A mutant of family b dna polymerase and its construction method and application

Abstract

The application belongs to the technical field of molecular biology, and discloses a B-family DNA polymerase mutant, a construction method and application thereof. Compared with the B-family DNA polymerase 4K8Z with an amino acid sequence as shown in SEQ ID NO: 1, the B-family DNA polymerase mutant provided by the application comprises two or more of an E134K mutation, an E154A mutation, a Y291S mutation and a K317E mutation. The B-family DNA polymerase mutant has excellent amplification performance and fidelity performance, and also has good anti-inhibition performance, and can be well applied to in-vitro DNA amplification, especially has excellent amplification effect for complex samples, and has good application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a B family DNA polymerase mutant and a construction method and application thereof. Background Art

[0002] DNA polymerase is a key component in PCR amplification technology. The most commonly used DNA polymerases include pfu DNA polymerase, Taq DNA polymerase, and B-family DNA polymerases. B-family DNA polymerases, isolated from strains living in extreme, higher-temperature environments, possess both DNA synthase and 3'-5' exonuclease activities. They exhibit excellent amplification performance, heat resistance, and fidelity.

[0003] However, existing B family DNA polymerases have poor tolerance to inhibitory components such as proteins and polysaccharides, which leads to inhibition of PCR amplification and has significant limitations. Summary of the Invention

[0004] The first purpose of the present invention is to provide a B family DNA polymerase mutant, which has excellent amplification performance and fidelity performance while also having good anti-inhibition performance. It can be well applied to in vitro DNA amplification, especially for complex samples. It also has excellent amplification effect and good application prospects.

[0005] The second object of the present invention is to provide a method for constructing the above-mentioned B family DNA polymerase mutant.

[0006] The third object of the present invention is to provide the use of the above-mentioned B family DNA polymerase mutant in in vitro DNA amplification.

[0007] Specifically, the B family DNA polymerase mutant provided by the present invention includes two or more of the E134K mutation, E154A mutation, Y291S mutation and K317E mutation compared to the B family DNA polymerase 4K8Z with the amino acid sequence as described in SEQ ID NO: 1.

[0008] Furthermore, the B family DNA polymerase mutants include E134K mutation, Y291S mutation and K317E mutation.

[0009] Furthermore, the B family DNA polymerase mutants include E154A mutation, Y291S mutation and K317E mutation.

[0010] The method for constructing the above-mentioned B family DNA polymerase mutant provided by the present invention includes: S1, taking the coding gene of the B family DNA polymerase 4K8Z and a plasmid vector for recombination treatment to obtain a recombinant plasmid; taking a mutation primer to perform site-directed mutagenesis on the recombinant plasmid to obtain the construct; S2, taking the construct and introducing it into a host cell to obtain an expression strain; S3, taking the expression strain for induction expression and purification treatment to obtain the B family DNA polymerase mutant.

[0011] Furthermore, in step S1, the nucleotide sequence of the gene encoding the B family DNA polymerase 4K8Z is shown in SEQ ID NO: 2.

[0012] Furthermore, in step S1, the plasmid vector is selected from one or more of pET-3a, pET-3b, pET-3c, pET-24a, pET-24b and pET-24c.

[0013] Furthermore, in step S1, the mutation primers include two or more of an E134K mutation primer, an E154A mutation primer, a Y291S mutation primer and a K317E mutation primer.

[0014] Furthermore, the E134K mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer as shown in SEQ ID NO: 4.

[0015] Furthermore, the Y291S mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 5 and a reverse primer as shown in SEQ ID NO: 6;

[0016] Furthermore, the K317E mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 7 and a reverse primer as shown in SEQ ID NO: 8;

[0017] Furthermore, the E154A mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 9 and a reverse primer as shown in SEQ ID NO: 10.

[0018] Furthermore, in step S2, the introduction treatment includes one or more of a calcium chloride method, an electroporation method, and a lambda phage infection method.

[0019] Furthermore, in step S3, the inducing agent for inducing expression is IPTG.

[0020] Furthermore, in step S3, the temperature for inducing expression is 25-30° C., and the time is 16-18 hours.

[0021] Furthermore, in step S3, the purification treatment includes one or more of centrifugation, Ni-NTA column chromatography and dialysis.

[0022] The present invention also provides the use of the above-mentioned B family DNA polymerase mutant in in vitro DNA amplification.

