleotides in the target polynucleotide. Z is preferably complementary to one of the nucleotides in the target polynucleotide. It is straightforward for a person skilled in the art to identify complementary nucleotides. If a nucleotide hybridizes with another nucleotide by base pairing, preferably Watson and Crick base pairing, the nucleotide is complementary to the other nucleotide. Complementary nucleotides can hybridize with other nucleotides that are not complementary to them, but to a lesser extent than with their complementary nucleotides. N preferably includes one of the nucleobases adenine (A), uracil (U), guanine (G), or cytosine (C). Alternatively, N preferably includes the nucleobases A, thymine (T), G, or C. A is complementary to T or U, and vice versa. G is complementary to C, and vice versa.

[0113] For Z X N Y and / or N Y Z X , X is 1, 2, 3, 4, 5, or 6, and Y is 1, 2, 3, 4, 5, or 6. Z X N Y and / or N Y Z X The pattern of, and / or N, is preferably regular. This allows for the uniform distribution of non-natural nucleotides throughout the hybridization region. In particular, X and / or Y in Z X N Y and / or N YZ X can be the same in different instances of Z. Both X and Y are preferably in Z X N Y and / or N Y Z X the same in different instances, i.e., in different hybridization regions of the probes in the group. For example, in Z X N Y and / or N Y Z X at least one instance of: (i) X is 1 and Y is 1; (ii) X is 2 and Y is 2; (iii) X is 3 and Y is 3; (iv) X is 4 and Y is 4; (v) X is 5 and Y is 5; (vi) Y is 1 and Z is 2, 3, 4, 5 or 6; (vii) Y is 2, 3, 4, 5 or 6 and Z is 1; (viii) Y is 2 and Z is 2, 3, 4, 5 or 6; (viii) Y is 2, 3, 4, 5 or 6 and Z is 2; (ix) Y is 3 and Z is 3, 4, 5 or 6; or (x) Y is 3, 4, 5 or 6 and Z is 3. One or more, optionally all, of the hybridization regions can have a regular pattern.

[0114] One or more, optionally all, of the hybridization regions in the probes in the group can comprise or consist of:

[0115] (a) ZN-ZN-ZN-ZN-ZN-ZN;

[0116] (b) NZ-NZ-NZ-NZ-NZ-NZ;

[0117] (c) ZZNN-ZZNN-ZZNN;

[0118] (d) NNZZ-NNZZ-NNZZ;

[0119] (e) ZZZNNN-ZZZNNN;

[0120] (f) NNNZZZ-NNNZZZ;

[0121] (g) ZZZZNNNN-ZZZZNNNN;

[0122] (h) NNNNZZZZ-NNNNZZZZ;

[0123] (i) ZN-ZN-ZN-ZN;

[0124] (j) NZ-NZ-NZ-NZ;

[0125] (k) ZZNN-ZZNN;

[0126] (l) NNZZ-NNZZ;

[0127] (m) ZZZZNNNN;

[0128] (n) NNNNZZZZ;

[0129] (o) ZZN-ZZN-ZZN;

[0130] (p) NNZ-NNZ-NNZ;

[0131] (q) ZZZN-ZZZN-ZZZN-ZZZN;

[0132] (r) NNNZ-NNNZ-NNNZ-NNNZ;

[0133] (s) ZZZN-ZZZN-ZZZN; or

[0134] (t) NNNZ-NNNZ-NNNZ

[0135] (u) NNNNZ-NNNNZ-NNNNZ

[0136] (v) ZNNNN-ZNNNN-ZNNNN

[0137] (w) NNNNNZ-NNNNNZ-NNNNNZ

[0138] (x) ZNNNNN-ZNNNNN-ZNNNNN.

[0139] In the above, "-" is used for the purpose of separating Z X N Y or N Y Z X of the repeating units. The same applies hereinafter.

[0140] Z X N Y and / or N Y Z X The pattern of and / or N X N Y and / or N Y Z X can be irregular. In particular, X and / or Y in Z X N Y and / or N Y Z X can be different in different instances. X and Y are more preferably different in Z X N Y and / or N Y Z XIn at least one instance, X is 2 and Y is 1; X is 1 and Y is 2; X is 3 and Y is 1; or X is 1 and Y is 3. At least one and optionally all of the hybridization regions may have an irregular pattern.

[0141] One or more, optionally all, of the hybridization regions in the probes of the group may comprise or consist of:

[0142] (aa) NZ-ZNN-ZZNN-ZZN;

[0143] (bb) ZN-NZZ-NNZZ-NNZ;

[0144] (cc) NNZZ-ZZNN-NNNZZZ-ZNN;

[0145] (dd) ZZNN-NNZZ-ZZZNNN-NZZ;

[0146] (ee) NNZZ-ZZNN;

[0147] (ff) ZZNN-NNZZ;

[0148] (gg) NZZ-NNZ-ZNN-ZZN;

[0149] (hh) ZNN-ZZN-NZZ-NNZ;

[0150] (ii) NZZ-NNZ-ZN; or

[0151] (jj) ZNN-ZZN-NZ

[0152] The probe set generally includes probes having hybridization regions that include different patterns of natural and unnatural nucleotides, which may be regular or irregular, and may include at least one hybridization region that consists of only natural nucleotides to optimize the residence time of the probes in the set, i.e., when their respective target polynucleotides are present in the sample, all of the probes in the set have a residence time within a defined window.

[0153] Defined residence time window

[0154] If the residence times are within 10 seconds or less of each other, preferably within 5 seconds, 2 seconds, 1 second, 0.5 second, 0.2 second, or 0.1 second or less of each other, the residence times are considered similar or substantially the same. The residence times are most preferably within 1 second or less of each other.

[0155] In a method for determining the presence, absence or amount of two or more target polynucleotides, the duration of current blockage caused by at least two of the probes in the group, such as 3, 4, 5, 6, 10 or all of the probes, hybridizing to their respective target polynucleotides can be within 10 seconds or less time of each other, preferably within 5 seconds or less time, preferably within 2 seconds or less time, 1 second or less, 0.5 second or less, 0.2 second or less or 0.1 second of each other.

[0156] Thus, in some embodiments, the defined window can have a total width of 10 seconds, 5 seconds, 4 seconds, 3 seconds, 2 seconds, 1 second, 0.5 second or 0.2 second. For example, a 10 - second window can capture current blockages from 0.01 second to 10 seconds, 1 second to 11 seconds, 5 seconds to 15 seconds, etc. Current blockages with a duration shorter than the defined window or longer than the defined window are not measured.

[0157] The term "measure" is intended to mean detect and analyze. All current blockages generated by the interaction of the components of the sample with the pore will be detected. However, only the current blockages falling within the window of interest will be measured in a method for determining the presence, absence or amount of two or more target polynucleotides.

[0158] In one embodiment, due to the interaction of the hybridization probe with the pore, substantially all current blockages occur within the window and / or most of the current blockages occurring outside the window are due to additional components in the sample.

[0159] Non - hybridized region

[0160] The non - hybridized region includes a portion capable of entering the pore. The non - hybridized region is typically a linear molecule that can enter and pass through the barrel or channel of the pore. When the non - hybridized region enters the pore, it affects the current flowing through the pore in a manner specific to the portion of the non - hybridized region present in the barrel or channel.

[0161] The non - hybridized region has a different effect on the current flowing through the pore depending on whether the probe is hybridized to its target polypeptide. When the target polynucleotide is not bound to the probe, the non - hybridized region in each probe affects the current flowing through the pore in one way, and when the target polynucleotide is bound to the probe, it affects the current flowing through the pore in a different way. This allows the use of the method to determine the presence or absence of the target polynucleotide.

[0162] Hybridization of the probe to the target polynucleotide affects the time it takes for the probe to move through the pore. In the absence of the target polynucleotide, the probe passes through the pore quickly. When the pore hybridizes with its target polynucleotide, the passage of the probe through the pore is hindered.

[0163] Typically, when a probe is not hybridized to its target polynucleotide, it rapidly passes through the pore under the applied potential. The current blockades generated by the unhybridized probes in the group generally have a short duration that falls outside a defined window where the current blockades are measured.

[0164] Without wishing to be bound by theory, for a period of time, the movement of the entire probe through the pore is blocked (i.e., delayed) by the hybridized target polynucleotide. Double-stranded polynucleotides are generally too large to move through the barrel or channel of the pore. After a moment, under the influence of the potential, the target polynucleotide is released from the probe, and the entire probe is able to move through the pore. Once the probe has exited the pore, the current flowing through the pore returns to the level seen when no sample and probe group are present. Each hybridized probe affects the current flowing through the pore for a specific amount of time ("dwell time"). When the target polynucleotide is present in the sample, the duration of the current blockade caused by the hybridized probe can be controlled by modifying the hybridization region of the probe as discussed herein.

[0165] The current blockades resulting from the interaction of each of the hybridized probes can be distinguished based on differences in the current blockades generated by differences between the non-hybridized region of the probe and optionally the hybridized region of the probe (e.g., differences in signal level, signal pattern, signal deviation).

[0166] The pore includes a barrel or channel and may include a vestibule. The barrel or channel generally allows the non-hybridized region of the probe to enter, but does not allow the double-stranded hybridized region of the probe, e.g., the region of the hybridization pore including the hybridization region and the target polynucleotide, to enter. For a particular pore, the non-hybridized region suitable for inclusion in the probe group can be designed based on, for example, the known length of the barrel or channel, and where the vestibule of the pore is present.

[0167] The non-hybridized region of the probe can include any nucleotide discussed herein. In some embodiments, the non-hybridized region has a base-free leader sequence, where the leader sequence is the first region of the non-hybridized region for entering the pore. The leader sequence is generally single-stranded and can include, for example, 3 to 20, such as 5 to 15 or 8 to 12, e.g., 10 nucleotides. In some embodiments, the non-hybridized region includes at least two adjacent base-free residues, such as 3, 4, 5, 6, 7 or more adjacent base-free residues.

[0168] In a preferred embodiment, the non-hybridized region includes a polymer, such as a linear polymer. The polymer is capable of entering the pore and affecting the current flowing through the pore. The polymer is preferably a polynucleotide, polypeptide, polysaccharide, or polyethylene glycol (PEG). The non-hybridized region can include different polymer combinations.

[0169] The non-hybridizing region can be of any length. The tail preferably comprises a polynucleotide having a length of from about 7 to about 70 nucleotides, such as from about 10 to about 60, from about 20 to about 50, or from about 30 to about 40 nucleotides.

[0170] The non-hybridizing region can be a tail region as described in WO2013 / 121201.

[0171] The non-hybridizing region preferably comprises at least one single-stranded polynucleotide or polynucleotide region. Single-stranded polynucleotides are used in the non-hybridizing region because they can pass through the pore and can be easily separated into at least two different regions, which affect the current flowing through the pore in different ways. For example, different regions of polynucleotides having different sequences generally affect the current flowing through the pore in different ways. At least two different regions preferably correspond to at least two different segments of nucleotides. For example, a single-stranded polynucleotide region can include a segment of adenine nucleotides and a segment of abasic nucleotides. Each segment will affect the current flowing through the pore in a different way. Alternatively, at least two different segments of nucleotides are different polynucleotide barcodes. Polynucleotide barcodes are well known in the art (Kozarewa, I. et al., (2011), Methods Mol. Biol. 733, p279-298). A barcode is a specific sequence of a polynucleotide that affects the current flowing through the pore in a specific and known way.

[0172] The non-hybridizing region can include one or more unnatural nucleotides. For example, T k-mers (i.e., where the central nucleotide is a thymine-based k-mer, such as TTA, GTC, GTG, and CTA) generally have the lowest current state. Modified forms of T nucleotides can be introduced into the probe, particularly into the non-hybridizing region, to further reduce the current state and thereby increase the total current range seen when the modified polynucleotide moves through the pore.

[0173] G k-mers (i.e., where the central nucleotide is a guanine-based k-mer, such as TGA, GGC, TGT, and CGA) tend to be strongly affected by the other nucleotides in the k-mer, and thus modifying the G nucleotides in the probe, particularly in the non-hybridizing region, can help them have more independent current positions.

