A method for designing and connecting amplification primers for DNA molecules

Abstract

The present invention discloses a method for designing and ligating primers for DNA amplification, particularly a library construction method for increasing the effective data volume of PacBio amplicon sequencing. The method includes designing different primer pairs for DNA molecules, and using the different primer pairs to perform PCR amplification on the template DNA in different amplification systems. The method ligates shorter PCR products to generate a longer library, which is then used for sequencing on a sequencing machine. This method can significantly improve data utilization while ensuring data quality.

Description

Technical Field

[0001] The present invention belongs to the field of biological sequencing, and specifically relates to a method for designing and connecting amplification primers for DNA molecules, in particular to a library construction method for increasing the amount of Pacbio amplicon sequencing data. Background Art

[0002] In certain sequencing applications, library construction requires amplification, and the insert fragments are long, requiring long-read sequencing, such as full-length 16S rDNA sequencing, 18S rDNA sequencing, ITS sequencing, target gene sequencing, full-length transcriptome sequencing, and targeted full-length transcriptome sequencing. In the Pacbio long-read sequencing platform, its sequencing reagents have undergone several versions of development, and the enzyme read length has now been increased to over 60k. Because each well of the Pacbio sequencing chip can only read one library molecule, the library molecule formed by the amplified product is read repeatedly in the sequencing well, resulting in redundancy and waste of enzyme read length.

[0003] Currently, in different applications, the conventional process for constructing a Pacbio library after obtaining the amplified product is: amplification product -> DNA damage repair -> end repair -> magnetic bead purification -> adapter ligation -> removal of incomplete library -> magnetic bead purification.

[0004] Conventional library construction process: After obtaining PCR products through amplification (such as using 16S rDNA full-length primers to amplify the microbial genome), DNA damage repair is performed, sequencing adapters are added, incomplete libraries are removed using digestion enzymes, and sequencing libraries are obtained after purification.

[0005] Typically, the length of the amplicon and the average length of the full-length transcriptome are relatively short. The 16S rDNA amplicon is approximately 1.5k, the 18S rDNA is approximately 1.8k, the average length of the full-length transcriptome is less than 2k, and the full-length transcripts of immune cell TCR / BCRs are approximately 1-1.8k. The average length of the corresponding libraries obtained through conventional library construction is also less than 2k, while the enzyme read length of the Pacbio sequencing platform can reach over 60k, meaning that a single library molecule can undergo over 30 sequencing cycles. According to statistics, six sequencing cycles are sufficient for accurate sequence analysis. Therefore, the additional sequencing data represents a significant amount of data redundancy, meaning that existing library construction methods cannot fully utilize the advantages of the Pacbio platform's enzyme read length. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a method for designing and connecting amplification primers for DNA molecules in order to overcome the defect in the existing technology of library construction for existing amplification products that cannot fully utilize the advantages of the enzyme read length of the Pacbio platform. A head-to-tail connection library construction scheme is designed, in which PCR products are connected end to end through sticky ends, thereby increasing the average length of the library, so that more valid data can be obtained after sequencing.

[0007] The present invention mainly solves the above technical problems through the following technical solutions.

[0008] The present invention provides a set of PCR primer pairs, wherein the characteristic association between different primer pairs is as follows: between two different primer pairs, the n bases at the 5' end of the forward primer of one primer pair and the reverse primer of another primer pair have the following characteristics: the first base of the n bases is A and the nth base is dU; n is an integer from 4 to 30; in addition, the products amplified by the primer pairs can be connected by removing the dU bases of the amplified products to generate sticky ends;

[0009] The forward primer of the first primer pair and the reverse primer of the last primer pair do not have the characteristic association: the products amplified by the primer pairs can be connected end to end through the sticky ends.

[0010] In a preferred embodiment of the present invention, n is an integer of 4-6.

[0011] In a preferred embodiment of the present invention, n is 6.

[0012] The present invention provides a method for amplifying a DNA molecule, wherein the amplification method includes designing different primer pairs for the DNA molecule, and using the different primer pairs to perform PCR amplification on the DNA molecule in different amplification systems; the characteristic correlation between the different primer pairs is:

[0013] Between two different pairs of primers, the n bases at the 5' end of the forward primer of one primer pair and the reverse primer of another primer pair have the following characteristics: the first base of the n bases is A and the nth base is dU; n is an integer from 4 to 30; and the products amplified by the primer pairs are connected by removing the dU bases in the amplified products to generate sticky ends.

