Universal cells expressing lgals9 and methods of making the same
By knocking out the B2M and CIITA genes and overexpressing LGALS9 in human pluripotent stem cells, and combining them with other immunosuppressive molecules, the immunocompatibility problem in the construction of low-immunogenic cells in existing technologies has been solved. This allows for the escape of T cells and NK cells, maintains the function of stem cells, and is suitable for a wide range of cell therapy applications.
Patent Information
- Application Number
- CN202310846838.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-07-11
- Filing Date
- 2023-07-11
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2043-07-11
AI Technical Summary
Existing technologies for constructing universal pluripotent stem cells with low immunogenicity suffer from problems such as incomplete, unclear, or lacking persistence of immunocompatibility and a narrow effective dose window. Furthermore, the potential molecular mechanisms of maternal-fetal immune tolerance and tumor escape are not fully understood, leading to strong immune rejection in allogeneic cell therapy.
By knocking out the B2M and CIITA genes in human pluripotent stem cells and combining them with overexpression of the LGALS9 gene, B2M/CIITA biallelic knockout positive clones were constructed. This reduced or eliminated the expression of MHC-I and MHC-II, and introduced other immunosuppressive molecules such as CD47, enabling the escape of T cells and NK cells.
The obtained low-immunogenic pluripotent stem cells can effectively evade attacks from T cells and NK cells, maintain stemness and differentiation capacity, and provide broader potential for cell therapy applications.
Smart Images

Figure CN117384852B_ABST
Abstract
Description
[0001] Cross Reference to Related Applications
[0002] This application claims priority to and the benefit of Chinese Patent Application No. 202210815169.7, filed July 11, 2022, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD
[0003] The present application belongs to the field of genetic engineering and stem cell technology, and specifically relates to a universal cell expressing LGALS9 and a preparation method thereof. BACKGROUND
[0004] Through in vitro culture of cells or induced differentiation of stem cells, a large number of healthy functional cells can be regenerated in vitro, and diseases can be treated by allogeneic functional cell transplantation. However, immune incompatibility and immune rejection of transplanted cells are still key obstacles to its clinical application. Stem cells are a class of "seed" cells with self-renewal ability and differentiation ability to specific functional cells. According to the degree of stem cell characteristics, stem cells are mainly divided into totipotent stem cells, pluripotent stem cells (PSCs), and adult stem cells. Human embryonic stem cells (hESC) and induced pluripotent stem cells (iPSC) have the potential for unlimited proliferation, self-renewal, and differentiation into various types of cells, and have important application prospects in the treatment of cancer, neurological, cardiovascular, and other diseases.
[0005] Autologous cell transplantation can avoid immune rejection problems, but the cost of manufacturing autologous cells from patients is high and the preparation process is long (Khera et al., 2013), and the quality and effectiveness of individual-derived cell products are uncertain. There is data to suggest that the cells in the patient's body differ from those in normal people, and the therapeutic effect can be affected.
[0006] Immunogenicity can be reduced by immunosuppressive drugs, HLA matching, and gene editing, or to reduce the rejection of allogeneic transplanted cells by the host immune system. Immunosuppressive drugs have significant side effects, causing myelosuppression, hepatotoxicity, alopecia, and gastrointestinal adverse reactions. Now the United States, Japan, and China are building HLA-matched iPSC banks, but the cost of building and maintaining the bank is high because the HLA antigen gene is the most polymorphic gene observed in the human genome. The iPSC banks in various places cannot provide matching for the majority of people in their respective countries, and can only cover specific populations (Solomon et al., 2015; Turner et al., 2013). Allogeneic cell therapy for a large patient population can have a very obvious advantage over matching banks in terms of economy and construction and operation costs, but allogeneic cell therapy will be subject to strong immune rejection. Therefore, it is urgent to construct universal PSCs that are immunocompatible with allogeneic cells.
[0007] The major histocompatibility complex (MHC) of humans, i.e., human leukocyte antigen (HLA), is the main cause of immune incompatibility. The HLA complex is composed of a series of genes, which can be divided into class I, class II, and class III. MHC-I genes are expressed in almost all tissue cell types, and transplanted cells expressing “non-self” MHC class I molecules will stimulate the activation of CD8+ T cells and be eliminated. CD4+ helper T cells recognize the MHC-II genes of “non-self” cells, thereby causing immune rejection, and III class molecules are not involved in immune activity. Using gene editing methods to change immunogenic elements to produce low immunogenic cells makes it possible to mass-produce “off-the-shelf” cell therapy products with immune privilege.