[0023] Beneficial effects:

[0024] The B family DNA polymerase provided by the present invention is based on the existing known B family DNA polymerase 4K8Z, and site-directed mutagenesis is performed on the amino acids at positions 134, 154, 291 and / or 317 in its structure to optimize the structure of the enzyme molecule and the residues in the relevant active domains, which is conducive to the conformational changes of the domains during the polymerization process and improves the resistance of the enzyme molecule to interfering substances. The resulting mutant has excellent amplification performance and fidelity performance, as well as good anti-inhibition performance, and can be well applied to PCR amplification. DETAILED DESCRIPTION

[0025] Based on a deep understanding of the relationship between the structure of B-family DNA polymerases and their catalytic activity, the inventors of the present invention, through extensive and in-depth research, have creatively discovered that introducing two or more of the E134K mutation, E154A mutation, Y291S mutation, and K317E mutation into the structure of the original B-family DNA polymerase 4K8Z can significantly improve the catalytic activity, mismatch correction ability, and stability of the enzyme molecule, thereby obtaining a B-family DNA polymerase mutant with excellent amplification performance, fidelity performance, and anti-inhibition performance. The amino acid sequence of the B-family DNA polymerase 4K8Z is shown in SEQ ID NO: 1.

[0026] In the present invention, the E134K mutation, E154A mutation, Y291S mutation and K317E mutation are encoded by referring to the amino acid sequence shown in SEQ ID NO: 1. Among them, the E134K mutation is defined as a mutation of the amino acid residue at position 134 on the B family DNA polymerase 4K8Z from glutamic acid (E) to lysine (K). The E154A mutation is defined as a mutation of the amino acid residue at position 154 on the B family DNA polymerase 4K8Z from glutamic acid (E) to alanine (A). The Y291S mutation is defined as a mutation of the amino acid residue at position 291 on the B family DNA polymerase 4K8Z from tyrosine (Y) to serine (S). The K317E mutation is defined as a mutation of the amino acid residue at position 317 on the B family DNA polymerase 4K8Z from lysine (K) to glutamic acid (E).

[0027] In some specific embodiments, compared to the original B family DNA polymerase 4K8Z, the B family DNA polymerase mutant preferably includes E134K mutation, Y291S mutation and K317E mutation; in this case, the amino acid sequence of the B family DNA polymerase mutant is shown in SEQ ID NO:11.

[0028] In some specific embodiments, compared to the original B family DNA polymerase 4K8Z, the B family DNA polymerase mutant preferably includes E154A mutation, Y291S mutation and K317E mutation; in this case, the amino acid sequence of the B family DNA polymerase mutant is shown in SEQ ID NO:12.

[0029] In some specific embodiments, compared to the original B family DNA polymerase 4K8Z, the B family DNA polymerase mutant preferably includes a Y291S mutation and a K317E mutation; in this case, the amino acid sequence of the B family DNA polymerase mutant is shown in SEQ ID NO: 13.

[0030] In some specific embodiments, compared to the original B family DNA polymerase 4K8Z, the B family DNA polymerase mutant preferably includes E154A mutation and K317E mutation; in this case, the amino acid sequence of the B family DNA polymerase mutant is shown in SEQ ID NO:14.

[0031] To obtain the aforementioned B-family DNA polymerase mutant, the present invention also provides a method for constructing a B-family DNA polymerase mutant. The method specifically comprises: S1, recombining the gene encoding the B-family DNA polymerase 4K8Z with a plasmid vector to obtain a recombinant plasmid; performing site-directed mutagenesis on the recombinant plasmid using a mutagenesis primer to obtain the construct; S2, introducing the construct into a host cell to obtain an expression strain; and S3, inducing expression and purifying the expression strain to obtain the B-family DNA polymerase mutant.

[0032] In the present invention, in step S1, the coding gene of the B family DNA polymerase 4K8Z can be deduced based on its amino acid sequence, and the deduction method is a technical means conventionally used in the biological field, and the present invention does not impose any particular limitation thereto.

[0033] In some specific embodiments, the gene encoding the B family DNA polymerase 4K8Z is preferably codon-optimized for Escherichia coli, and its specific nucleotide sequence is shown in SEQ ID NO: 2.

[0034] In some specific embodiments, specific examples of the plasmid vector include but are not limited to: one or more of pET-3a, pET-3b, pET-3c, pET-24a, pET-24b and pET-24c.