[0014] The forward primer of the first primer pair and the reverse primer of the last primer pair do not have the characteristic association: the products amplified by the primer pairs can be connected end to end through the sticky ends.

[0015] In a preferred embodiment of the present invention, n is an integer of 4-6.

[0016] In a preferred embodiment of the present invention, n is 6.

[0017] In a preferred embodiment of the present invention, the amplification method of the present invention further comprises: after performing the PCR amplification, connecting amplification products obtained from different amplification systems.

[0018] In a preferred embodiment of the present invention, Uracil-DNA Glycosylase (UDG) and Endonuclease VIII in USER enzymes are used to digest and remove dU bases.

[0019] The present invention provides a library construction method for improving the amount of Pacbio amplicon sequencing data, wherein the library construction method includes the amplification method according to the present invention.

[0020] In a preferred embodiment of the present invention, before PCR is performed on the template, the PCR system is divided into n tubes, with different PCR primers added to each tube. The forward or reverse primers in different primer pairs (excluding the forward primer in tube 1 and the reverse primer in tube n) differ only in a few linker sequences at their 5' ends. The first base at the 5' end of the linker sequence is A, and the last base is dU (e.g., if the 5' end has a six-base linker sequence, the first base is A, and the sixth base is dU). The dU bases are then digested and removed by Uracil-DNA Glycosylase (UDG) and Endonuclease VIII in the USER enzymes, thereby generating a series of sticky ends. The sticky end series is characterized by product A ligating only to product B 1, product B 1 ligating only to product A and product B 2, product B n-1 ligating only to product B n-2 and product B n, and product B n ligating only to product B n-1 and product C. The products with sticky ends are connected using DNA ligase. Due to the sequence characteristics of the sticky ends, different products will be connected end to end in sequence.

[0021] Because ligation efficiency is not 100%, the ligation product contains some nicks, requiring PCR amplification to screen for fully ligated products. The forward primer in tube 1 and the reverse primer in tube n do not have dU at their 5' ends and serve as primer binding sites for the screening PCR. Adding sequencing adapters to the PCR products yields a standard dumbbell-shaped library.

[0022] The present invention designs a set of primers with dU, and in the Pacbio amplicon library construction process, a fixed number of amplified fragments are sequentially connected and then sequenced, which can fully utilize the ultra-long read length of Pacbio sequencing.

[0023] The present invention can be applied to the field of using Pacbio sequencing to obtain sequence information of amplicons such as full-length transcripts, 16S, 18S and other target gene fragment amplicons.

[0024] This invention is based on the official full-length transcriptome library construction process of Pacbio. After redesigning the library construction process, the length of the library is increased by connecting the transcript PCR products, thereby improving the availability of sequencing data.

[0025] The present invention provides a method for full-length transcriptome sequencing, wherein the method includes the amplification method according to the present invention.

[0026] The present invention provides the use of the PCR primer pair according to the present invention in DNA molecule amplification, improving the amount of Pacbio amplicon sequencing data or full-length transcriptome sequencing.

[0027] The present invention provides a set of primer pairs for amplifying TCR / BCR cDNA, wherein the sequences of the primer pairs are shown in SEQ ID NOs: 1 to 8.

[0028] The present invention provides a set of PCR primer pairs, wherein the relationship between different primer pairs is as follows: between two different primer pairs, the difference between the forward primer of one primer pair and the reverse primer of another primer pair is n bases at the 5' end, wherein the first base of the n bases is A and the nth base is dU; wherein n is an integer greater than or equal to 4;

[0029] There is no characteristic correlation between the forward primer of the first primer pair and the reverse primer of the last primer pair.

[0030] The above n is preferably 4 to 30, and more preferably 6.