[0174] Including three copies of the same nucleotide instead of three different nucleotides can facilitate characterization because then only the location of, for example, a 3-nucleotide k-mer needs to be determined in the probe. However, such modification does reduce the information provided by the probe.

[0175] Including one or more abasic nucleotides results in characteristic current spikes. This allows the position of one or more nucleotides in the probe to be clearly highlighted.

[0176] In some embodiments, the non-hybridizing regions are unrelated to any target or non-target polynucleotides present in the sample or may be expected to be present in the sample. For example, the non-hybridizing regions may be less than about 70% complementary to any portion of the target polynucleotide, such as less than about 50%, less than about 30%, less than about 20%, or less than about 10%.

[0177] G-quadruplex

[0178] One or more in the group, such as all the probes may include sequences capable of forming a G-quadruplex between two non-hybridizing regions as defined above. The G-quadruplex-forming sequence also does not hybridize to the target polynucleotide. A G-quadruplex is a three-dimensional structure formed by four sequence strands.

[0179] The G-quadruplex cannot translocate or move through the narrowest part of the pore. The G-quadruplex is wider than the narrowest part of the pore. For example, the narrowest part of the wild-type α-HL pore has a diameter of 1.3 nm. The narrowest part of the α-HL-NN pore has a diameter of 1.5 nm. In embodiments using these pores, the G-quadruplex preferably has a width greater than 1.3 nm, such as greater than 1.5 nm, such as greater than 2 nm, greater than 3 nm, or greater than 5 nm. Those skilled in the art will be able to design G-quadruplexes of appropriate sizes for the pores used. When the G-quadruplex-forming sequence does not form a G-quadruplex, it is able to translocate or move through the narrowest part of the pore.

[0180] The G-quadruplex-forming sequence is preferably a polynucleotide. It can be any nucleotide discussed herein. For example, the G-quadruplex-forming sequence can have a length of about 10 to about 50 nucleotides, such as about 12 to about 40 nucleotides, about 14 to about 30 nucleotides, or about 16 to about 20 nucleotides.

[0181] The G-quadruplex can be any type of G-quadruplex. The G-quadruplex can be an intermolecular G-quadruplex, such as a bimolecular G-quadruplex or a tetramolecular G-quadruplex. The G-quadruplex-forming sequence preferably is capable of forming an intramolecular G-quadruplex.

[0182] The quadruplex-forming sequences are preferably capable of forming G-quadruplexes (also known as G-tetrads or G4-DNA). These are polynucleotide sequences that are rich in guanine and capable of forming a four-stranded structure. Four guanine bases can bind through Hoogsteen hydrogen bonds to form a square planar structure called a guanine tetrad, and two or more guanine tetrads can stack on top of each other to form a G-quadruplex. The quadruplex structure is further stabilized by the presence of cations, especially potassium, which are located in the central channel between each pair of tetrads. Formation of G-quadruplexes is well known in the art (Marathias and Bolton, Nucleic Acids Research, 2000; 28(9):1969-1977; Kankia and Marky, J. Am. Chem. Soc., 2001, 123, 10799-10804; and Marusic et al., Nucleic Acids Research, 2012, 1–11).

[0183] The quadruplex-forming sequences more preferably comprise the sequence Ga, followed by Nb, followed by Gc, followed by Nd, followed by Ge, followed by Nf, followed by Gg, where G is a nucleotide comprising guanine, where a, c, e, and g are independently selected from 1, 2, 3, 4, and 5, where N is any nucleotide, and where b, d, and f are from 2 to 50. The values of a, c, e, and g can be the same. G is preferably guanosine monophosphate (GMP), cyclic guanosine monophosphate (cGMP), deoxyguanosine monophosphate (dGMP), dideoxyguanosine monophosphate, N2-methyl-GMP, N2-methyl-cGMP, N2-methyl-dGMP, N2-methyl-dideoxyguanosine monophosphate, N2-methyl-06-methyl-GMP, N2-methyl-06-methyl-cGMP, N2-methyl-06-methyl-dGMP, N2-methyl-06-methyl-dideoxyguanosine monophosphate, 2'-O-methyl-GMP, 2'-O-methyl-cGMP, 2'-O-methyl-dGMP, 2'-O-methyl-dideoxyguanosine monophosphate, 6-thio-GMP, 6-thio-cGMP, 6-thio-dGMP, 6-thio-dideoxyguanosine monophosphate, 7-methyl-GMP, 7-methyl-cGMP, 7-methyl-dGMP, 7-methyl-dideoxyguanosine monophosphate, 7-deaza-GMP, 7-deaza-cGMP, 7-deaza-dGMP, 7-deaza-dideoxyguanosine monophosphate, 8-oxo-GMP, 8-oxo-cGMP, 8-oxo-dGMP, or 8-oxo-dideoxyguanosine monophosphate.

[0184] Suitable quadruplex-forming sequences are disclosed in WO2014 / 072703. The quadruplex-forming sequence preferably comprises the sequence shown in nucleotides 28 to 42 of SEQ ID NO: 1.

[0185] Since the quadruplex cannot translocate through the narrowest part of the pore, it acts as a brake and holds one of the non-hybridized regions in the narrowest part of the pore in the region. The non-hybridized region then generates a unique current for the recognition probe. After a moment, the quadruplex is usually destabilized under the influence of the applied potential and unfolding. Thus, the braking action of the quadruplex is usually temporary. The non-hybridized region is usually only temporarily held in the narrowest part of the pore. The unfolded quadruplex-forming sequence translocates or moves through the pore under the influence of the applied potential.

[0186] Double-stranded region

[0187] The double-stranded polynucleotide cannot pass through the pore and thus a double-stranded region can be included in the probes in the set instead of the quadruplex-forming sequence or the second hybridization region. In practice, the probe can be generated as a single-stranded molecule incorporating one strand of the double-stranded region between two non-hybridized regions. Then, before bringing the sample into contact with the set of probes or when the set of probes is in contact with the sample, the other strand of the double-stranded region can hybridize to the probe. The double-stranded region usually has the same sequence in each of the probes in the set. The presence of such a double-stranded region does not prevent the probe from moving through the pore but simply delays the movement of the probe through the pore because one of the strands in the double-stranded region is stripped from the probe under the influence of the potential. It can be seen that this delay is measured as the current flowing through the pore. The duration of the current block usually falls within the same window of current block durations because the current block is due to the delay caused by hybridization of the probes in the set to their respective target polynucleotides.

[0188] The duration of the current block generated by the double-stranded region can be adjusted to be suitable within a defined time window, for example, by changing the length of the double-stranded region, changing the degree of complementarity between the strands of the double-stranded region and / or changing the composition of the double-stranded region, such as by incorporating non-natural nucleotides as described herein for the hybridization region.

[0189] The double-stranded region can have a length of, for example, about 10 to about 50 nucleotides, such as about 12 to about 40 nucleotides, about 14 to about 30 nucleotides or about 16 to about 20 nucleotides.

[0190] The double-stranded region can include, for example, a first strand and a second strand, where the first strand is at least 70%, such as at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to the second strand. The inclusion of one or more double-stranded polynucleotide regions in each probe region increases the number of possible signals that can be obtained from the probe set and thus increases the number of target polynucleotides that can be assayed using the methods of the present invention.

[0191] For example, the double-stranded polynucleotide region can be used to hold a specific region of the non-hybridizing region, such as a barcode, which indicates the probe in the well or channel, and can thus be read in accordance with the present invention.

[0192] Linker

[0193] The different regions of the probes described herein can be directly linked or linked through one or more linkers. In some embodiments, the linker can be a peptidyl linker or an oligonucleotide linker. In some embodiments, any suitable spacer can be used as a linker. Examples of suitable spacers include idSp(1',2'-dideoxyribose) or iSpC3 (internal C3 spacer), and other suitable spacers are known in the art (see, for example, https: / / www.idtdna.com / Site / Catalog / Modifications / Category / 6). Another example is triethylene glycol (TEG). One or more, such as 2, 3 or 4 spacers, such as idSp, iSpC3 and / or TEG can be used to link adjacent regions of the probe.

[0194] Nucleotide

[0195] Each probe in the probe set includes a nucleotide sequence. Nucleotides generally contain a nucleobase, a sugar and at least one phosphate group. Nucleobases are generally heterocyclic. Nucleobases include, but are not limited to, purines and pyrimidines, and more specifically, adenine, guanine, thymine, uracil and cytosine. Sugars are generally pentoses. Nucleotide sugars include, but are not limited to, ribose and deoxyribose. Nucleotides are generally ribonucleotides or deoxyribonucleotides. Nucleotides generally contain a monophosphate, diphosphate or triphosphate. The phosphate can be attached to the 5' or 3' side of the nucleotide.

[0196] Nucleotides include but are not limited to: adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), 5-methylcytidine monophosphate, 5-methylcytidine diphosphate, 5-methylcytidine triphosphate, 5-hydroxymethylcytidine monophosphate, 5-hydroxymethylcytidine diphosphate, 5-hydroxymethylcytidine triphosphate, cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), deoxyuridine triphosphate (dUTP), deoxycytidine monophosphate (dCMP), deoxycytidine diphosphate (dCDP), and deoxycytidine triphosphate (dCTP), 5-methyl-2'-deoxycytidine monophosphate, 5-methyl-2'-deoxycytidine diphosphate, 5-methyl-2'-deoxycytidine triphosphate, 5-hydroxymethyl-2'-deoxycytidine monophosphate, 5-hydroxymethyl-2'-deoxycytidine diphosphate, and 5-hydroxymethyl-2'-deoxycytidine triphosphate. The nucleotides are preferably selected from AMP, TMP, GMP, UMP, dAMP, dTMP, dGMP, or dCMP. The nucleotides may be abasic (i.e., lacking a nucleobase). The nucleotides may contain additional modifications. Specifically, suitable modified nucleotides include but are not limited to 2'-aminopyrimidines (such as 2'-aminocytidine and 2'-aminouridine), 2'-hydroxypurines (such as 2'-fluoropyrimidines) (such as 2'-fluorocytidine and 2'-fluorouridine), hydroxypyrimidines (such as 5'-α-P-boranyluridine), 2'-O-methyl nucleotides (such as 2'-O-methyladenosine, 2'-O-methylguanosine, 2'-O-methylcytidine, and 2'-O-methyluridine), 4'-thiopyrimidines (such as 4'-thiouracil and 4'-thiocytidine), and the nucleotides have modifications to the nucleobase (such as 5-pentynyl-2'-deoxyuridine, 5-(3-aminopropyl)-uridine, and 1,6-diaminohexyl-N-5-carbamoylmethyluridine).

[0197] If the probe is DNA, the probe can include one or more unnatural nucleotides, which include nucleobases different from adenine, guanine, thymine, cytosine or 5-methylcytosine and / or include nucleosides different from deoxyadenosine, deoxyguanosine, thymidine, deoxycytidine or hydroxymethylpyrimidine. If the probe is RNA, the probe can include one or more unnatural nucleotides different from adenine, guanine, uracil, cytosine or 5-methylcytosine and / or include nucleosides different from adenosine, guanosine, uridine, cytidine or 5-methylcytidine. When present in the hybridization region, the different nucleobases and / or nucleosides are capable of hybridizing with one or more of the nucleotides in the target polynucleotide. Commercially available nucleosides include, but are not limited to, 2,6-diaminopurine-2'-deoxynucleoside, 2-aminopurine-2'-deoxynucleoside, 2,6-diaminopurine-riboside, 2-aminopurine-riboside, pseudouridine, puromycin, 2,6-diaminopurine-2'-O-methyl arabinoside, 2-aminopurine-2'-O-methyl arabinoside and cytarabine. The unnatural nucleotides can include any of these nucleosides.