[0035] In the present invention, in step S1, the recombination treatment refers to a technique of obtaining a recombinant plasmid by appropriately cutting and modifying the target gene and plasmid vector respectively by using restriction endonucleases, DNA ligases and other modifying enzymes, and then connecting the two together. This technique is a conventionally used technical means in the biological field and is not particularly limited in the present invention.

[0036] In the present invention, in step S1, the mutation primer refers to an oligonucleotide fragment containing a predetermined mutation site and capable of specifically recognizing and binding to the coding gene of B family DNA polymerase 4K8Z, specifically including two or more of E134K mutation primer, E154A mutation primer, Y291S mutation primer and K317E mutation primer.

[0037] In the present invention, in step S1, the E134K mutation primer refers to a nucleotide fragment that can direct the mutation of the codon encoding the 134th amino acid residue in the gene encoding B family DNA polymerase 4K8Z to a codon encoding lysine (K).

[0038] In some specific embodiments, the E134K mutation primer preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 4.

[0039] In the present invention, in step S1, the Y291S mutation primer refers to a nucleotide fragment that can direct the mutation of the codon encoding the 291st amino acid residue in the gene encoding B family DNA polymerase 4K8Z to the codon encoding serine (S).

[0040] In some specific embodiments, the Y291S mutation primer preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 6.

[0041] In the present invention, in step S1, the K317E mutation primer refers to a nucleotide fragment that can direct the mutation of the codon encoding the 317th amino acid residue in the gene encoding B family DNA polymerase 4K8Z to the codon encoding glutamic acid (E).

[0042] In some specific embodiments, the K317E mutation primer preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 7 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 8.

[0043] In the present invention, in step S1, the E154A mutation primer refers to a nucleotide fragment that can direct the mutation of the codon encoding the 154th amino acid residue in the gene encoding B family DNA polymerase 4K8Z to the codon encoding alanine (A).

[0044] In some specific embodiments, the E154A mutation primer preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 9 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 10.

[0045] In the present invention, in step S1, the site-directed mutagenesis refers to the use of mutant primers to perform PCR amplification on the coding gene of B family DNA polymerase 4K8Z to introduce corresponding mutations into the PCR amplification product and obtain a large number of mutated nucleotide fragments. This is a technical means commonly used in the biological field and is not particularly limited in the present invention.

[0046] In the present invention, in step S2, the host cell refers to a type of cell having a protein expression system for synthesizing the B family DNA polymerase mutant, which is a technical means commonly used in the biological field and is not particularly limited in the present invention.

[0047] In the present invention, in step S2, the introduction treatment refers to a technique of introducing the obtained construct into the host cell by means of transformation, transfection or infection, so as to ultimately achieve amplification and expression of the construct in the host cell. This is a technical means conventionally used in the biological field and is not particularly limited in the present invention.

[0048] In some specific embodiments, specific examples of the introduction treatment include but are not limited to: one or more of a calcium chloride method, an electroporation method, and a lambda phage infection method.

[0049] In the present invention, the induced expression refers to a technology that uses additionally added inducers to regulate gene expression in host cells, so that the host cells can express a large amount of B family DNA polymerase mutants. It is a technical means commonly used in the biological field and is not particularly limited in the present invention.

[0050] In some specific embodiments, specific examples of the expression inducing agent used in the inducing expression include but are not limited to: IPTG.

[0051] In some specific embodiments, the conditions for inducing expression include a temperature preferably of 25 to 30°C, such as 25°C, 26°C, 27°C, 28°C, 30°C or any value therebetween; and a time preferably of 16 to 18h, such as 16h, 16.3h, 16.5h, 17h, 17.2h, 18h or any value therebetween.

[0052] In the present invention, in step S3, the purification treatment refers to a technology that can separate the B family DNA polymerase mutant from the cell culture medium and remove other impurities to obtain a high-purity B family DNA polymerase mutant. It is a technical means commonly used in the biological field and the present invention does not impose any special limitation on it.

[0053] In some specific embodiments, specific examples of the purification treatment include but are not limited to: one or more of centrifugation, Ni-NTA column chromatography, and dialysis.

[0054] Based on the good amplification performance, fidelity performance and inhibition resistance of the above-mentioned B family DNA polymerase mutants, the present invention also provides the use of the above-mentioned B family DNA polymerase mutants in DNA amplification in vitro.