[0031] The present invention also provides a method for amplifying a DNA molecule, the method comprising designing different primer pairs for the DNA molecule, and using the different primer pairs to perform PCR amplification on the template DNA in different amplification systems; the characteristic correlation between the different primer pairs is:

[0032] Between two different pairs of primers, the difference between the forward primer of one primer pair and the reverse primer of another primer pair is n bases at the 5' end, wherein the first base of the n bases is A and the nth base is dU; wherein n is an integer greater than 4;

[0033] There is no characteristic correlation between the forward primer of the first primer pair and the reverse primer of the last primer pair.

[0034] Wherein, the n is preferably less than 30, and more preferably 6.

[0035] The amplification method of the present invention preferably further comprises: after the PCR amplification, ligating amplification products obtained from different amplification systems, preferably by removing dU bases from the amplification products to generate sticky ends. Preferably, dU bases are digested and removed using Uracil-DNA Glycosylase (UDG) and Endonuclease VIII from USER enzymes.

[0036] The present invention also provides a library construction method for increasing the amount of Pacbio amplicon sequencing data, which includes the amplification method as described in the first aspect of the present invention.

[0037] In one embodiment of the present invention, before PCR is performed on the template, the PCR system is divided into n tubes, with different PCR primers added to each tube. The forward or reverse primers of the different primer pairs (excluding the forward primer in tube 1 and the reverse primer in tube n) differ only in a few linker sequences at their 5' ends. The first base of the 5' end of the linker sequence is A, and the last base is dU (e.g., if the 5' end has a six-base linker sequence, the first base is A, and the sixth base is dU). The dU bases are then digested and removed by Uracil-DNA Glycosylase (UDG) and Endonuclease VIII in the USER enzymes, thereby generating a series of sticky ends. The sticky end series is characterized by product A ligating only to product B 1, product B 1 ligating only to product A and product B 2, product B n-1 ligating only to product B n-2 and product B n, and product B n ligating only to product B n-1 and product C. The products with sticky ends are connected using DNA ligase. Due to the sequence characteristics of the sticky ends, different products will be connected end to end in sequence.

[0038] Because ligation efficiency is not 100%, the ligation product contains some nicks, requiring PCR amplification to screen for fully ligated products. The forward primer in tube 1 and the reverse primer in tube n do not have dU at their 5' ends and serve as primer binding sites for the screening PCR. Adding sequencing adapters to the PCR products yields a standard dumbbell-shaped library.

[0039] The present invention designs a set of primers with dU, and in the Pacbio amplicon library construction process, a fixed number of amplified fragments are sequentially connected and then sequenced, which can fully utilize the ultra-long read length of Pacbio sequencing.

[0040] The present invention can be applied to the field of using Pacbio sequencing to obtain sequence information of amplicons such as full-length transcripts, 16S, 18S and other target gene fragment amplicons.

[0041] The present invention is based on the official full-length transcriptome library construction process of Pacbio. After redesigning the library construction process, the length of the library is increased by connecting the transcript PCR products, thereby improving the availability of sequencing data.

[0042] The present invention also provides a library construction method for improving the amount of Pacbio amplicon sequencing data, which includes the amplification method as described above.

[0043] The present invention also provides a method for full-length transcriptome sequencing, which includes the amplification method described above.

[0044] The present invention also provides the use of the PCR primer pair described above in DNA molecule amplification, improving the amount of Pacbio amplicon sequencing data or full-length transcriptome sequencing.

[0045] The present invention also provides a set of primer pairs for amplifying TCR / BCR cDNA, the sequences of the primer pairs are shown in SEQ ID NOs: 1 to 8.

[0046] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0047] The reagents and raw materials used in the present invention are commercially available.

[0048] The positive progress effect of the present invention is:

[0049] The present invention connects shorter PCR products to obtain a longer library, and uses the connected library for sequencing on a machine, which can significantly improve data utilization while ensuring data quality; the throughput can be increased by up to 3.06 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 Schematic diagram for building a library for end-to-end connection. DETAILED DESCRIPTION

[0051] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.

[0052] The full-length TCR / BCR cDNA (known at present) amplified products obtained from the 10x Genomics platform were respectively constructed using the ligation library construction technology of the present invention and conventional library construction methods (see the library construction principle for details). Figure 1 ) and sequenced.