[0198] The unnatural nucleotides can be universal nucleotides. The universal nucleotides preferably include one of the following nucleobases: hypoxanthine, 4-nitroindole, 5-nitroindole, 6-nitroindole, formylindole, 3-nitropyrrole, nitroimidazole, 4-nitropyrazole, 4-nitrobenzimidazole, 5-nitroindazole, 4-aminobenzimidazole or phenyl (C6-aromatic ring). The universal nucleotides more preferably include one of the following nucleosides: 2'-deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 7-deaza-inosine, 2-aza-deoxyinosine, 2-aza-inosine, 2'-O'-methylinosine, 4-nitroindole 2'-deoxynucleoside, 4-nitroindole nucleoside, 5-nitroindole 2'-deoxynucleoside, 5-nitroindole nucleoside, 6-nitroindole 2'-deoxynucleoside, 6-nitroindole nucleoside, 3-nitropyrrole 2'-deoxynucleoside, 3-nitropyrrole nucleoside, acyclic sugar analog of hypoxanthine, nitroimidazole 2'-deoxynucleoside, nitroimidazole nucleoside, 4-nitropyrazole 2'-deoxynucleoside, 4-nitropyrazole nucleoside, 4-nitrobenzimidazole 2'-deoxynucleoside, 4-nitrobenzimidazole nucleoside, 5-nitroindazole 2'-deoxynucleoside, 5-nitroindazole nucleoside, 4-aminobenzimidazole 2'-deoxynucleoside, 4-aminobenzimidazole nucleoside, phenyl C-nucleoside, phenyl C-2'-deoxyribosyl nucleoside, 2'-deoxyclitocine, 2'-deoxyinosine, K-2'-deoxynucleoside, P-2'-deoxynucleoside and pyrrolidine. The universal nucleotides more preferably include 2'-deoxyinosine. The universal nucleotides more preferably are IMP or dIMP. The universal nucleotides most preferably are dPMP (2'-deoxy-P-nucleoside monophosphate) or dKMP (N6-methoxy-2,6-diaminopurine monophosphate).

[0199] Unnatural nucleotides may include chemical atoms or groups that are not present in the natural nucleotide they are replacing. The chemical group is preferably propargyl, sulfanyl, oxo, methyl, hydroxymethyl, formyl, carboxyl, carbonyl, benzyl, propargyl or propargylamino group. The chemical group or atom may be or may include a fluorescent molecule, biotin, digoxin, DNP (dinitrophenol), a photo-labile group, an alkyne, DBCO, an azide, a free amino group, a redox dye, a mercury atom or a selenium atom.

[0200] Commercially available nucleosides that include chemical groups not present in naturally occurring nucleosides include, but are not limited to, 6-thio-2'-deoxyguanosine, 7-deaza-2'-deoxyadenosine, 7-deaza-2'-deoxyguanosine, 7-deaza-8-aza-2'-deoxyadenosine, 8-5'(5'S)-cyclo-2'-deoxyadenosine, 8-amino-2'-deoxyadenosine, 8-amino-2'-deoxyguanosine, 8-deutero-2'-deoxyguanosine, 8-oxo-2'-deoxyadenosine, 8-oxo-2'-deoxyguanosine, vinyl-2'-deoxyadenosine, N6-methyl-2'-deoxyadenosine, O6-methyl-2'-deoxyguanosine, O6-phenyl-2'-deoxyinosine, 2'-deoxypseudouridine, 2-thiothymidine, 4-thio-2'-deoxyuridine, 4-thiothymidine, 5'-aminothymidine, 5-(1-alkynylethynyl)-2'-deoxyuridine, 5-(C2-EDTA)-2'-deoxyuridine, 5-(carboxy)vinyl-2'-deoxyuridine, 5,6-dihydro-2'-deoxyuridine, 5.6-dihydrothymidine, 5-bromo-2'-deoxycytidine, 5-bromo-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-fluoro-2'-deoxyuridine, 5-formyl-2'-deoxycytidine, 5-hydroxy-2'-deoxycytidine, 5-hydroxy-2'-deoxyfluorouridine, 5-hydroxymethyl-2'-deoxycytidine, 5-hydroxymethyl-2'-deoxyuridine, 5-iodo-2'-deoxycytidine, 5-iodo-2'-deoxyuridine, 5-methyl-2'-deoxycytidine, 5-methyl-2'-deoxyisocytidine, 5-propynyl-2'-deoxycytidine, 5-propynyl-2'-deoxyuridine, 6-O-(TMP)-5-F-2'-deoxyuridine, C4-(1,2,4-triazol-1-yl)-2'-deoxyuridine, C8-alkyne-thymidine, dT-ferrocene, N4-ethyl-2'-deoxycytidine, O4-methylthymidine, pyrrole-2'-deoxycytidine, thymidine glycol, 4-thiouridine, 5-methylcytidine, 5-methyluridine, pyrrole ring cytidine, 3-deaza-5-aza-2'-O-methylcytidine, 5-fluoro-2'-O-methyluridine, 5-fluoro-4-O-TMP-2'-O-methyluridine, 5-methyl-2'-O-methylcytidine, 2-methyl-2'-O-methylthymidine, 2',3'-dideoxyadenosine, 2',3'-dideoxycytidine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine, 3'-deoxyadenosine, 3'-deoxycytidine, 3'-deoxyguanosine, 3'-deoxythymidine, and 5'-O-methylthymidine. Unnatural nucleotides can include any of these nucleosides. The unnatural nucleotide is most preferably 2'-fluoro-2'-deoxyadenosine or 5-carboxy-2'-deoxycytidine.

[0201] Alternatively, the unnatural nucleotide preferably lacks a chemical group or atom that is present in the natural nucleotide it is replacing.

[0202] Compared to the one or more nucleotides being replaced, the unnatural nucleotides preferably have an altered electronegativity. The unnatural nucleotides having an altered electronegativity preferably include a halogen atom. The halogen atom can be attached to any position on the unnatural nucleotide, such as the nucleobase and / or the sugar. The halogen atom is preferably fluorine (F), chlorine (Cl), bromine (Br), or iodine (I). The halogen atom is most preferably F or I.

[0203] Commercially available nucleosides containing a halogen include, but are not limited to, 8-bromo-2'-deoxyadenosine, 8-bromo-2'-deoxyguanosine, 5-bromouridine, 5-iodouridine, 5-bromouridine, 5-iodouridine, 5'-iodothymidine, and 5-bromo-2'-O-methyluridine. The unnatural nucleotides can include any one of these nucleosides.

[0204] Any nucleotide mentioned in the examples can also be used in the methods described herein.

[0205] Unique current

[0206] Each probe (i.e., each type of probe) affects the current flowing through the pore in a unique way. In other words, the probe affects the current flowing through the pore in a way that can be distinguished or differentiated from the way different probes affect the current flowing through the pore. This allows determination of the identity of each probe (i.e., each type of probe) according to the present invention. Then the binding of the probe to the target polynucleotide can be measured as described above. Since the identity of each probe and the binding of each probe to the target polynucleotide can be measured, the presence or absence of each target polynucleotide can be determined.

[0207] Each probe (i.e., each type of probe) preferably affects the current flowing through the pore in a unique way when it binds to the target polynucleotide. In other words, the binding of the target polynucleotide to the probe preferably affects the current flowing through the pore in a way that can be distinguished or differentiated from the way different probes affect the current flowing through the pore when they bind to the target polynucleotide. Different probes can bind to the same target polynucleotide.

[0208] The unique way may involve the degree to which the current flowing through the pore is affected, i.e., the change in the amount of current flowing through the pore when the probe binds to its target polynucleotide, and / or the time ("dwell time") during which the current is affected by the binding of the probe to its target polynucleotide. The value of the current disruption is more significant than the dwell time because the former provides a more distinct signature, while the hybridization regions of the probes have been designed such that the dwell times of the probes in the group are within a defined window when hybridized to their respective target polynucleotides. This means that the dwell times of the various hybridization probes have a narrow distribution. The unique way may involve the degree to which the change in the current flowing through the pore is affected. The change can increase or decrease due to the binding of the target polynucleotide to the probe.

[0209] When hybridized to their respective target polynucleotides and analyzed using nanopores, probe sets can be designed to give well-separated clusters of current blockades. Examples of current signatures that can be used to identify probes hybridized to a specific target polynucleotide include current blockade length (or dwell), “variation” or standard deviation, and / or current blockade noise. This is illustrated in Example 4 of the present application. When a probe set is hybridized to a target polynucleotide and contacted with a nanopore, clusters corresponding to each of the duplexes formed by hybridization of the target polynucleotide with its probe are visible. For Figure 4 a specific example in

[0210] shows this. Current blockades formed by all duplexes are detected within a defined window. Only these current blockades occurring within the defined window are measured and presented for further analysis.

[0211] The distinctiveness between probes can be achieved by differences in their lengths. Longer probes will affect the current flowing through the pore for a longer time, i.e., have a longer dwell time. Shorter probes will affect the current flowing through the pore for a shorter time, i.e., have a shorter dwell time.

[0212] In a preferred embodiment, when a probe binds to its target polynucleotide, the non-hybridized region or a portion thereof transiently remains in the barrel or channel of the pore. When a probe includes a second non-hybridized region separated from the first non-hybridized region by a second hybridization region, a quadruplex-forming region, or a duplex region, the second non-hybridized region remains in the pore either before or after the first hybridization region, depending on the order of the regions in the probe. Differences between specific regions of different probes in a set, such as the presence of different polymers and different polynucleotide species, affect the current flowing through the pore. For example, different sequences of the same type of polymer, such as one sequence including two or more adjacent abasic residues, can also account for differences between probes. Designing a set of non-hybridized regions with the desired distinctiveness is straightforward, as described, for example, in WO2013 / 121201.

[0213] In the case where a probe includes a quadruplex-forming region or a duplex region, if the relevant target polynucleotide is present in the sample, the current blockade has two phases, but has only one phase if the target polynucleotide is absent.

[0214] Transmembrane pore

[0215] A transmembrane pore is a structure that crosses the membrane to some extent. It allows hydrated ions driven by an applied potential to flow across or within the membrane. Transmembrane pores typically cross the entire membrane such that hydrated ions can flow from one side of the membrane to the other. However, a transmembrane pore need not cross the membrane. It may be closed at one end. For example, the pore can be a well, gap, channel, groove, or slit in the membrane, along or into which hydrated ions can flow.

[0216] Any transmembrane pore can be used in the present invention. The pores can be biological or artificial. Suitable pores include but are not limited to protein pores, polynucleotide pores, and solid-state pores. The pores can be DNA origami pores (Langecker et al., Science, 2012; 338:932 - 936). Suitable DNA origami pores are disclosed in WO2013 / 083983.

[0217] The transmembrane pore is preferably a transmembrane protein pore. A transmembrane protein pore is a polypeptide or a collection of polypeptides that allows hydrated ions such as polynucleotides to flow from one side of the membrane to the other. In the present invention, the transmembrane protein pore is capable of forming a pore that allows hydrated ions driven by an applied potential to flow from one side of the membrane to the other. The transmembrane protein pore preferably allows polynucleotides to flow from one side of the membrane, such as a triblock copolymer membrane, to the other. The transmembrane protein pore allows polynucleotides such as DNA or RNA to move through the pore.

[0218] The transmembrane protein pore can be monomeric or oligomeric. The pore preferably consists of several repeating subunits, such as at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 subunits. The pore is preferably a hexamer, heptamer, octamer, or non-trimeric pore. The pore can be a homo-oligomer or a hetero-oligomer.

[0219] The transmembrane protein pore is preferably derived from CsgG, more preferably from CsgG from Escherichia coli strain K - 12 substrain MC4100. Such a pore will be oligomeric and typically includes 7, 8, 9, or 10 monomers derived from CsgG. The pore can be a homo-oligomeric pore derived from CsgG that includes identical monomers. Alternatively, the pore can be a hetero-oligomeric pore derived from CsgG that includes at least one monomer different from the other monomers. Examples of suitable CsgG pores are described in WO / 2016 / 034591, WO 2017 / 149316, WO 2017 / 149317, and WO 2017 / 149318.