[0055] The embodiments of the present invention are described in detail below. The examples of the embodiments are intended to explain the present invention and are not to be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this area or according to the product specifications. Reagents or instruments used that do not specify the manufacturer are all conventional products that can be obtained commercially.

[0056] The reagents and their sources involved in the following examples include:

[0057] LB liquid medium (Solarbio, product number L1010).

[0058] LB plate (Solebo, product number L1015).

[0059] Plasmid extraction kit (Merck, catalog number PLN350).

[0060] PCR universal premix (Thermo Fisher Scientific, catalog number A44647100).

[0061] Ni-NTA affinity chromatography column (Shanghai Biotechnology Co., Ltd., catalog number C597593).

[0062] PCR buffer (Shanghai Chuangsai Technology, catalog number PM11657).

[0063] DNA Ladder (Thermo Fisher Scientific, catalog number SM0331).

[0064] The enzyme-catalyzed reaction system includes: 1 ng of salmon sperm DNA, 200 μmol / L dNTPs, 1 μCi [α-32P] dCTP, 20 mmol / L Tris-HCl, 2 mmol / L MgCl2, 5 mmol / L (NH4)2SO4, 10 mmol / L KCl, 0.1 g / L BSA and 0.05% Triton X-100, pH = 8.0.

[0065] 2×SSC buffer includes 300 mmol / L NaCl and 30 mmol / L Na 3 C 6 H 5 O 7 , pH = 7.0.

[0066] Example 1

[0067] This example illustrates a B-family DNA polymerase mutant. The B-family DNA polymerase mutant is based on the B-family DNA polymerase 4K8Z, whose amino acid sequence is shown in SEQ ID NO: 1. The mutant is prepared by site-directed mutagenesis of the gene encoding the B-family DNA polymerase 4K8Z (nucleotide sequence shown in SEQ ID NO: 2) using an E134K mutation primer, a Y291S mutation primer, and a K317E mutation primer, and is prepared using genetic engineering techniques. The construction of the mutant specifically includes the following steps:

[0068] 1. Construction of constructs: (1) NdeⅠ and XhoⅠ restriction sites were added to both ends of the gene encoding B family DNA polymerase 4K8Z, respectively, and then synthesized. The recombinant plasmid was then digested with NdeⅠ and XhoⅠ enzymes and recombined into the vector pET24a(+) to obtain a recombinant plasmid.

[0069] The recombinant plasmid was transformed into Tran5ɑ competent cells and placed in LB liquid culture medium. The cells were shaken and cultured overnight at 37°C and 200 rpm. The plasmid was extracted from the culture medium using a plasmid extraction kit according to the instructions to obtain a large amount of recombinant plasmid.

[0070] (2) The recombinant plasmid was subjected to PCR mutation amplification using E134K mutation primer, Y291S mutation primer, and K317E mutation primer to obtain mutation amplification products. The mutation amplification products were digested with DpnⅠ at 37°C for 1 h to remove the template and obtain the construct.

[0071] The specific mutation primers used are shown in Table 1. The PCR system consisted of 25 μL of universal PCR premix, 1 μL of a 10 μM forward primer, 1 μL of a 10 μM reverse primer, and 1 μL of a 50 ng / μL recombinant plasmid, made up to 50 μL with ddH₂O. The PCR procedure included: pre-denaturation at 95°C for 3 min, 30 amplification cycles (denaturation at 95°C for 10 s, annealing at 55°C for 520 s, and extension at 72°C for 90 s), followed by extension at 72°C for 10 min.

[0072] Table 1.

[0073]

[0074] 2. Construction of expression strains: (1) The constructs were transformed into Tran5ɑ competent cells, spread onto LB plates containing 50 μg / mL kana resistance, and cultured overnight at 37°C. Part of the cells from each single clone were taken for PCR identification and sequencing to screen for single clones containing the construct.

[0075] (2) A large number of constructs were extracted from the single clones, and the constructs were transformed into Escherichia coli BL21 (DE3) competent cells. The transformed cells were inoculated into LB liquid culture medium containing 50 mg / L kanamycin sulfate and cultured overnight at 37°C and 200 rpm to obtain expression strains.