[0053] Example 1: Using the connection library construction technology of the present invention to build a library

[0054] 1. PCR amplification

[0055] 1.1 Second-strand synthesis

[0056] Take 20 ng of TCR / BCR captured PCR product and prepare the following PCR system (Table 1):

[0057] Table 1 PCR system

[0058] Reagent name Dosage PCR products after capture 20ng KAPA HiFi HotStart Uracil+ReadyMix(2×) 50 μl Nuclease-free water (NF water) Make up to 94 μl

[0059] Divide the PCR system into 4 tubes and add the following 4 pairs of primers (Table 2) to each tube, adding 0.75 μl of each primer (10 mM):

[0060] Table 2 PCR amplification primers

[0061]

[0062] The PCR reaction program is shown in Table 3:

[0063] Table 3 PCR reaction system

[0064]

[0065] 1.2 Sample purification

[0066] 1) After performing Qubit quantification on 4 tubes of PCR products, equal amounts were mixed.

[0067] 2) Add 1 volume of AMPure XP magnetic beads to the 1.5 mL centrifuge tube containing the PCR mixture, mix thoroughly, and centrifuge briefly. Incubate at room temperature for 5 minutes.

[0068] 3) Transfer the centrifuge tube to a magnetic rack, let it stand until it is clear, and then remove the supernatant.

[0069] 4) Add 300 μL of 80% ethanol, let it stand for 30 seconds, and then discard the supernatant.

[0070] 5) Repeat the previous step once, open the lid and let it air dry for 5 minutes to remove any residual ethanol.

[0071] 6) Re-dissolve with 19 μL elution buffer and place on ThemoMixer at 20°C, 2000 rpm, for 10 min.

[0072] 7) After 10 minutes, remove the centrifuge tube, centrifuge briefly for 2 seconds, place on a magnetic rack, and let it stand until clear. Aspirate the supernatant and collect it in another labeled 1.5 mL centrifuge tube.

[0073] 8) Take 1 μL of the purified sample and dilute it 5-fold. Take 1 μL of the dilution solution for Qubit assay, and perform 2100 quality control on the remaining diluted sample.

[0074] 2. Connect in sequence from beginning to end

[0075] Take the purified PCR product and configure the following system (Table 4):

[0076] Table 4 PCR system

[0077] Reagents Volume / μL Purified PCR products 17 10×T4 DNA ligase buffer 2 USER Enzyme (1 unit) 1

[0078] After mixing, incubate at 37°C for 20 min. Add 1 μL of T4 DNA ligase (NEB), mix, and incubate at 16°C for 1 h.

[0079] Add 80 μL of water to 100 μL. Add 0.4 times the volume (40 μL) of AMPure XP magnetic beads to the tube for purification, and finally dissolve in 20 μL of elution buffer. Measure the concentration of the purified product using the Qubit dsDNA HS Assay kit.

[0080] 3. PCR amplification of ligation products

[0081] Take 100 ng of the purified ligation product and prepare the following PCR system (Table 5):

[0082] Table 5 PCR amplification system

[0083] Reagent name Dosage Connection products 100ng KAPAHiFi HotStart ReadyMix(2×) 50 μL Selection primer (10mM) 6μL Nuclease-free water (NF water) Make up to 100 μL

[0084] Selection Primer: 5'PHO-CGACATGGCTACGATCCGAC-3' was used to screen PCR primers for effective ligation products.

[0085] The PCR reaction program is shown in Table 6:

[0086] Table 6 PCR amplification program

[0087]

[0088] Take 0.4 times the volume (40 μL) of AMPure XP magnetic beads and add them to the tube for purification, and finally dissolve them back in 27 μL of elution buffer.

[0089] 4. End repair and connector addition (using Ultra TM II DNA Library Prep Kit for Illumina)

[0090] 4.1 End Repair

[0091] The purified ligation product was prepared into the following system (Table 7):

[0092] Table 7 End repair system

[0093] Reagents Volume / μL Purified product from the previous step 25 NEBNext Ultra II End Prep Reaction Buffer 3.5 NEBNext Ultra II End Prep Enzyme Mix 1.5

[0094] After mixing, react at 20℃ for 30 minutes, then at 65℃ for 30 minutes, and then maintain at 4℃.