[0220] The transmembrane protein pore generally includes a barrel or channel through which ions can flow. The subunits of the pore generally surround a central axis and provide strands for a transmembrane barrel or channel or a transmembrane α - helix bundle or channel.

[0221] The barrels or channels of transmembrane protein pores generally include amino acids that facilitate interaction with analytes such as nucleotides, polynucleotides, or nucleic acids. These amino acids are preferably located near the constriction of the barrel or channel. Transmembrane protein pores generally include one or more positively charged amino acids such as arginine, lysine, or histidine, or aromatic amino acids such as tyrosine or tryptophan. These amino acids generally facilitate the interaction between the pore and nucleotides, polynucleotides, or nucleic acids.

[0222] The transmembrane protein pores used according to the present invention can be derived from β-barrel pores or α-helical bundle pores. β-barrel pores include barrels or channels formed by β-strands. Suitable β-barrel pores include but are not limited to β-toxins such as α-hemolysin, anthrax toxin, and leukocidin, as well as outer membrane proteins / porins of bacteria such as Mycobacterium smegmatis porin (Msp), such as MspA, MspB, MspC, or MspD, CsgG, outer membrane porin F (OmpF), outer membrane porin G (OmpG), outer membrane phospholipase A, and Neisseria autotransporter lipoprotein (NalP), and other pores such as cytolysin. α-helical bundle pores include barrels or channels formed by α-helices. Suitable α-helical bundle pores include but are not limited to inner membrane proteins and α-outer membrane proteins such as WZA and ClyA toxin.

[0223] The transmembrane pores can be derived from or based on Msp, α-hemolysin (α-HL), cytolysin, CsgG, ClyA, Sp1, and hemolytic protein fragaceatoxin C (FraC). The transmembrane protein pores are preferably derived from CsgG, more preferably from CsgG from Escherichia coli strain K-12 substrain MC4100. Suitable pores derived from CsgG are disclosed in WO 2016 / 034591. The transmembrane pores can be derived from cytolysin. Suitable pores derived from cytolysin are disclosed in WO 2013 / 153359.

[0224] The wild-type α-hemolysin pore is formed by 7 identical monomers or subunits (i.e., it is a heptamer). The α-hemolysin pore can be α-hemolysin-NN or a variant thereof. The variant preferably includes N residues at positions E111 and K147. The sequence of one monomer or subunit of α-hemolysin-NN is shown in SEQ ID NO: 3.

[0225] Monomers derived from α-HL-NN typically include the sequence shown in SEQ ID NO: 3 or a variant thereof. A variant of SEQ ID NO: 3 is a polypeptide having an amino acid sequence different from SEQ ID NO: 3 and retaining its ability to form pores. Any method known in the art can be used to determine the pore-forming ability of the variant. For example, the variant can be inserted into an amphiphilic layer together with other appropriate subunits, and its ability to oligomerize to form pores can be determined. Methods for inserting subunits into membranes, such as amphiphilic layers, are known in the art. For example, the purified form of the subunit can be suspended in a solution containing a triblock copolymer membrane such that it diffuses into the membrane and inserts by binding to the membrane and assembling into a functional state. Alternatively, the "pick and place" method described in M.A. Holden, H. Bayley. Journal of the American Chemical Society (J. Am. Chem. Soc.) 2005, 127, 6502-6503 and WO 2006 / 100484 can be used to directly insert the subunit into the membrane.

[0226] Throughout the entire length of the amino acid sequence of SEQ ID NO: 3, the variant will preferably be at least 50% homologous to the sequence based on amino acid similarity or identity. More preferably, based on amino acid similarity or identity, the variant can be at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and more preferably at least 95%, 97% or 99% homologous to the amino acid sequence of SEQ ID NO: 3 throughout the sequence. In segments of 100 or more, such as 125, 150, 175 or 200 or more contiguous amino acids, there may be at least 80%, such as at least 85%, 90% or 95% amino acid similarity or identity ("hard homology").

[0227] Standard methods in the art can be used to determine homology. For example, the UWGCG package provides the BESTFIT program, which can be used to calculate homology, e.g., using its default settings (Devereux et al. (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can be used to calculate homology or to order sequences (such as identifying equivalent residues or corresponding sequences, usually according to their default settings), e.g., as described in Altschul S.F. (1993) J Mol Evol 36:290-300; Altschul, S.F. et al. (1990) J Mol Biol 215:403-10. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). Similarity can be measured using pairwise identity or by applying a scoring matrix such as BLOSUM62 and converting to equivalent identity. Since they represent functional changes rather than evolutionary changes, the positions of deliberate mutations will be masked when determining homology. Similarity can be determined more sensitively by applying a position-specific scoring matrix, e.g., using PSIBLAST on a comprehensive database of protein sequences. Different scoring matrices can be used that reflect the chemo-physical properties of amino acids rather than the substitution frequencies within an evolutionary time scale (e.g., charge).

[0228] Amino acid substitutions can be made to the amino acid sequence of SEQ ID NO: 3, e.g., up to 1, 2, 3, 4, 5, 10, 20 or 30 substitutions. Conservative substitutions replace an amino acid with another amino acid having a similar chemical structure, similar chemical properties or similar side chain volume. The introduced amino acid can have a polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality or charge similar to that of the amino acid it replaces. Alternatively, a conservative substitution can introduce another aromatic or aliphatic amino acid in place of a pre-existing aromatic or aliphatic amino acid.

[0229] The transmembrane protein pore is preferably derived from Msp, more preferably from MspA. Suitable pores derived from MspA are disclosed in WO 2012 / 107778.

[0230] For example, any protein described herein, such as a transmembrane protein pore, can be modified to aid in its identification or purification by adding a histidine residue (His-tag), an aspartic acid residue (Asp-tag), a streptavidin tag, a FLAG, a SUMO tag, a GST tag, or an MBP tag, or by adding a signal sequence to promote its secretion from the cell, where the polypeptide does not naturally contain such a sequence. An alternative to introducing a genetic tag is to chemically react the tag to a native or engineered position on the pore or construct. An example of this would be reacting a gel mobility reagent to an engineered cysteine on the outside of the pore. This has been shown as a method for separating hemolysin hetero-oligomers (Braha et al. (1997) Chem Biol, 4(7):497-505).

[0231] The pore can be labeled with an exposed label. The exposed label can be any suitable label that allows the pore to be detected. Suitable labels include but are not limited to fluorescent molecules, radioisotopes, such as 125 I, 35 S, enzymes, antibodies, antigens, polynucleotides, and ligands such as biotin.

[0232] Any protein described herein, such as a transmembrane protein pore, can be prepared synthetically or by recombinant means. For example, the pore can be synthesized by in vitro translation and transcription (IVTT). The amino acid sequence of the pore can be modified to include non-naturally occurring amino acids or to increase the stability of the protein. Such amino acids can be introduced during production when the protein is produced synthetically. The pore can also be altered after synthetic or recombinant production.

[0233] Any protein described herein, such as a transmembrane protein pore, can be produced using standard methods known in the art. Polynucleotide sequences encoding the pore or construct can be derived and replicated using standard methods in the art. Polynucleotide sequences encoding the pore or construct can be expressed in bacterial host cells using standard techniques in the art. The pore can be produced in a cell by in situ expression of the polypeptide from a recombinant expression vector. The expression vector optionally carries an inducible promoter to control the expression of the polypeptide. These methods are described in Sambrook, J. and Russell, D. (2001), Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

[0234] The pores can be produced on a large scale after purification from a protein-producing organism by any protein liquid chromatography system or after recombinant expression. Typical protein liquid chromatography systems include FPLC, AKTA systems, Bio-Cad systems, Bio-Rad biosystems, and Gilson HPLC systems.

[0235] coupling

[0236] In some embodiments, the probe can include one or more anchors capable of coupling to a membrane. In some embodiments, a method for determining the presence, absence, or amount of two or more target polynucleotides can further include coupling the probe to the membrane using the one or more anchors.

[0237] An anchor includes a group that couples (or binds) to the probe and a group that couples (or binds) to the membrane. Each anchor can be covalently coupled (or bound) to the probe and / or the membrane.

[0238] Any number of anchors can be used to couple the probe to the membrane, such as 2, 3, 4, or more anchors. For example, two anchors can be used to couple the probe to the membrane, with each anchor coupling (or binding) the probe to the membrane separately.

[0239] The one or more anchors can include one or more polynucleotide-binding proteins.

[0240] If the membrane is an amphiphilic layer such as a triblock copolymer membrane, the one or more anchors preferably include a polypeptide anchor and / or a hydrophobic anchor that can insert into the membrane. The hydrophobic anchor is preferably a lipid, fatty acid, sterol, carbon nanotube, polypeptide, protein, or amino acid, such as cholesterol, palmitic acid, or tocopherol. In a preferred embodiment, the anchor is cholesterol. The anchor is preferably not coupled to the membrane through a pore.

[0241] Components of the membrane such as amphiphiles, copolymers, or lipids can be chemically modified or functionalized to form the one or more anchors. Examples of suitable chemical modifications and suitable ways of functionalizing components of the membrane are discussed below. Any proportion of the membrane components can be functionalized, such as at least 0.01%, at least 0.1%, at least 1%, at least 10%, at least 25%, at least 50%, or 100%.

[0242] The probe can be directly coupled to the membrane. The one or more anchors for coupling the probe to the membrane preferably include a linker. The one or more anchors can include one or more linkers, such as 2, 3, 4, or more. One linker can be used to couple more than one, such as 2, 3, 4, or more probes to the membrane.

[0243] Preferred linkers include, but are not limited to, polymers such as polynucleotides, polyethylene glycol (PEG), polysaccharides, and polypeptides. These linkers can be linear, branched, or cyclic. For example, the linker can be a cyclic polynucleotide. The probe can hybridize to a complementary sequence on the cyclic polynucleotide linker.

[0244] The one or more anchors or one or more linkers can generally include components that can be cleaved or decomposed, such as restriction sites or photo-labile groups.

[0245] Functionalized linkers and the ways in which they can couple molecules are known in the art. For example, a linker functionalized with a maleimide group will react with cysteine residues in a protein and attach. In the context of the present invention, the protein can be present in a membrane, can be part of the probe, or can be used to couple (or bind) to a polynucleotide probe.

[0246] A "lock and key" arrangement can be used to avoid cross-linking of the polynucleotides. Only one end of each linker can react together to form a longer linker, and the other ends of the linkers react separately with the polynucleotide or the membrane, respectively. Such linkers are described in WO2010 / 086602.

[0247] The coupling is preferably transient. In other words, the coupling can be such that the probe can be separated from the membrane when it interacts with the pore. Using cholesterol or fatty acyl chains, the probe can be temporarily coupled to an amphiphilic layer or a triblock copolymer membrane. Any fatty acyl chain with a length of 6 to 30 carbon atoms can be used, such as hexadecanoic acid.

[0248] In a preferred embodiment, the probe is coupled to an amphiphilic layer, such as a triblock copolymer membrane or a lipid bilayer. Nucleic acid coupling to synthetic lipid bilayers has previously been carried out using a variety of different strategies shared in the literature. These are summarized in Table 1 below.

[0249] Table 1

[0250]

[0251] Anchors including thiols, biotin, or surfactants can be used in combination with components that can be cleaved or decomposed to achieve transient coupling of the probe to the membrane.

[0252] Modified phosphoramidites can be used in synthetic reactions to functionalize synthetic polynucleotides and / or linkers, and the modified phosphoramidites are readily compatible with the direct addition of suitable anchoring groups such as cholesterol, tocopherol, palmitic acid, thiol, lipid, and biotin groups. These different attachment chemistries provide a set of options for the attachment of polynucleotides. Each different modifying group couples the polynucleotide in a slightly different manner, and the coupling is not necessarily permanent, thus giving different residence times of the probe to the membrane. Thus, when coupling is used in the methods of the present invention, all probes in the group are coupled to the membrane in the same manner.