[0008] In recent years, there have been pioneer reports that by knocking out B2M, CIITA, etc., MHC-I and MHC-II cell surface or itself gene expression is deleted, thereby making cells immune tolerant or escaping T / B cell-specific immune response, and producing immunocompatible universal PSCs, which lays an important foundation for more extensive universal PSCs source cells, tissues, and organs. However, HLA molecules are the main inhibitory ligands of natural killer cells (NK cells), and MHC-I class negative cells are susceptible to natural killer (NK) cell lysis. In vivo and in vitro data show that host NK cells can eliminate implanted B2M - / - Donor cells (Flahou et al., 2021). Therefore, it is necessary to improve previous methods to produce universal donor cells that can avoid immune response.
[0009] The human immune system can recognize and attack non-self antigens, thereby resisting infection. Therefore, in the process of allogeneic organ transplantation, the immune system will attack the transplanted organ, leading to immune rejection and transplantation failure. Although the embryo and placenta are semi-allogeneic transplants, similar to transplanted organs, they can induce maternal tolerance and do not produce a strong immune response. The high expression of HLA-G in the placenta regulates maternal-fetal tolerance by interacting with decidual natural killer cells, while high expression of CD47 is also detected in the placenta (Liu et al., 2021; Than et al., 2019). On the other hand, it is well known that tumor cells can escape immune surveillance by reducing the expression of HLA, reducing antigen presentation, thereby preventing them from being recognized by immune cells; and increasing the expression of immunosuppressive components such as HLA-G, PD-L1, and CTLA-4, etc. (Barnet et al., 2018; Bogomiakova et al., 2019; de Charette and Houot, 2018).
[0010] Some studies have explored the relationship between maternal-fetal immune tolerance, tumor immune escape, and organ transplantation (Sun et al., 2021). It has been reported that simulating the mechanisms of maternal-fetal tolerance and tumor escape, such as expressing HLAG and other non-classical HLA-I class molecules based on the destruction of MHC-I and MHC-II class gene expression, or expressing PD-L1, CTLA4-Ig, CD47, CD24, and other immunosuppressive checkpoint proteins, exhibit certain immune tolerance protection to NK cells (Zhao, W. et al., 2020; Ye, Q. et al., 2020).
[0011] However, these schemes exist only based on the direct application of field-known star molecules, and immune escape and tolerance are mostly dependent on immunosuppressive receptor-ligand binding, and have specific microenvironments in tumor states or maternal-fetal interfaces. There are uncertainties in the cross-field direct application of low immune factors to allogeneic transplantation, such as whether the paired receptor or ligand exists on the transplanted cells and immune cells, and whether the transplanted environment meets the escape conditions? The state in the pregnant maternal-fetal interface may be different from that at the time of organ transplantation, therefore, the prior art has technical problems such as incomplete, unclear, or lack of durability of immune compatibility, narrow effective dose window, etc. And so far, the potential molecular mechanisms of maternal-fetal immune tolerance and tumor escape are still being explored, and new genes are continuously discovered, which can further develop low-immunogenic cells (Barnet et al., 2018). This indicates the need to screen more new molecules to achieve more optimized modified stem cells to obtain a more optimal immune exemption scheme.
[0012] References:
[0013] De Charette, M., and Houot, R. (2018). Hide or defend, the two strategies of lymphoma immune evasion: potential implications for immunotherapy. Haematologica 103, 1256-1268.
[0014] Liu, Y., Gao, S., Zhao, Y., Wang, H., Pan, Q., and Shao, Q. (2021). Decidual Natural Killer Cells: A Good Nanny at the Maternal-Fetal Interface During Early Pregnancy. Front Immunol 12, 663660.
[0015] Than, N.G., Hahn, S., Rossi, S.W., and Szekeres-Bartho, J. (2019). Editorial: Fetal-Maternal Immune Interactions in Pregnancy. Front Immunol 10, 2729.