[0095] 4.2 Adding Sequencing Adapters

[0096] The following system was added to the product of the previous step (Table 8):

[0097] Table 8 Linker Addition Reaction System

[0098] Reagents Volume / μL NEBNext Ultra II Ligation Master Mix 15 NEBNext Ligation Enhancer 0.5 Connector (PB barcoded adapter) 1.5

[0099] Note: The PB barcoded adapter sequence is: 5'- / 5Phos / (16bp barcode)ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT(16bp barcode)T-3'

[0100] After mixing, react at 20°C for 30 min.

[0101] 5. Enzyme Digestion Reaction and Magnetic Bead Purification

[0102] 1) Add the following mix (Table 9) to the product from the previous step:

[0103] Table 9 Enzyme digestion reaction system

[0104] Reagents Volume / μL Reaction buffer (NEBuffer I, 10X) 10 Exonuclease I (20 U / μL, NEB) 2 Exonuclease III (100 U / μL, NEB) 2 Nuclease-free water (NF water) 39

[0105] After mixing, react at 37°C for 1 h.

[0106] 2) Add 0.4 times the volume (40 μL) of AMPure XP magnetic beads to a 1.5 mL centrifuge tube containing the enzymatic digestion reaction product for purification, and finally dissolve it back in 15 μL of elution buffer.

[0107] 3) Take 1 μL of the purified sample and dilute it 5-fold. Take 1 μL of the diluted sample for Qubit detection, and perform 2100 quality control on the remaining diluted sample.

[0108] 6. Sequencing

[0109] The Diffusion loading protocol provided by Pacbio was used, and the preparation and sequencing were performed according to the corresponding instructions.

[0110] Example 2: Using conventional library construction technology to build a library

[0111] 1. PCR Amplification

[0112] Take 20 ng of TCR / BCR captured PCR product and prepare the following PCR system (Table 10):

[0113] Table 10 PCR amplification system

[0114] Reagent name Dosage PCR products after capture 20ng KAPA HiFi HotStart ReadyMix(2×) 50 μL Forward primer (10mM) 3μL Reverse primer (10mM) 3μL Nuclease-free water (NF water) Make up to 100 μL

[0115] The primer information is as follows (Table 11):

[0116] Table 11 Amplification primer sequences

[0117] Primer name Primer sequence 5'-3' Forward primer PHO-CTACACGACGCTCTTCCGATCT Reverse primer PHO-AAGCAGTGGTATCAACGCAGAG

[0118] The PCR reaction program is shown in Table 12:

[0119] Table 12 PCR reaction program

[0120]

[0121] Detect the PCR product concentration using the Qubit dsDNA HS Assay kit; the concentration should be greater than 20 ng / μL. Add 0.8 times the volume (80 μL) of AMPure XP magnetic beads to the tube for purification and dissolve in 27 μL of elution buffer.

[0122] 2. End repair and connector addition (using Ultra TM IIDNA Library Prep Kit for Illumina

[0123] 2.1 End repair

[0124] The purified ligation product was prepared into the following system (Table 13):

[0125] Table 13 End repair system

[0126] Reagents Volume / μL Purified product from the previous step 25 NEBNext Ultra II End Prep Reaction Buffer 3.5 NEBNext Ultra II End Prep Enzyme Mix 1.5

[0127] After mixing, react at 20℃ for 30 minutes, then at 65℃ for 30 minutes, and then maintain at 4℃.

[0128] 2.2 Adding Sequencing Adapters

[0129] The following system was added to the product of the previous step (Table 14):

[0130] Table 14 Linker Addition Reaction System

[0131] Reagents Volume / μL NEBNext Ultra II Ligation Master Mix 15 NEBNext Ligation Enhancer 0.5 Connector (PB barcoded adapter) 1.5

[0132] Note: The linker sequence is the same as that used in 4.2 of Example 1.

[0133] After mixing, react at 20°C for 30 min.

[0134] 3. Enzyme Digestion Reaction and Magnetic Bead Purification

[0135] 1) Add the following mix (Table 15) to the product from the previous step:

[0136] Table 15 Enzyme digestion reaction system

[0137] Reagents Volume / μL Reaction buffer (NEBuffer I, 10X) 10 Exonuclease I (20 U / μL, NEB) 2 Exonuclease III (100 U / μL, NEB) 2 Nuclease-free water (NF water) 39

[0138] After mixing, react at 37°C for 1 h.