[0076] 3. Expression and purification of B family DNA polymerase mutants: (1) Inoculate the expression strain into fresh LB liquid medium containing 50 mg / L kanamycin sulfate at a 1% inoculum volume, and culture at 37°C and 200 rpm with shaking until the OD 600 =0.8, then IPTG was added at a final concentration of 0.1 mmol / mL, and cultured at 30°C and 200 rpm for 16 h to obtain an induced expression culture medium.

[0077] (2) The induced expression culture medium was centrifuged at 4°C and 10,000 rpm for 10 min to collect the cell paste; the cell paste was resuspended in 15 mL of 50 mM Tris-HCl buffer (pH = 7.5), and the cells were ultrasonically disrupted in an ice bath for 10 min with a working period of 4 s and a rest period of 4 s. The supernatant was centrifuged at 4°C and 10,000 rpm for 10 min, and the supernatant was purified using a Ni-NTA affinity chromatography column to obtain a B family DNA polymerase mutant.

[0078] The amino acid sequence of the B family DNA polymerase mutant provided in this example is shown in SEQ ID NO: 11.

[0079] Example 2

[0080] The B family DNA polymerase mutant provided in this example has E154A mutation, Y291S mutation and K317E mutation compared to B family DNA polymerase 4K8Z, and its amino acid sequence is specifically shown in SEQ ID NO: 12.

[0081] In this example, the method provided in Example 1 was used to construct a B family DNA polymerase mutant. The difference was that the mutant primer system used in "Step 1, Construction of Construct" was different, specifically including an E154A mutant primer, a Y291S mutant primer, and a K317E mutant primer, as shown in Tables 1 and 2. Other conditions were the same to obtain the B family DNA polymerase mutant.

[0082] Table 2.

[0083]

[0084] Example 3

[0085] The B family DNA polymerase mutant provided in this example has a Y291S mutation and a K317E mutation compared to the B family DNA polymerase 4K8Z, and its amino acid sequence is specifically shown in SEQ ID NO: 13.

[0086] In this example, the method provided in Example 1 was used to construct a B family DNA polymerase mutant. The difference was that the mutant primer system used in "Step 1, Construction of Construct" was different, specifically including an E154A mutant primer, a Y291S mutant primer, and a K317E mutant primer, as shown in Tables 1 and 2. Other conditions were the same to obtain the B family DNA polymerase mutant.

[0087] Example 4

[0088] The B family DNA polymerase mutant provided in this example has E154A mutation and K317E mutation compared to the B family DNA polymerase 4K8Z, and its amino acid sequence is specifically shown in SEQ ID NO: 14.

[0089] In this example, the method provided in Example 1 was used to construct a B family DNA polymerase mutant. The difference was that the mutant primer system used in "Step 1, Construction of Construct" was different, specifically including an E154A mutant primer and a K317E mutant primer, as shown in Tables 1 and 2. Other conditions were the same to obtain the B family DNA polymerase mutant.

[0090] Example 5

[0091] This example is used to illustrate the enzymatic activity of the B-family DNA polymerase mutants provided in Examples 1 to 4, using the original B-family DNA polymerase 4K8Z as a control. The test specifically includes:

[0092] (1) Separately, a B family DNA polymerase mutant and a B family DNA polymerase 4K8Z were mixed with nuclease-free water to prepare an enzyme solution with a concentration of 0.05 μg / μL.

[0093] (2) Using salmon sperm DNA as a template / primer, 1 μL of enzyme solution was added to 10 mL of enzyme-catalyzed reaction system, and the enzyme-catalyzed reaction was carried out at 74°C for 30 minutes. After the reaction was completed, the reaction was immediately terminated on ice to obtain the reaction product.

[0094] (3) 5 μL of the reaction product was added to an ion exchange paper disc. After the spot dried, it was rinsed three times with 2× SSC buffer and finally washed once with anhydrous ethanol after an ice bath and allowed to dry. The incorporated radioactive material was measured using a liquid scintillation counter. One unit of enzyme activity was defined as the amount of enzyme that catalyzes the incorporation of 10 nmol of dNTPs into DNA. The results are shown in Table 1.

[0095] Table 3.

[0096] Group Enzyme activity (U / μL) Example 1 18.94 Example 2 19.01 Example 3 16.75 Example 4 13.96 B family DNA polymerase 4K8Z 12.03

[0097] The test results shown in Table 1 show that, compared with the currently known B family DNA polymerase 4K8Z, the enzyme activity of the B family DNA polymerase mutant provided in the present invention is 13.96-19.01 U / μL, and the enzyme catalytic activity is significantly improved.