[0016] Zhao, W., Lei, A., Tian, L., Wang, X., Correia, C., Weiskittel, T., Li, H., Trounson, A., Fu, Q., Yao, K., et al. (2020). Strategies for Genetically Engineering Hypoimmunogenic Universal Pluripotent Stem Cells. iScience 23, 101162. SUMMARY
[0017] In view of the deficiencies of the prior art, the present application provides a new method for obtaining low immunogenicity by modifying cells, which first adopts the strategy of screening a large number of molecules related to maternal-fetal tolerance and tumor escape, and finally identifies the representative new gene LGALS9 through multiple rounds of functional detection. The gene can significantly reduce or escape the recognition and attack of the immune system, especially the attack of natural killer cells, macrophages and the like. The present application proposes a feasible strategy for realizing the immune exemption of cells by transforming new genes in an unpredictable field.
[0018] The present application successfully constructs a B2M / CIITA double-allele knockout positive clone DKO cell by knocking out the beta-2-microglobulin (B2M) in the endoplasmic reticulum of human pluripotent stem cells and knocking out the positive regulator CIITA of MHC-II gene transcription; then overexpressing the new gene LGALS9 identified by the present application in the DKO cell using a lentiviral vector, so that the human pluripotent stem cell obtained can further escape the killing of NK cells on the basis of escaping T cell attack. At the same time, these low immunogenic pluripotent stem cells retain the key biological functions of pluripotent stem cells such as stemness and differentiation ability.
[0019] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0020] In a first aspect, the present application provides a universal cell, which comprises, relative to a wild-type cell:
[0021] 1) reduced or no expression of MHC-I and / or MHC-II human leukocyte antigens;
[0022] 2) an expression sequence of LGALS9;
[0023] The cell can escape T cell attack and killing by NK cells.
[0024] In some aspects, the cell comprises reduced or no expression of MHC-I and MHC-II human leukocyte antigens.
[0025] In some aspects, the cell further comprises a modification to increase expression of one or more polypeptides selected from the group consisting of: DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8, and SerpinB9.
[0026] In some aspects, the reduced or no expression of MHC-I and MHC-II genes is achieved by targeting one or more genes encoding one or more transcriptional regulators of MHC-I and one or more genes encoding one or more transcriptional regulators of MHC-II in the cell using a gene editing tool such as a TALEN and / or a CRISPR system.
[0027] In some embodiments, to achieve the reduced or no expression of MHC-I and MHC-II genes, the transcriptional regulator of MHC-I can be preferably selected from one or more of: B2M, TAP1, TAP2, Tapasin, or NLRC5; and the transcriptional regulator of MHC-II can be preferably selected from one or more of: CIITA, RFXANK, RFX5, RFXAP;
[0028] The transcriptional regulator is preferably B2M and CIITA.
[0029] In certain embodiments, the cell further comprises a genetic modification targeting the CIITA gene by a rare-cutting endonuclease that selectively inactivates the CIITA gene.
[0030] In certain embodiments, the cell further comprises a genetic modification targeting the B2M gene by a rare-cutting endonuclease that selectively inactivates the B2M gene.
[0031] In certain embodiments, the rare-cutting endonuclease is selected from the group consisting of a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease and a homing nuclease.
[0032] In certain embodiments, wherein the genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide ribonucleic acid sequence for specific targeting of the CIITA gene or the B2M gene.
[0033] In specific embodiments, a CRISPR / CAS9 system is used to perform a two-end direct knockout on the B2M and CIITA exon segments, respectively, wherein the target sequence of the gRNA against the B2M gene is SEQ ID NO: 2 and SEQ ID NO: 3, and the target sequence of the gRNA against the CIITA gene is SEQ ID NO: 4 and SEQ ID NO: 5.
[0034] In certain aspects, the reduction or absence of expression of MHC-I and / or MHC-II genes in the cell is achieved by introducing a gene expression modification molecule against one or more genes encoding a transcriptional regulator of MHC-I, or one or more genes encoding a transcriptional regulator of MHC-II, wherein the gene expression modification molecule comprises one selected from the group consisting of an siRNA, an shRNA, a microRNA, an antisense RNA and another RNA-mediated inhibition molecule.
[0035] In certain aspects, the amino acid sequence of the LGALS9 has more than 70% homology to the sequence as set forth in SEQ ID NO: 1, for example more than 80% homology, for example more than 90%, more than 95%, more than 98% homology;
[0036] Further preferably, the amino acid sequence of the LGALS9 is as set forth in SEQ ID NO: 1.
[0037] In certain aspects, the cell is an embryonic stem cell.