[0139] 2) Add 0.8 times the volume (80 μL) of AMPure XP magnetic beads to a 1.5 mL centrifuge tube containing the enzymatic digestion reaction product for purification, and finally dissolve it back in 15 μL of elution buffer.

[0140] 3) Take 1 μL of the purified sample and dilute it 5-fold. Take 1 μL of the diluted sample for Qubit detection, and perform 2100 quality control on the remaining diluted sample.

[0141] 4. Sequencing

[0142] The Diffusion loading protocol provided by Pacbio was used, and the preparation and sequencing were performed according to the corresponding instructions.

[0143] 5. Test results:

[0144] Table 16 Statistics of data analysis results

[0145]

[0146] The number of CCSs represents the circular consensus sequence, and one CCS is measured by one sequencing pore.

[0147] The number of reads indicates the number of valid transcripts obtained by CCS after data analysis.

[0148] Since each CCS in the data obtained from conventional library construction only contains one transcript information, the number of transcript reads after data filtering is lower than the number of CCS; however, in the data obtained from the ligation method library construction of the present invention, each CCS contains multiple transcript information, so the number of transcript reads obtained is greater than the number of CCS (Table 16). The present invention can significantly increase the number of transcripts detected.

Claims

1. A set of PCR primer pairs, characterized in that: The characteristic association between different primer pairs is as follows: between two different primer pairs, the n bases at the 5' end of the forward primer of one primer pair and the reverse primer of another primer pair have the following characteristics: the first base of the n bases is A and the nth base is dU; n is an integer from 4 to 30; in addition, the products amplified by the primer pairs can be connected to the PCR products by removing the dU bases in the amplified products to generate sticky ends; The forward primer of the first primer pair and the reverse primer of the last primer pair do not have the characteristic association: the products amplified by the primer pairs can be connected end to end through the sticky ends, Except for the forward primer of the first primer pair and the reverse primer of the last primer pair, the forward primers or reverse primers of different primer pairs only differ in several connecting sequences at the 5' end. The first base at the 5' end of the linker sequence is A, and the last base is dU.

2. The PCR primer pair according to claim 1, wherein Said n is an integer of 4-6.

3. The PCR primer pair according to claim 2, wherein The n is 6.

4. A method for amplifying a DNA molecule, characterized in that: The method includes designing different primer pairs for DNA molecules, and using different primer pairs to perform PCR amplification on the DNA molecules in different amplification systems; the characteristic correlation between different primer pairs is: Between two different pairs of primers, the n bases at the 5' end of the forward primer of one primer pair and the reverse primer of another primer pair have the following characteristics: the first base of the n bases is A and the nth base is dU; n is an integer from 4 to 30; and the products amplified by the primer pairs are connected by removing the dU bases in the amplified products to generate sticky ends. The forward primer of the first primer pair and the reverse primer of the last primer pair do not have the characteristic association: the products amplified by the primer pairs can be connected end to end through the sticky ends, Except for the forward primer of the first primer pair and the reverse primer of the last primer pair, the forward primers or reverse primers of different primer pairs only differ in several connecting sequences at the 5' end. The first base at the 5' end of the linker sequence is A, and the last base is dU.

5. The amplification method according to claim 4, wherein Said n is an integer of 4-6.

6. The amplification method according to claim 5, wherein The n is 6.

7. The amplification method according to claim 4, wherein The method further comprises: after performing the PCR amplification, connecting amplification products obtained from different amplification systems.

8. The amplification method according to claim 7, wherein The dU bases were removed by digestion using Uracil-DNA Glycosylase and Endonuclease VIII in USER enzymes.

9. A method for increasing the amount of Pacbio amplicon sequencing data, characterized in that: The library construction method comprises the amplification method according to any one of claims 4 to 8.

10. A method for full-length transcriptome sequencing, characterized in that: The method comprises the amplification method according to any one of claims 4 to 8.

11. Use of the PCR primer pair according to claim 1 or 2 in DNA molecule amplification, improving the amount of Pacbio amplicon sequencing data or full-length transcriptome sequencing.

Images