[0253] The coupling of polynucleotides to linkers or to functionalized membranes can also be achieved by a variety of other means, provided that complementary reactive groups or anchoring groups can be added to the polynucleotides. The addition of reactive groups to either end of polynucleotides has been reported previously. A thiol group can be added to the 5' of ssDNA or dsDNA using T4 polynucleotide kinase and ATPγS (Grant, G.P. and P.Z. Qin (2007). "A facile method for attaching nitroxide spin labels at the 5' terminus of nucleic acids", Nucleic Acids Res 35(10):e77). An azide group can be added to the 5'-phosphate of ssDNA or dsDNA using T4 polynucleotide kinase and γ-[2-azidoethyl]-ATP or γ-[6-azidohexyl]-ATP. Using thiol or click chemistry, a tether containing any of a thiol, iodoacetamide OPSS or maleimide group (reactive with thiol) or DIBO (dibenzocyclooctyne) or alkyne group (reactive with azide) can be covalently attached to the polynucleotide. Terminal transferase can be used to incorporate modified oligonucleotides into the 3' of ssDNA to add a more diverse selection of chemical groups such as biotin, thiol, and fluorophores (Kumar, A., P. Tchen et al. (1988), "Nonradioactive labeling of synthetic oligonucleotide probes with terminal deoxynucleotidyltransferase", Biochem Anal Anal Biochem)》169(2):376 - 82). Streptavidin / biotin and / or streptavidin / desthiobiotin conjugations can be used for any other polynucleotide. It is also possible to directly add an anchor to a polynucleotide with a suitable modified nucleotide using a terminal transferase (such as cholesterol or palmitic acid).

[0254] The one or more anchors can couple the probe to the membrane by hybridization. Hybridization can occur in any part of the one or more anchors, such as between the one or more anchors and the probe, within the one or more anchors, or between the one or more anchors and the membrane. As discussed above, hybridization in the one or more anchors allows for coupling in a transient manner. For example, a linker can include two or more polynucleotides hybridized together, such as 3, 4, or 5 polynucleotides. The one or more anchors can hybridize with a polynucleotide. The one or more anchors can hybridize directly to a non - hybridized region of the probe. Alternatively, the one or more anchors can hybridize with one or more, such as 2 or 3, intermediate polynucleotides (or “splints”) that hybridize with the probe.

[0255] The one or more anchors can be incorporated during the chemical synthesis of the probe. For example, a primer with a reactive group attached to it can be used to synthesize the probe.

[0256] Adenylated polynucleotides are intermediates in a ligation reaction where adenosine monophosphate is attached to the 5'-phosphate of the polynucleotide. Various kits for generating such intermediates are available, such as the 5' DNA Adenylation Kit from NEB. By substituting ATP with a modified nucleotide triphosphate in the reaction, a reactive group (such as thiol, amine, biotin, azide, etc.) can then be added to the 5' of the polynucleotide. It is also possible to directly add an anchor to a polynucleotide with a suitable modified nucleotide (such as cholesterol or palmitic acid) using the 5' DNA Adenylation Kit.

[0257] Ideally, the probe is coupled to the membrane without having to functionalize the probe. This can be achieved by coupling the one or more anchors, such as polynucleotide - binding proteins or chemical groups, to the membrane and having the one or more anchors interact with the probe or by functionalizing the membrane. The one or more anchors can be coupled to the membrane by any method described herein. In particular, the one or more anchors can include one or more linkers, such as maleimide - functionalized linkers.

[0258] The one or more anchors can include any group that couples, binds, or interacts with a single - stranded polynucleotide, a specific nucleotide sequence within the probe, or a pattern of modified nucleotides within the probe, or any other ligand present on the probe.

[0259] Suitable binding proteins for use in the anchor include, but are not limited to: Escherichia coli single-stranded binding protein, P5 single-stranded binding protein, T4 gp32 single-stranded binding protein, TOPO V dsDNA binding region, human histone, Escherichia coli HU DNA binding protein, and other archaeal, prokaryotic or eukaryotic single-stranded or double-stranded polynucleotide (or nucleic acid) binding proteins.

[0260] The one or more anchors may include any group that couples, binds, inserts or interacts with a polynucleotide. The group may interact with or insert into the probe by electrostatic, hydrogen bonding or van der Waals interactions. Such groups include lysine monomers, polylysine (which will interact with ssDNA or dsDNA), ethidium bromide (which will insert into dsDNA), universal bases or universal nucleotides (which can hybridize with any polynucleotide), and osmium complexes (which can react with methylated bases). Thus, the probe may be coupled to the membrane using one or more universal nucleotides attached to the membrane. Each universal nucleotide may be coupled to the membrane using one or more linkers. The universal nucleotide preferably includes one of the following nucleobases: hypoxanthine, 4-nitroindole, 5-nitroindole, 6-nitroindole, formylindole, 3-nitropyrrole, nitroimidazole, 4-nitropyrazole, 4-nitrobenzimidazole, 5-nitroindazole, 4-aminobenzimidazole or phenyl (C6-aromatic ring). The universal nucleotide more preferably includes one of the following nucleosides: 2'-deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 7-deaza-inosine, 2-aza-deoxyinosine, 2-aza-inosine, 2'-O'-methylinosine, 4-nitroindole 2'-deoxynucleoside, 4-nitroindole nucleoside, 5-nitroindole 2'-deoxynucleoside, 5-nitroindole nucleoside, 6-nitroindole 2'-deoxynucleoside, 6-nitroindole nucleoside, 3-nitropyrrole 2'-deoxynucleoside, 3-nitropyrrole nucleoside, acyclic sugar analog of hypoxanthine, nitroimidazole 2'-deoxynucleoside, nitroimidazole nucleoside, 4-nitropyrazole 2'-deoxynucleoside, 4-nitropyrazole nucleoside, 4-nitrobenzimidazole 2'-deoxynucleoside, 4-nitrobenzimidazole nucleoside, 5-nitroindazole 2'-deoxynucleoside, 5-nitroindazole nucleoside, 4-aminobenzimidazole 2'-deoxynucleoside, 4-aminobenzimidazole nucleoside, phenyl C-nucleoside, phenyl C-2'-deoxyribosyl nucleoside, 2'-deoxyclitocine, 2'-deoxyinosine, K-2'-deoxynucleoside, P-2'-deoxynucleoside and pyrrolidine. The universal nucleotide more preferably includes 2'-deoxyinosine. The universal nucleotide more preferably is IMP or dIMP. The universal nucleotide most preferably is dPMP (2'-deoxy-P-nucleoside monophosphate) or dKMP (N6-methoxy-2,6-diaminopurine monophosphate).

[0261] The one or more anchors can be coupled (or bound) to the polynucleotide by Hoogsteen hydrogen bonds (where two nucleobases are held together by a hydrogen bond) or reverse Hoogsteen hydrogen bonds (where one nucleobase is rotated 180° relative to the other nucleobases). For example, the one or more anchors can include one or more nucleotides, one or more oligonucleotides, or one or more polynucleotides that form Hoogsteen hydrogen bonds or reverse Hoogsteen hydrogen bonds with the polynucleotide. These types of hydrogen bonds allow a third polynucleotide strand to wind around the double-stranded helix and form a triple helix.

[0262] In this embodiment, at least 1%, at least 10%, at least 25%, at least 50%, or 100% of the membrane components can be functionalized.

[0263] When the one or more anchors include proteins, they may be able to directly anchor into the membrane without further functionalization, for example when they already have an outer hydrophobic region compatible with the membrane. Examples of such proteins include, but are not limited to, transmembrane proteins, integral membrane proteins, and membrane proteins. Alternatively, the protein can be expressed with a hydrophobic region genetically fused to it. Such hydrophobic protein regions are known in the art.

[0264] Preferably, the one or more anchors are mixed with the probe before delivery to the membrane, but the one or more anchors can contact the membrane and then contact the probe.

[0265] In another aspect, the methods described herein can be used to functionalize the probe such that it can be recognized by a specific binding group. Specifically, the probe can be functionalized with a ligand such as biotin (for binding to streptavidin), amylose (for binding to maltose binding protein or a fusion protein), Ni-NTA (for binding to a polyhistidine or a protein with a polyhistidine tag), or a peptide (such as an antigen).

[0266] Diagnosis

[0267] In some embodiments, the target polynucleotide is a microRNA (or miRNA). A set of two or more target polynucleotides is preferably a set of two or more miRNAs. miRNAs suitable for diagnosis are well known in the art. For example, suitable miRNAs are stored in publicly available databases (Jiang Q., Wang Y., Hao Y., Juan L., Teng M., Zhang X., Li M., Wang G., Liu Y., (2009) miR2Disease: a manually curated database of microRNA dysregulation in human diseases. Nucleic Acids Res.).

[0268] One or more miRNAs can be used, for example, for diagnosing or predicting a disease or medical condition. The disease or medical condition is preferably cancer, coronary heart disease, cardiovascular disease, or sepsis. The disease or medical condition is more preferably abdominal aortic aneurysm, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute myocardial infarction, acute promyelocytic leukemia (APL), adenoma, adrenocortical carcinoma, alcoholic liver disease, Alzheimer's disease, anaplastic thyroid carcinoma (ATC), anxiety disorder, asthma, astrocytoma, atopic dermatitis, autism spectrum disorder (ASD), B-cell chronic lymphocytic leukemia, B-cell lymphoma, Becker muscular dystrophy (BMD), bladder cancer, brain tumor, breast cancer, Burkitt lymphoma, cardiac hypertrophy, cardiomyopathy, cardiovascular disease, cerebellar neurodegeneration, cervical cancer, cholangiocarcinoma, cholesteatoma, choriocarcinoma, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic pancreatitis, colon cancer, colorectal cancer, congenital heart disease, coronary artery disease, calf syndrome, dermatomyositis (DM), diabetic nephropathy, diarrhea-predominant irritable bowel syndrome, diffuse large B-cell lymphoma, dilated cardiomyopathy, Down syndrome (DS), Duchenne muscular dystrophy (DMD), endometrial cancer, endometrioid adenocarcinoma of the endometrium, endometriosis, epithelial ovarian cancer, esophageal cancer, esophageal squamous cell carcinoma, essential thrombocythemia (ET), facioscapulohumeral muscular dystrophy (FSHD), follicular lymphoma (FL), follicular thyroid carcinoma (FTC), frontotemporal dementia, gastric cancer (gastric carcinoma), glioblastoma, glioblastoma multiforme (GBM), glioma, glomerular disease, glomerulosclerosis, hamartoma, HBV-related cirrhosis, HCV infection, head and neck cancer, head and neck squamous cell carcinoma (HNSCC), hearing loss, heart disease, heart failure, hepatitis B, hepatitis C, hepatocellular carcinoma (HCC), hilar cholangiocarcinoma, Hodgkin lymphoma, homozygous sickle cell disease (HbSS), Huntington's disease (HD), hypertension, hypopharyngeal cancer, inclusion body myositis (IBM), insulinoma, intrahepatic cholangiocarcinoma (ICC), kidney cancer, kidney disease, laryngeal cancer, late insomnia (sleeping sickness), leiomyoma of the lung, leukemia, limb-girdle muscular dystrophy type 2A (LGMD2A), lipoma, lung adenocarcinoma, lung cancer, lymphoproliferative disease, malignant lymphoma, malignant melanoma, malignant mesothelioma (MM), mantle cell lymphoma (MCL), medulloblastoma, melanoma, meningioma, metabolic disease, Miyoshi distal myopathy (MM), multiple myeloma (MM), multiple sclerosis, MYC-rearranged lymphoma, myelodysplastic syndrome, myeloproliferative disease, myocardial infarction, myocardial injury, myoma, nasopharyngeal carcinoma (NPC), nemaline myopathy (NM), nephritis, neuroblastoma (NB), neutrophilia, Niemann-Pick type (NPC) disease, non-alcoholic fatty liver disease (NAFLD), non-small cell lung cancer (NSCLC), obesity, oral cancer,Ovarian cancer (OC), pancreatic cancer, pancreatic ductal adenocarcinoma (PDAC), pancreatic tumors, panic disorder, papillary thyroid cancer (PTC), Parkinson's disease, PFV-1 infection, pharyngeal diseases, pituitary adenoma, polycystic kidney disease, polycystic liver disease, polycythemia vera (PV), polymyositis (PM), primary biliary cirrhosis (PBC), primary myelofibrosis, prion diseases, prostate cancer, psoriatic arthritis, psoriasis, pulmonary hypertension, recurrent ovarian cancer, renal cell carcinoma, renal clear cell carcinoma, retinitis pigmentosa (RP), retinoblastoma, rhabdomyosarcoma, rheumatic heart disease and atrial fibrillation, rheumatoid arthritis, sarcoma, schizophrenia, sepsis, serous ovarian cancer, Sézary syndrome, skin diseases, small cell lung cancer, spinocerebellar ataxia, squamous cell carcinoma, T-cell leukemia, teratocarcinoma, testicular germ cell tumors, thalassemia, thyroid cancer, tongue squamous cell carcinoma, Tourette syndrome, type 2 diabetes, ulcerative colitis (UC), uterine leiomyoma (ULM), uveal melanoma, vascular diseases, vesicular stomatitis, or Waldenström macroglobulinemia (WM). Since the multiplex methods of the present invention can determine the presence of two or more miRNAs, two or more of any of the diseases listed above can be predicted or diagnosed.