[0038] In certain aspects, the cell is a pluripotent stem cell.
[0039] In certain embodiments, the cell is a hypoimmunogenic stem cell.
[0040] In certain embodiments, the cell is a human stem cell or a human somatic cell.
[0041] In a second aspect, the present application provides a method for preparing the universal cell of the first aspect, comprising the following steps:
[0042] 1) knocking out one or more genes of one or more transcriptional regulators of MHC-I of the cell; and / or,
[0043] 2) knocking out one or more genes of one or more transcriptional regulators of MHC-II of the cell;
[0044] 3) introducing a nucleic acid sequence encoding LGALS9 protein into the cell.
[0045] In certain aspects, the transcriptional regulator of MHC-I can be preferably selected from one or more of B2M, TAP1, TAP2, Tapasin or NLRC5; the transcriptional regulator of MHC-II can be preferably selected from one or more of CIITA, RFXANK, RFX5, RFXAP.
[0046] In certain embodiments, the transcriptional regulator is selected from B2M and CIITA.
[0047] In certain aspects, the knocking out of steps 1) and 2) is a genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease inactivating selectively the CIITA gene or the B2M gene.
[0048] Preferably, the rare-cutting endonuclease is selected from a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease and a homing nuclease.
[0049] Further preferably, wherein the genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene or the B2M gene.
[0050] In certain embodiments, steps 1) and 2) use the CRISPR system to perform two-end direct knockout on the B2M and CIITA exon segments, respectively, wherein the target sequence of the gRNA for the B2M gene is SEQ ID NO: 2, 3, and the target sequence of the gRNA for the CIITA gene is SEQ ID NO: 4, 5.
[0051] In some aspects, the knocking out of step 1) or 2) is achieved by introducing a gene expression modification molecule for one or more genes encoding one or more transcriptional regulators of MHC-I, or one or more genes encoding one or more transcriptional regulators of MHC-II, wherein the gene expression modification molecule comprises one selected from the group consisting of siRNA, shRNA, microRNA, antisense RNA and another RNA-mediated inhibitory molecule, to reduce or not express the MHC-I and / or MHC-II genes.
[0052] In some aspects, step 3) employs an expression vector to introduce the nucleic acid sequence encoding the LGALS9 protein into the cell.
[0053] Preferably, the expression vector employed in step 3) is a viral vector.
[0054] In some embodiments, the viral vector employed in step 3) is a lentivirus.
[0055] In some aspects, step 3) introduces the nucleic acid sequence encoding the LGALS9 protein into a selected site of the cell; preferably, the selected site of the cell is a safe harbor gene site.
[0056] In some aspects, the amino acid sequence of the LGALS9 has more than 70% homology to the sequence as set forth in SEQ ID NO: 1, for example, more than 80% homology, for another example, more than 90%, more than 95%, more than 98% homology;
[0057] Further preferably, the amino acid sequence of the LGALS9 is as set forth in SEQ ID NO: 1.
[0058] In some aspects, the universal cell further comprises a second expression vector comprising a polynucleotide sequence encoding one selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9.
[0059] In some embodiments, the second expression vector is an inducible expression vector; preferably, the second expression vector is a viral vector.
[0060] In a third aspect, the present application provides a method for preparing a differentiated universal cell, comprising culturing the universal cell prepared according to the method of the second aspect under differentiation conditions, thereby preparing a differentiated hypoimmunogenic cell.
[0061] In certain aspects, wherein the differentiation conditions are suitable to differentiate the cells into a cell type selected from the group consisting of cardiomyocytes, neural cells, glial cells, endothelial cells, T cells, NK cells, NKT cells, macrophages, hematopoietic progenitor cells, mesenchymal cells, islet cells, chondrocytes, retinal pigment epithelial cells, kidney cells, liver cells, thyroid cells, skin cells, blood cells, and epithelial cells.
[0062] In a fourth aspect, the present application provides a method of treating a patient in need of cell therapy, comprising administering a population of differentiated hypoimmunogenic cells prepared according to the method of the third aspect.
[0063] In a fifth aspect, the present application provides a composition comprising the universal cell of the first aspect.