[0098] Example 6

[0099] This example is used to illustrate the amplification performance of the B-family DNA polymerase mutants provided in Examples 1 to 4, and the original B-family DNA polymerase 4K8Z is used as a control. The test specifically includes:

[0100] (1) Separately, a B family DNA polymerase mutant and a B family DNA polymerase 4K8Z were mixed with nuclease-free water to prepare an enzyme solution with a concentration of 0.05 μg / μL.

[0101] (2) Human genomic DNA was used as a template and PCR amplification was performed using the primer system shown in Table 4 to obtain PCR amplification products of 1 kb, 2 kb, 4 kb, 8 kb, and 16 kb in length. The PCR reaction system included: 2.5 μL human genomic DNA (4 mg / L), 0.5 μL dNTPs (10 mmol / L), 2.5 μL PCR amplification buffer, 2.5 μL BSA (1 mg / L), 0.5 μL each of upstream and downstream primers (10 nmol / L), 1 μL enzyme solution, and ddH2O was added to 25 μL. The PCR reaction procedure included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s; annealing at 58°C for 15 s; extension at 72°C for 2 min; 30 cycles; and extension at 72°C for 5 min.

[0102] Table 4.

[0103] name sequence Amplification length Universal forward primer ATGTGTGTAACACTAACATAGCTTA - Primer 1kb-R AATAATGTAGATCAGGCATGGTGTC 1kb Primer 2kb-R TCCGTGGCCTGTTAGGAACCAGGCT 2kb Primer 4kb-R AGAGAAGTTTGGCAGAGGAAATTGT 4kb Primer 8kb-R CTGCACCCCAGCCTGGTGAAAAAGC 8kb

[0104] (3) 0.5 μL of PCR amplification product and DNA Ladder were each subjected to gel electrophoresis. The grayscale of the gel electrophoresis bands was analyzed using Image J and normalized to the total intensity of the DNA Ladder bands to obtain the normalized intensity of each band. The results are shown in Table 5.

[0105] Table 5.

[0106]

[0107] It can be seen from the test results shown in Table 5 that compared with the currently known B family DNA polymerase 4K8Z, the B family DNA polymerase mutant provided in the embodiments of the present invention has better amplification performance.

[0108] Example 7

[0109] This example is used to illustrate the fidelity performance of the B-family DNA polymerase mutants provided in Examples 1 to 4, and the original B-family DNA polymerase 4K8Z is used as a control. The test specifically includes:

[0110] (1) Separately, a B family DNA polymerase mutant and a B family DNA polymerase 4K8Z were mixed with nuclease-free water to prepare an enzyme solution with a concentration of 0.05 μg / μL.

[0111] (2) Using plasmid pUC19 as a template, PCR amplification was performed using the primer system shown in Table 6 to obtain PCR amplification products. The PCR reaction system included: 2.5 μL of plasmid pUC19 (4 mg / L), 0.5 μL of dNTPs (10 mmol / L), 2.5 μL of PCR amplification buffer, 2.5 μL of BSA (1 mg / L), 0.5 μL of each upstream and downstream primer (10 nmol / L), 1 μL of enzyme solution, and ddH2O was added to 25 μL. The PCR reaction procedure included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s; annealing at 58°C for 15 s; extension at 72°C for 2 min; 30 cycles; and extension at 72°C for 5 min.

[0112] Table 6.

[0113] name sequence Primer pUC19F CCAGGCTTTACACTTTATGC Primer pUC19R TGGCTTAACTATGCGGCATC

[0114] (3) The PCR amplified product was transformed into Escherichia coli DH5α competent cells and spread onto a solid LB plate containing 100 mg / mL ampicillin. The plate was cultured overnight at 37°C to obtain single colonies. The number of blue colonies and white colonies on the plate culture medium was recorded, where blue colonies were normal and white colonies were mutants. The mismatch rate was calculated and the results are shown in Table 7.

[0115] Table 7.

[0116] Group <![CDATA[Error rate (×10 -6 )]]> Example 1 7.38 Example 2 8.10 Example 3 6.52 Example 4 4.37 B family DNA polymerase 4K8Z 12.5

[0117] The test results shown in Table 7 indicate that, compared to the currently known B-family DNA polymerase 4K8Z, the B-family DNA polymerase mutants provided in the embodiments of the present invention have excellent fidelity performance.