[0269] Devices and conditions

[0270] Electrical measurements can be made using standard single-channel recording devices known in the art, e.g., as described in Stoddart, D.S. et al., (2009), Proceedings of the National Academy of Sciences of the United States of America, 106, p7702-7707, Lieberman KR et al., J Am Chem Soc, 2010; 132(50):17961-72 and International Application WO-2000 / 28312. Alternatively, electrical measurements can be made using a multi-channel system, e.g., as described in WO2009 / 077734 and WO2011 / 067559.

[0271] The methods can be performed using any device suitable for a membrane / pore system in which a pore is inserted into a membrane. The methods can be performed using any device suitable for transmembrane pore sensing. For example, the device includes a chamber containing an aqueous solution and a barrier that divides the chamber into two sections. The barrier has an opening in which a membrane containing a pore is formed.

[0272] The method can be carried out using the devices described in WO2008 / 102120, WO2010 / 122293 or WO00 / 28312.

[0273] The method involves measuring the ionic current through the pore, typically by current measurement. Alternatively, the ionic flow through the pore can be measured optically, as disclosed by Heron et al. in Journal of the American Chemical Society (J. Am. Chem. Soc.), Vol. 131, No. 5, 2009. Thus, the device can also include circuitry capable of applying a potential and measuring the electrical signal across the membrane and the pore. The patch clamp or voltage clamp can be used for the method. The method preferably involves using a voltage clamp.

[0274] The method can be carried out on a silicon-based pore array, where each array includes 128, 256, 512, 1024, 2000, 3000, 4000, 6000, 10000, 12000, 15000 or more pores.

[0275] The method of the present invention can involve measuring the current flowing through the pore. Suitable conditions for measuring the ionic current through the transmembrane pore are known in the art and are disclosed in the examples. The method is typically carried out with a voltage applied across the membrane and the pore. The voltage used is typically from +2V to -2V, usually from -400mV to +400mV. The voltage used is preferably within a range having a lower limit and an upper limit, the lower limit being selected from -400mV, -300mV, -200mV, -150mV, -100mV, -50mV, -20mV and 0mV, and the upper limit being independently selected from +10mV, +20mV, +50mV, +100mV, +150mV, +200mV, +300mV and +400mV. The voltage used is more preferably within the range of 100mV to 240mV, and most preferably within the range of 120mV to 220mV. By using an increased applied potential, the discrimination between different nucleotides can be increased through the pore.

[0276] The method is typically carried out in the presence of any charge carriers such as metal salts, e.g., alkali metal salts; halide salts, e.g., chloride salts such as alkali metal chloride salts. The charge carriers can comprise ionic liquids or organic salts such as tetramethylammonium chloride, trimethylphenylammonium chloride, phenyltrimethylammonium chloride, or 1-ethyl-3-methylimidazolium chloride. In the exemplary devices discussed above, the salt is present in an aqueous solution in the chamber. Potassium chloride (KCl), sodium chloride (NaCl), or cesium chloride (CsCl) is typically used. KCl is preferred. The salt can be an alkaline earth metal salt such as calcium chloride (CaCl2). The salt concentration can be saturated. The salt concentration can be 3M or lower, and is typically from 0.1M to 2.5M, 0.3M to 1.9M, 0.5M to 1.8M, 0.7M to 1.7M, 0.9M to 1.6M, or 1M to 1.4M. The salt concentration is preferably from 150 mM to 1M. The method is preferably carried out using a salt concentration of at least 0.3M, such as at least 0.4M, at least 0.5M, at least 0.6M, at least 0.8M, at least 1.0M, at least 1.5M, at least 2.0M, at least 2.5M, or at least 3.0M. High salt concentrations provide a high signal-to-noise ratio and allow the identification of currents indicative of binding / unbinding against the background of normal current fluctuations.

[0277] The method is typically carried out in the presence of a buffer. In the exemplary devices discussed above, the buffer is present in an aqueous solution in the chamber. Any buffer can be used in the method of the present invention. Typically, the buffer is HEPES. Another suitable buffer is Tris-HCl buffer. The method is typically carried out at the following pH values: 4.0 to 12.0, 4.5 to 10.0, 5.0 to 9.0, 5.5 to 8.8, 6.0 to 8.7, or 7.0 to 8.8, or 7.5 to 8.5. The pH used is preferably about 7.5.

[0278] The method can be carried out at the following temperatures: 0°C to 100°C, 15°C to 95°C, 16°C to 90°C, 17°C to 85°C, 18°C to 80°C, 19°C to 70°C, or 20°C to 60°C. The method is typically carried out at room temperature. Optionally, the method is carried out at a temperature that supports enzyme function, such as about 37°C.

[0279] The sample and probe set can be contacted with the pores on opposite sides of the membrane. Typically, the sample and probe set are contacted with the pores on the same side of the membrane.

[0280] The sample and the probe set can be brought into contact with the pore in any order. Preferably, the sample is brought into contact with the probe set before the sample and the probe are brought into contact with the pore. Alternatively, the sample can be brought into contact with the pore before the sample is brought into contact with the probe set, or the probe set can be brought into contact with the pore before the sample is brought into contact with the probe set. If the probe set is brought into contact with the pore before the sample is brought into contact with the pore, it must be ensured that there are sufficient probes for binding the target polynucleotide (and that not all pass through the pore through the membrane), for example by ensuring that a potential is not applied across the transmembrane pore until the probes have bound the target polynucleotide present in the sample.

[0281] Method for measuring concentration

[0282] In some embodiments, a method for determining the presence, absence or amount of two or more target polynucleotides can further comprise, particularly for those probes comprising a quadruplex sequence or a double-stranded sequence and a second non-hybridizing region, comparing the different currents flowing through the pore when each probe is bound to its target polynucleotide and when unbound. This helps to determine the concentration of the target polynucleotide present in the sample, typically with reference to a calibration curve, using an equilibrium constant or reference control data. Methods for calculating the concentration are well known in the art. For example, a calibration curve or control data can be used.

[0283] The present invention also provides a method for determining the amount of two or more target polynucleotides in a sample, the method comprising:

[0284] (i) performing a method for determining the presence, absence or amount of two or more target polynucleotides; and

[0285] (ii) for one or more target polynucleotides shown to be present in the sample, comparing the current flowing through the pore with control or reference data for each target polynucleotide, and thereby determining the amount of said one two or more target polynucleotides in the sample.

[0286] The control or reference data can be generated by performing a control experiment in which a known amount of the target polynucleotide is used to calibrate the assay.

[0287] In some embodiments, the method can include adding a calibration polynucleotide to a sample and contacting the sample with a probe set that further includes a calibration probe, the calibration probe including a non-hybridizing region and a hybridization region that specifically hybridizes with the calibration polynucleotide to form a hybridized probe. The calibration probe can be designed in a manner similar to the probes for the target polynucleotides described herein. For example, the hybridization region of the calibration probe can include one or more non-natural nucleotides. The one or more non-natural nucleotides present in the hybridization region of the calibration probe can increase or decrease the duration of the current blockage resulting from hybridization of the probe with the calibration polynucleotide. The increase or decrease in the duration of the current blockage generally results in an increase in the proportion of the current blockage caused by the calibration probe binding the calibration polynucleotide occurring within the measured current blockage window compared to when the corresponding one or more natural nucleotides are present in the hybridization region of the calibration probe. The hybridized calibration probe produces a current blockage indicative of the probe. The method can further include comparing the frequency or number of current blockages resulting from the calibration probe / calibration polynucleotide interaction with the frequency or number of current blockages resulting from one or more probe / target polynucleotide interactions to determine the amount of one or more target polynucleotides in the sample. The concentration of the target polynucleotide in the sample can be calculated.

[0288] In some embodiments, a calibration polynucleotide having a calibration probe bound thereto can be added to the sample used in the method. The calibration polynucleotide is added to the sample in a known amount, such as at a known concentration. The calibration probe generally binds the calibration polynucleotide under the same conditions as its corresponding probe in the target polynucleotide binding probe set.

[0289] Kit

[0290] In another aspect, the present invention also provides a kit for determining the presence, absence or amount of two or more target polynucleotides in a sample. The kit comprises (a) a set of probes as defined herein and (b) a membrane anchor, (c) a calibration polynucleotide and (d) one or more of calibration probes. The calibration polynucleotide can be any polynucleotide that can be added to the sample at a known concentration in a method for determining the amount of a target polynucleotide or target polynucleotides in a sample. Any suitable polynucleotide can be used. Generally, the calibration polynucleotide is a polynucleotide of the same type as the target polynucleotide. When the target polynucleotide is DNA, the calibration polynucleotide is generally DNA, and when the target polynucleotide is RNA, the calibration polynucleotide is generally RNA. For example, the calibration polynucleotide can be a microRNA that is absent or present only at a negligible level in the sample. The calibration polynucleotide can be a naturally occurring polynucleotide or an artificial polynucleotide. The calibration probe is generally a probe as described herein that has a hybridization region that binds to the calibration polynucleotide. The calibration probe can be present in the set of probes. Alternatively, the calibration probe can hybridize to the calibration polynucleotide in the kit. The kit can further comprise transmembrane pores. Any of the embodiments discussed above with reference to the method of the present invention are equally applicable to the kit.

[0291] The kit can further comprise components of the membrane, such as phospholipids required to form an amphiphilic layer, such as a lipid bilayer or a triblock copolymer.

[0292] The kit can additionally comprise one or more other reagents or instruments that enable any of the embodiments in the above-mentioned embodiments to be carried out. Such reagents or instruments include one or more of the following: one or more suitable buffers (aqueous solutions), a device for obtaining a sample from a subject (such as a container or instrument comprising a needle), a device for amplifying and / or expressing polynucleotides, a membrane as defined above or a voltage clamp or patch clamp device. The reagents can be present in the kit in a dry state such that a fluid sample resuspends the reagents. The kit can also optionally comprise instructions for enabling the kit to be used in the method of the present invention or details regarding which patients the method can be used for. The kit can optionally comprise nucleotides.

[0293] Device

[0294] In another aspect, the present invention also provides a device for determining the presence, absence or amount of two or more target polynucleotides in a sample. The device comprises a plurality of wells and a set of probes of the present invention. The device preferably further comprises instructions for carrying out the method of any one of the embodiments. The device can be any conventional device for polynucleotide analysis, such as an array or a chip. Any of the embodiments discussed above with reference to the method for determining the presence, absence or amount of two or more target polynucleotides are equally applicable to the device of the present invention.

[0295] Preferably, the device is set up to perform any embodiment of a method for determining the presence, absence or amount of two or more target polynucleotides.

[0296] The device preferably further comprises:

[0297] a sensor device capable of supporting a membrane and a plurality of wells and operable to perform target polynucleotide characterization using the wells;

[0298] at least one reservoir for holding materials for performing the characterization;

[0299] a fluid system configured to controllably supply materials from at least one reservoir to the sensor device; and

[0300] a plurality of containers for receiving respective samples, the fluid system being configured to selectively supply samples from the containers to the sensor device.