[0064] In certain aspects, the composition comprises the universal cell of the first aspect and one or more therapeutic agents comprising a peptide, a cytokine, a small molecule compound, a macromolecule, an ADC, an antibody, a nanoparticle, a biosimilar, an mRNA, a traditional Chinese medicine, a protein, a vaccine, a checkpoint inhibitor, a mitogen, a growth factor, a small RNA, a double stranded RNA (dsRNA), a mononuclear blood cell, a feeder cell, a feeder cell component or a replacement factor thereof, a vector comprising one or more polynucleic acids of interest, an antibody, and the like.
[0065] In a sixth aspect, the present application provides a cell expressing LGALS9 protein, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.
[0066] In a seventh aspect, the present application provides a cell not expressing CIITA, expressing LGALS9 protein, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.
[0067] In an eighth aspect, the present application provides a cell not expressing B2M, expressing LGALS9 protein, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.
[0068] In a ninth aspect, the present application provides a cell not expressing CIITA and B2M, expressing LGALS9 protein, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.
[0069] In a tenth aspect, the present application provides a cell expressing LGALS9 protein and at least one polypeptide selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.
[0070] In an eleventh aspect, the present application provides a cell not expressing CIITA, expressing LGALS9 protein and at least one polypeptide selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.
[0071] In a twelfth aspect, the present application provides a cell not expressing B2M, expressing LGALS9 protein and at least one polypeptide selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.
[0072] In a thirteenth aspect, the present application provides a cell not expressing CIITA and B2M, expressing LGALS9 protein and at least one polypeptide selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9, and having reduced or no expression of MHC class I and / or MHC class II human leukocyte antigens.
[0073] In a fourteenth aspect, the present application provides the cell of any one of the sixth to thirteenth aspects, wherein the cell is selected from the group consisting of stem cells, differentiated cells, pluripotent stem cells, induced pluripotent stem cells, somatic stem cells, progenitor cells, somatic cells, primary T cells and chimeric antigen receptor T cells.
[0074] In a fifteenth aspect, the present application provides use of the universal cell of the first aspect or the composition of the fifth aspect in the manufacture of a product for cell therapy.
[0075] In a sixteenth aspect, the present application provides use of the universal cell of the first aspect or the composition of the fifth aspect in the manufacture of a product for organ transplantation.
[0076] In a seventeenth aspect, the present application provides use of the universal cell of the first aspect or the composition of the fifth aspect in constructing a universal PSC cell bank.
[0077] In an eighteenth aspect, the present application provides use of the universal cell of the first aspect or the composition of the fifth aspect as a gene drug carrier.
[0078] Advantages of the present application:
[0079] After inactivating the major histocompatibility complex (MHC) class I and II genes in stem cells and overexpressing LGALS9, the human pluripotent stem cells obtained by the present application can further escape the killing of NK cells on the basis of escaping T cell attack, and the multiple killing rate is less than DKO, which is similar to the average killing rate of positive control H1 WT and prior art DKO+CD47. Meanwhile, these low immunogenic pluripotent stem cells retain their stemness and differentiation ability. BRIEF DESCRIPTION OF DRAWINGS
[0080] Figure 1 . B2M gene knockout strategy and result graph in human embryonic stem cell line H1;
[0081] Figure 2 . CIITA gene knockout strategy and result graph in human embryonic stem cell line H1;
[0082] Figure 3 . Graph of detecting the expression of B2M and CIITA at RNA level in DKO cells using RT-qPCR in Example 1;
[0083] Figure 4 . Result graph of detecting B2M protein level using Western-blot in Example 1;
[0084] Figure 5 . Graph of detecting the expression of HLA-I / II in wild type H1 (WT) and DKO cells by flow cytometry after stimulation with INF-gamma in Example 1;
[0085] Among them, T cells are positive controls for detecting HLA-I / II class molecules;
[0086] Figure 6 . Karyotype graph of B2M / CIITA double allele knockout positive clone (DKO) obtained in Example 1;
[0087] Figure 7 . Graph of detecting the expression of stemness genes POU5F1 / NANOG / SOX2 at RNA and protein levels in WT and DKO cells using immunofluorescence and RT-qPCR in Example 2;
[0088] Wherein MSC is a negative control;
[0089] Figure 8 . Figure of the expression of the stemness genes SSEA-4 and Tra1-81 on the surface of WT and DKO cells detected by immunofluorescence in Example 2.
[0090] Figure 9 . Figure of the results of the verification of the immune function of DKO cells detected by RTCA in Example 2.
[0091] Figure 10 . Figure of the results of the verification of the immune function of DKO cells detected by RTCA in Example 2.