[0118] Example 8

[0119] This example is used to illustrate the inhibitory performance of the B-family DNA polymerase mutants provided in Examples 1 to 4, and the original B-family DNA polymerase 4K8Z is used as a control. The test specifically includes:

[0120] (1) Separately, a B family DNA polymerase mutant and a B family DNA polymerase 4K8Z were mixed with nuclease-free water to prepare an enzyme solution with a concentration of 0.05 μg / μL.

[0121] (2) 1 mL of the collected sputum was mixed with 0.1 mL of sodium hydroxide solution (0.1 M), liquefied for 30 min, and 10 mL of Tris-HCl buffer (1 mM, pH = 7.5) was added and mixed evenly to obtain an interference solution; human genomic DNA was added at a final concentration of 4 mg / L and mixed with the interference solution to obtain a DNA sample to be tested.

[0122] (3) PCR amplification of the DNA sample to be tested was performed using the enzyme solution and the primer system shown in Table 4 to obtain a PCR amplification product with a length of 1 kb. The PCR reaction system includes: 2.5 μL of the DNA sample to be tested, 0.5 μL of dNTPs (10 mmol / L), 2.5 μL of PCR amplification buffer, 2.5 μL of BSA (1 mg / L), 0.5 μL of each upstream and downstream primer (10 nmol / L), 1 μL of enzyme solution, and ddH2O was added to 25 μL. The PCR reaction procedure includes: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s; annealing at 58°C for 15 s; extension at 72°C for 2 min; 30 cycles; and extension at 72°C for 5 min.

[0123] (4) 0.5 μL of the PCR amplification product and DNA Ladder were each subjected to gel electrophoresis. The grayscale of the gel electrophoresis bands was analyzed using Image J and normalized to the total intensity of the DNA Ladder bands to obtain the normalized intensity of each band. The results are shown in Table 8.

[0124] Table 8.

[0125] Group Normalized band intensity Example 1 1.02 Example 2 0.67 Example 3 0.71 Example 4 0.59 B family DNA polymerase 4K8Z 0.13

[0126] From the test results shown in Table 8, it can be seen that compared with the currently known B family DNA polymerase 4K8Z, the B family DNA polymerase mutants provided in the embodiments of the present invention have good anti-inhibition performance.

[0127] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and purpose of the present invention.

[0128] The amino acid sequences and nucleotide sequences involved in the present invention are specifically shown in Table 9.

[0129] Table 9.

[0130]

[0131]

[0132]

[0133]

Claims

1. A B family DNA polymerase mutant, characterized in that The amino acid sequence of the B family DNA polymerase mutant is shown in any one of SEQ ID NOs: 11 to 14.

2. The method for constructing a B family DNA polymerase mutant according to claim 1, characterized in that: The construction method includes: S1, taking the coding gene of B family DNA polymerase 4K8Z and a plasmid vector for recombination treatment to obtain a recombinant plasmid; taking a mutation primer to perform site-directed mutagenesis on the recombinant plasmid to obtain a construct; S2, taking the construct and introducing it into a host cell to obtain an expression strain; S3, taking the expression strain for induction expression and purification treatment to obtain the B family DNA polymerase mutant.

3. The method for constructing a B family DNA polymerase mutant according to claim 2, characterized in that: In step S1, the plasmid vector is selected from one or more of pET-3a, pET-3b, pET-3c, pET-24a, pET-24b and pET-24c.

4. The method for constructing a B family DNA polymerase mutant according to claim 2, characterized in that: In step S2, the introduction treatment includes one or more of a calcium chloride method, an electroporation method, and a lambda phage infection method.

5. The method for constructing a B family DNA polymerase mutant according to claim 2, characterized in that: In step S3, the inducing agent for inducing expression is IPTG.

6. The method for constructing a B family DNA polymerase mutant according to claim 2, characterized in that: The induction temperature is 25-30°C and the time is 16-18 hours.

7. The method for constructing a B family DNA polymerase mutant according to claim 2, characterized in that: In step S3, the purification treatment includes one or more of centrifugation, Ni-NTA column chromatography and dialysis.

8. Use of the B family DNA polymerase mutant according to claim 1 in in vitro DNA amplification for purposes other than disease treatment and diagnosis.

Images