[0301] The following examples illustrate the invention.

[0302] Example 1

[0303] This example shows how the residence time of microRNA 150, a candidate microRNA biomarker for sepsis, can be adjusted.

[0304] Materials

[0305] DNA sequence (where mN represents 2-O-me-RNA base substitution)

[0306] 150_4G1C_1Alt (SEQ ID NO: 4, cholesterol TEG at the 3' end) final concentration = 500 pM

[0307] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTCGGGGmCAmCTmGGmUAmCAmAGmGGmUTmGGmGA / 3CholTEG /

[0308] 150_4G1C_2Alt (SEQ ID NO: 5, cholesterol TEG at the 3' end) final concentration = 500 pM

[0309] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTCGGGGmCACmUGGmUACmAAGmGGTmUGGmGA / 3CholTEG /

[0310] 150_4G1C_3Alt (SEQ ID NO: 6, Cholesterol TEG at the 3' end) Final concentration = 500 pM

[0311] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTCGGGGmCACTmGGTAmCAAGmGGTTmGGGA / 3CholTEG /

[0312] 150_4G1C_4Alt (SEQ ID NO: 7, Cholesterol TEG at the 3' end) Final concentration = 500 pM

[0313] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTCGGGGmCACTGmGTACAmAGGGTmUGGGA / 3CholTEG /

[0314] 150_4G1C_5Alt (SEQ ID NO: 8, Cholesterol TEG at the 3' end) Final concentration = 500 pM

[0315] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTCGGGGmCACTGGmUACAAGmGGTTGGmGA / 3CholTEG /

[0316] 192_6T (SEQ ID NO: 9, Cholesterol TEG at the 3' end) Final concentration = 500 pM

[0317] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTGGCTGTCAATTCATAGGTCAG / 3CholTEG /

[0318] RNA sequence

[0319] miR-150 (SEQ ID NO: 10) Final concentration = 500 pM

[0320] UCUCCCAACCCUUGUACCAGUG

[0321] miR-192 (SEQ ID NO: 11) Final concentration = 500 pM

[0322] CUGACCUAUGAAUUGACAGCC

[0323] Methods

[0324] Six hybridizations were set up in parallel, in which 10 μM sample miRNA was hybridized with 10 μM corresponding DNA probe in 50 mM NaCl, 10 mM Tris pH 7.5 using the following protocol:

[0325] Equal volumes of each 10 μM preformed duplex were added to low-binding tubes, and the samples were diluted to a final working concentration (500 pM) in 500 mM potassium chloride, 25 mM potassium phosphate buffer pH 8.

[0326] Electrical measurements were obtained from single α-hemolysin nanopores in block copolymers in insertion buffer (600 mM KCl, 25 mM potassium phosphate buffer, 75 mM potassium ferrocyanide (II), 25 mM potassium ferricyanide (III), pH 8.0). After achieving insertion of a single pore into the block copolymer, then buffer (1 mL 600 mM KCl, 25 mM potassium phosphate buffer, 150 mM potassium ferrocyanide (II), 150 mM potassium ferricyanide (III), pH 8.0) was flowed through the system to remove any excess α-hemolysin nanopores. After approximately 900 seconds, 500 μL of the pre-hybridization sample was added, and the potential was controlled using the following protocol:

[0327]

[0328] The protocol detailed above was carried out for 1 hour, and the current through each pore was monitored.

[0329] Results

[0330] When viewed together, the unnatural nucleotides present in the hybridization region result in a distinct difference in the dwell times between different duplex variants. All variants produce longer current blockades ( Figure 1 labeled X in ) than the unmodified duplex. From the data, there is a trend of increasing total number of 2-O-me bases (unnatural nucleotides), resulting in longer current blockades. The current blockade duration of the calibration duplex ( Figure 1 labeled Y in ) is also shown to demonstrate the adjustment of the dwell time of the duplex.

[0331] Example 2

[0332] This example shows how the dwell time of microRNA 182, a putative microRNA biomarker for sepsis, can be modulated.

[0333] Materials

[0334] DNA sequence (where mN represents 2-O-me-RNA base substitution)

[0335] 182_3T_3G_1Alt (SEQ ID NO: 12, Cholesterol TEG is located at the 3' end), final concentration = 500 pM

[0336] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTGGGmAGmUGmUGmAGmUTmCTmACmCAmUTmGCmCAmAA / 3CholTEG /

[0337] 182_3T_3G_2Alt (SEQ ID NO: 13, Cholesterol TEG is located at the 3' end), final concentration = 500 pM

[0338] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTGGGmAGTmGTGmAGTmUCTmACCmATTmGCCmAAA / 3CholTEG /

[0339] 182_3T_3G_3Alt (SEQ ID NO: 14, Cholesterol TEG is located at the 3' end), final concentration = 500 pM

[0340] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTGGGmAGTGmUGAGmUTCTmACCAmUTGCmCAAA / 3CholTEG /

[0341] 182_3T_3G_4Alt (SEQ ID NO: 15, Cholesterol TEG is located at the 3' end), final concentration = 500 pM

[0342] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTGGGmAGTGTmGAGTTmCTACCmATTGCmCAAA / 3CholTEG /

[0343] 182_3T_3G_5Alt (SEQ ID NO: 16, Cholesterol TEG is located at the 3' end), final concentration = 500 pM

[0344] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTGGGmAGTGTGmAGTTCTmACCATTmGCCAAA / 3CholTEG /

[0345] 192_6T (SEQ ID NO: 9, Cholesterol TEG is located at the 3' end) Final concentration = 500 pM

[0346] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTGGCTGTCAATTCATAGGTCAG / 3CholTEG /

[0347] RNA sequence

[0348] miR-182 (SEQ ID NO: 17) Final concentration = 500 pM

[0349] UUUGGCAAUGGUAGAACUCACACU

[0350] miR-192 (SEQ ID NO: 11) Final concentration = 500 pM

[0351] CUGACCUAUGAAUUGACAGCC

[0352] Methods

[0353] Six hybridizations were established in parallel, in which 10 μM sample miRNA was hybridized with 10 μM corresponding DNA probe in 50 mM NaCl, 10 mM Tris pH 7.5 using the following protocol:

[0354]

[0355] Equal volumes of each 10 μM pre-prepared duplex were added to low-binding tubes, and the samples were diluted to the final working concentration (500 pM) in 500 mM potassium chloride, 25 mM potassium phosphate buffer pH 8.

[0356] Electrical measurements were obtained from single α-hemolysin nanopores in block copolymers in an insertion buffer (600 mM KCl, 25 mM potassium phosphate buffer, 75 mM potassium ferrocyanide (II), 25 mM potassium ferricyanide (III), pH 8.0). After achieving the insertion of a single pore into the block copolymer, then buffer (1 mL 600 mM KCl, 25 mM potassium phosphate buffer, 150 mM potassium ferrocyanide (II), 150 mM potassium ferricyanide (III), pH 8.0) was flowed through the system to remove any excess α-hemolysin. After approximately 900 seconds, 500 uL of pre-hybridization sample was added and the potential was controlled using the following protocol:

[0357]

[0358] The protocol detailed above was carried out for 1 hour and the current of each pore was monitored.

[0359] Results

[0360] When observed together, the unnatural nucleotides present in the hybridization region result in a distinct difference in the dwell time between different duplex variants. From the data, there is a trend of increasing total number of 2-O-me (unnatural nucleotide) bases, resulting in longer current blockades (see Figure 2 ). The current blockade of the calibration duplex (labeled Y in Figure 2 ) is also shown to demonstrate the adjustment of the dwell time of the duplex.

[0361] Example 3

[0362] This example shows how the dwell time of microRNA 342, a candidate microRNA biomarker for sepsis, can be regulated.

[0363] Materials

[0364] DNA sequence (where mN represents 2-O-me-RNA base substitution)

[0365] 342 3T_3Sp (SEQ ID NO: 18 is attached to the 5' end of SEQ ID NO: 19 through 3 iSpC3 spacers at its 3' end, which has cholesterol TEG at the 3' end) final concentration = 500 pM

[0366] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTT / iSpC3 / / iSpC3 / / iSpC3 / TCAATCACAGATAGCACCCCT / 3CholTEG /

[0367] 342 3T_3Sp_all_enh (SEQ ID NO: 18 is attached to the 5' end of SEQ ID NO: 20 via three iSpC3 spacers at its 3' end, which has cholesterol TEG at the 3' end) Final concentration = 500 pM

[0368] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTT / iSpC3 / / iSpC3 / / iSpC3 / mTmCmAmAmTmCmAmCmAmGmAmTmAmGmCmAmCmCmCmCmT / 3CholTEG /

[0369] 192_6T (SEQ ID NO: 9, cholesterol TEG is located at the 3' end) Final concentration = 500 pM

[0370] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTGGCTGTCAATTCATAGGTCAG / 3CholTEG /

[0371] RNA sequence

[0372] miR - 342 (SEQ ID NO: 21) Final concentration = 500 pM

[0373] AGGGGUGCUAUCUGUGAUUGA

[0374] miR - 192 (SEQ ID NO: 11) Final concentration = 500 pM

[0375] CUGACCUAUGAAUUGACAGCC

[0376] Methods

[0377] Three hybridizations were established in parallel, in which 10 μM sample miRNA was hybridized with 10 μM corresponding DNA probe in 50 mM NaCl, 10 mM Tris pH 7.5 using the following protocol:

[0378]

[0379]

[0380] Equal volumes of each 10 μM pre - formed duplex were added to low - binding tubes, and the samples were diluted to the final working concentration (500 pM) in 500 mM potassium chloride, 25 mM potassium phosphate buffer pH 8.

[0381] Electrical measurements were obtained from single α - hemolysin nanopores in block copolymers in insertion buffer (600 mM KCl, 25 mM potassium phosphate buffer, 75 mM potassium ferrocyanide (II), 25 mM potassium ferricyanide (III), pH 8.0). After achieving the insertion of a single pore into the block copolymer, then buffer (1 mL 600 mM KCl, 25 mM potassium phosphate buffer, 150 mM potassium ferrocyanide (II), 150 mM potassium ferricyanide (III), pH 8.0) was flowed through the system to remove any excess α - hemolysin nanopores. After approximately 900 seconds, 500 μL of the pre - hybridized sample was added, and the potential was controlled using the following protocol.

[0382]

[0383] The protocol detailed above was carried out for 1 hour, and the current of each pore was monitored.

[0384] Results

[0385] Figure 3 It was shown that it was possible to successfully tune the dwell time of miRNA:DNA hybrid duplex blockades such that they clustered within the desired window (approximately 1 second in this example). Figure 3 Group 1 of shows the current blockade ratio and dwell time of an unmodified 342_3T_3SP RNA duplex. Figure 3 Group 2 of shows the addition of a dwell - adjusted 342_3T_3SP duplex (3423T_3Sp_all_enh, labeled X) to the original sample. It was observed that modification of the hybridization region (where all nucleotides in the hybridization region are non - natural nucleotides) had shifted the average dwell of the current blockade clusters into the desired window centered at 1 second. Group 3 shows the addition of a calibration duplex (labeled Y), which was used for comparison between experiments.

[0386] Example 4

[0387] This example shows how to use nanopores to detect five different microRNAs, which are candidate markers for sepsis. The probes for detecting microRNAs have a) no non - natural nucleotides in the hybridization region (microRNAs 192 and 486), b) all non - natural nucleotides in the hybridization region (microRNA 342), or c) patterned non - natural nucleotides in the hybridization region (microRNAs 150 and 182).

[0388] Materials

[0389] DNA sequence (where mN represents 2-O-me-RNA base substitution)

[0390] 182_6T_1Alt (SEQ ID NO: 22, cholesterol TEG is located at the 3' end), final concentration = 500 pM

[0391] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTmAGmUGmUGmAGmUTmCTmACmCAmUTmGCmCAmAA / 3CholTEG /

[0392] 192_3_3SP (SEQ ID NO: 18 is attached to the 5' end of SEQ ID NO: 23 through 3 iSpC3 spacers at its 3' end, which has cholesterol TEG at the 3' end), final concentration = 500 pM

[0393] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTT / iSpC3 / / iSpC3 / / iSpC3 / GGCTGTCAATTCATAGGTCAG / 3CholTEG /

[0394] 342_3T_3SP_All_enh (SEQ ID NO: 18 is attached to the 5' end of SEQ ID NO: 20 through 3 iSpC3 spacers at its 3' end, which has cholesterol TEG at the 3' end), final concentration = 500 pM

[0395] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTT / iSpC3 / / iSpC3 / / iSpC3 / mTmCmAmAmTmCmAmCmAmGmAmTmAmGmCmAmCmCmCmCmT / 3CholTEG /

[0396] 150_4G1C_2Alt (SEQ ID NO: 5, cholesterol TEG is located at the 3' end), final concentration = 500 pM

[0397] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTCGGGGmCACmUGGmUACmAAGmGGTmUGGmGA / 3CholTEG /

[0398] 486_3T_3X (SEQ ID NO: 18 is attached at its 3'-end to three 1',2'-dideoxyribose spacers, which are attached to the 5'-end of SEQ ID NO: 24, which has cholesterol TEG at its 3'-end) Final concentration = 500 pM

[0399] TTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTTTTTTCTTTTTT / idSp / idSp / idSp / CTCGGGGCAGCTCAGTACAGGA / 3CholTEG /

[0400] RNA sequence

[0401] hsa-miR-192 (SEQ ID NO: 11)

[0402] CUGACCUAUGAAUUGACAGCC

[0403] hsa-miR-342 (SEQ ID NO: 25)

[0404] AAAGGGGUGCUAUCUGUGAUUGA

[0405] hsa-miR-150 (SEQ ID NO: 10)

[0406] UCUCCCAACCCUUGUACCAGUG

[0407] hsa-miR-182 (SEQ ID NO: 17)

[0408] UUUGGCAAUGGUAGAACUCACACU

[0409] hsa-miR-486 (SEQ ID NO: 26)

[0410] UCCUGUACUGAGCUGCCCCGAG

[0411] Methods

[0412] Five hybridizations were established in parallel, in which 10 μM sample miRNA was hybridized with 10 μM corresponding DNA probe in 50 mM NaCl, 10 mM Tris pH 7.5 using the following protocol:

[0413]

[0414] Equal volumes of each 10 μM pre - fabricated duplex were added to low - binding tubes, and the samples were diluted to the final working concentration (500 pM) in 500 mM potassium chloride, 25 mM potassium phosphate buffer pH 8.

[0415] Electrical measurements were obtained from single α - hemolysin nanopores in block copolymers in insertion buffer (600 mM KCl, 25 mM potassium phosphate buffer, 75 mM potassium ferrocyanide (II), 25 mM potassium ferricyanide (III), pH 8.0). After achieving the insertion of a single pore into the block copolymer, then buffer (1 mL 600 mM KCl, 25 mM potassium phosphate buffer, 150 mM potassium ferrocyanide (II), 150 mM potassium ferricyanide (III), pH 8.0) was flowed through the system to remove any excess α - hemolysin nanopores. After approximately 900 seconds, 500 μL of the pre - hybridized sample was added, and the potential was controlled using the following protocol.

[0416]

[0417] The protocol detailed above was carried out for 1 hour, and the current through each pore was monitored.

[0418] Results

[0419] Here, we show miRNA and hybridization probe sets that have been designed to give well - separated current - blockade clusters. Figure 4 Shows how three metrics are used to determine the identity of the clusters corresponding to a specific microRNA. Current - blockade length (or dwell) (Part A), “variation” or standard deviation (Part B), and current - blockade noise (Part C). Five clusters are visible corresponding to 5 duplexes, as Figure 4 highlighted. In descending order: 192 - 3T_3Sp, 342 - 3T_3Sp_all_enh, 486 - 3T_3X, 150_4G_1C_2Alt, 182 - 6T_1Alt. As can be seen from the first set, only the current - blockades detected within a defined window were measured and presented for further analysis.

Claims

1. A method for determining the presence, absence or amount of two or more target polynucleotides in a sample comprising additional components, the method comprising: (i) contacting the sample with a set of two or more probes under conditions suitable for hybridization of the target polynucleotide with the probe, wherein: (a) each probe comprises a non-hybridizing region and a hybridizing region that hybridizes specifically with one of the target polynucleotides to form a hybridized probe; and (b) the hybridizing regions of the probes in the set comprise one or more unnatural nucleotides; (ii) contacting the sample prepared in step (i) with a transmembrane pore through which single-stranded polynucleotides, but not double-stranded polynucleotides, can pass, and applying a potential difference across the transmembrane pore such that the probes in the sample pass through the pore, wherein at least a portion of the non-hybridizing region of the probe in the sample enters the transmembrane pore and remains within the transmembrane pore until the target polynucleotide dissociates from the hybridizing region of the probe, and then the probe passes through the pore; (iii) measuring a current blockage having a duration within a defined window, the current blockage comprising current blockages caused by probes bound to their respective targets and excluding longer and / or shorter current blockages, wherein: (a) the one or more unnatural nucleotides present in the hybridizing region of the probe increase or decrease the duration of the current blockage due to hybridization of the probe with its target polynucleotide compared to when corresponding one or more natural nucleotides are present in the hybridizing region, such that the current blockage occurring due to the movement of the hybridized probe through the pore occurs within the defined window; and (b) each hybridized probe produces a current blockage signal pattern indicative of the probe; and (iv) correlating the measured current blockage signal pattern with the probe to thereby determine the presence, absence or amount of the two or more target polynucleotides in the sample; and wherein the method is for non-diagnostic use.

2. The method according to claim 1, wherein the non-hybridizing regions of at least two probes in the set are different from each other, and the method comprises separately determining the presence or absence of the target polynucleotide hybridizing with each of the at least two probes.

3. The method according to claim 2, wherein each probe in the set comprises a unique non-hybridizing region.

4. The method according to any one of the preceding claims, wherein the unnatural nucleotide comprises (i) a modified sugar, optionally wherein the modified sugar is 2'-O-methyl ribose; and / or (ii) a modified nucleobase.

5. The method according to claim 4, wherein the unnatural nucleotide is peptide nucleic acid, locked nucleic acid, unlocked nucleic acid, bridged nucleic acid (BNA) or morpholino.

6. The method according to any one of the preceding claims, wherein at least one of the hybridization regions comprises one or more instances of ZxNy and / or NyZx, where Z is a non-natural nucleotide, N is a natural nucleotide complementary to one of the nucleotides in the target polynucleotide, X is 1, 2, 3, 4 or 5, and Y is 1, 2, 3, 4 or 5.

7. The method according to any one of the preceding claims, wherein in at least one of the probes, the non-hybridization region is 5' of the hybridization region; and / or wherein in at least one of the probes, the hybridization region is located at the 3' end of the probe.

8. The method according to any one of the preceding claims, wherein the probe further comprises a second non-hybridization region, and a second hybridization region, a quadruplex sequence or a double-stranded region, wherein the first and second non-hybridization regions are separated by the first or second hybridization region, the quadruplex sequence or the double-stranded region.

9. The method according to any one of the preceding claims, wherein the non-hybridization region comprises a polymer; optionally, wherein the polymer is a polynucleotide, a polypeptide, polyethylene glycol (PEG) or a polysaccharide.

10. The method according to any one of the preceding claims, wherein one or more of the probes further comprises an anchor that permits its coupling to the membrane.

11. The method according to any one of the preceding claims, wherein the window is defined to comprise a current blockade between 0.01 seconds and 10 seconds.

12. The method according to any one of the preceding claims, wherein the duration of the current blockade caused by at least two of the probes hybridized to their respective target polynucleotides or caused by all of the hybridizing probes in the set differ from each other by one second or less.

13. The method according to any one of the preceding claims, wherein the target polynucleotide is a single-stranded oligonucleotide having a length of 15 to 30 nucleotides; optionally, wherein at least one of the polynucleotides is an siRNA or a microRNA.

14. The method according to any one of the preceding claims, wherein the transmembrane pore is a protein pore or a solid-state pore.

15. The method according to any one of the preceding claims, wherein: (a) the sample comprises a known amount of a calibration probe that hybridizes to a calibration polynucleotide, or step (i) further comprises adding a known amount of a calibration polynucleotide to the sample and contacting the sample with the calibration probe under conditions suitable for hybridization of the calibration polynucleotide to the calibration probe, wherein the calibration probe comprises a hybridization region and a non-hybridization region, the hybridization region specifically hybridizes to the calibration polynucleotide, and the non-hybridization region produces a current blockade indicative of the calibration probe; and (b) the method further comprises (v) comparing the frequency of the current blockade generated by the movement of one or more probes hybridized to a target polynucleotide through the pore with the frequency of the current blockade generated by the movement of a hybridized calibration probe through the pore to determine the concentration of one or more of the target polynucleotides.

16. The method according to claim 15, wherein the hybridization region of the calibration probe comprises one or more unnatural nucleotides, and the one or more unnatural nucleotides increase or decrease the duration of the current blockage due to hybridization of the calibration probe with the calibration polynucleotide, such that the proportion of the current blockage occurring within the window due to movement of the hybridized calibration probe through the pore is increased compared to when a corresponding one or more natural nucleotides are present in the hybridization region.

17. Use of a probe set as defined in any one of claims 1 - 10 for detecting the presence or absence of two or more target polynucleotides in the method according to any one of claims 1 - 16, wherein the use is non-diagnostic.

18. A kit for determining the presence, absence or amount of two or more target polynucleotides, comprising (a) a probe set as defined in any one of claims 1 - 10 and (b) a membrane anchor, (c) a calibration polynucleotide, and (d) one or more of a calibration probe.

19. Use of a group of two or more probes in the preparation of a kit for a method of determining the presence, absence or amount of two or more target polynucleotides in a sample comprising additional components, wherein the method comprises: (i) contacting the sample with the group of two or more probes under conditions suitable for hybridization of the target polynucleotide with the probes, wherein: (a) each probe comprises a non-hybridization region and a hybridization region that hybridizes specifically with one of the target polynucleotides to form a hybridized probe; and (b) the hybridization region of the probes in the group comprises one or more unnatural nucleotides; (ii) contacting the sample prepared in step (i) with a transmembrane pore through which single-stranded polynucleotides, but not double-stranded polynucleotides, can pass, and applying a potential difference across the transmembrane pore such that the probes in the sample pass through the pore, wherein at least a portion of the non-hybridization region of the probes in the sample enters the transmembrane pore and remains within the transmembrane pore until the target polynucleotide dissociates from the hybridization region of the probe, and then the probe passes through the pore; (iii) measuring a current blockage having a duration within a defined window, the current blockage comprising current blockages caused by probes bound to their respective targets and excluding longer and / or shorter current blockages, wherein: (a) the one or more unnatural nucleotides present in the hybridization region of the probe increase or decrease the duration of the current blockage due to hybridization of the probe with its target polynucleotide compared to when a corresponding one or more natural nucleotides are present in the hybridization region, such that the current blockage due to movement of the hybridized probe through the pore occurs within the defined window; and (b) each hybridized probe produces a current blockage signal pattern indicative of the probe; and (iv) correlating the measured current blockage signal pattern with the probe to thereby determine the presence, absence or amount of the two or more target polynucleotides in the sample. Use of a probe set as defined in any one of claims 1-10 in the preparation of a kit for detecting the presence or absence of two or more target polynucleotides according to the method of any one of claims 1-16.

Citation Information

Patent Citations

  • A miniature support for thin films containing single channels or nanopores and methods for using same

    WO2000028312A1

  • Deliver of molecules to a li id bila

    WO2006100484A2

  • Lipid bilayer sensor system

    WO2008102120A1

  • Formation of layers of amphiphilic molecules

    WO2009077734A2

  • Hybridization linkers

    WO2010086602A1