[0092] Figure 11 . Figure of the results of the verification of the immune function of DKO cells detected by RTCA in Example 2.
[0093] Figure 12 . Figure of the expression of CD47 in the DKO+CD47 cell line constructed in Example 3 detected by flow cytometry.
[0094] Figure 13 . Figure of the results of the killing of the DKO+CD47 cell line overexpressing CD47, WT and DKO cells by NK cells detected by RTCA in Example 3.
[0095] Figure 14 . Figure of the results of the killing of the cell line overexpressing the candidate protein, H1 WT (positive control) and H1 DKO cells (negative control) by NK cells detected by RTCA in Example 4.
[0096] Figure 15 . Figure of the results of the killing of the cell line overexpressing the candidate protein, H1 WT (positive control) and H1 DKO cells (negative control) by NK cells detected by RTCA in Example 4.
[0097] Figure 16 . Figure of the results of the killing of the cell line overexpressing the candidate protein, H1 WT (positive control) and H1 DKO cells (negative control) by NK cells detected by RTCA in Example 4.
[0098] Figure 17 . Figure of the results of the killing of the cell line overexpressing the candidate protein, H1 WT (positive control) and H1 DKO cells (negative control) by NK cells detected by RTCA in Example 4. DETAILED DESCRIPTION
[0099] The technical solutions of the present application will be further described in detail below in combination with specific examples. It should be understood that the following examples are only illustrative and explanatory of the present application, and should not be interpreted as limiting the scope of protection of the present application. Any technology realized based on the above description of the present application is covered within the scope of protection intended by the present application.
[0100] Unless otherwise indicated, the starting materials and reagents used in the following examples are commercially available or can be prepared by known methods. The experimental procedures in the following examples, where no specific conditions are indicated, were typically performed according to standard conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.
[0101] Unless defined otherwise, all technical and scientific terms used in this disclosure have the same meaning as is commonly understood by one of ordinary skill in the art to which this disclosure belongs.
[0102] Example 1. Construction of B2M and CIITA double knock-out cell line (DKO)
[0103] 1. Cell culture reagents:
[0104] Table 1
[0105]
[0106] 2. Methods and results:
[0107] The present application selected human pluripotent stem cell line H1 (Wicell, WA01) or H9 (Wicell, WA09), using CRISPR / CAS9 to knock out the endoplasmic reticulum β-2-microglobulin (B2M), so that the cell surface MHC-I cannot form functional molecules, thereby escaping the killing of allogeneic CD8 + T cells; escape the killing of CD4+T cells by knocking out the positive regulator CIITA of MHC-II gene transcription, and reducing the expression of MHC-II class molecules.
[0108] Among them, the CRISPR / CAS9 gene knockout strategy of B2M is as shown in Figure 1 B2M-gRNA1 and B2M-gRNA2 are used to directly knock out the two ends of the B2M exon segment, and then B2M-F1 / R1 and B2M-F2 / R2 two pairs of PCR primers are used for genome sequence knockout verification.
[0109] gRNA sequence:
[0110] B2M-gRNA1: CGTGAGTAAACCTGAATCTT
[0111] B2M-gRNA2: AGTCACATGGTTCACACGGC
[0112] Identification primer
[0113] B2M-F1 : TGGGGCCAAATCATGTAGACTC
[0114] B2M-R1 : TCAGTGGGGGTGAATTCAGTGT
[0115] B2M-F2 + B2M-R2 = 608 bp
[0116] After knockout: no band
[0117] B2M-F2 : CAGAAGTCCTTGAGAGCCTCC
[0118] B2M-R2 : TGTGCATCAGTATCTCAGCAGG
[0119] B2M-F2 + B2M-R2 = 812 bp
[0120] After knockout: 569 bp.
[0121] In addition, the CRISPR / CAS9 gene knockout strategy of CIITA is shown as follows: Figure 2 CIITA-gRNA1 and CIITA-gRNA2 are used to perform two-end direct knockout on CIITA exon segments, and then CIITA-F1 / R1 and CIITA-F2 / R2 are used to perform genome sequence knockout verification, respectively.
[0122] gRNA sequence:
[0123] CIITA-gRNA1 : GATATTGGCATAAGCCTCCC
[0124] CIITA-gRNA2 : CATCGCTGTTAAGAAGCTCC
[0125] Identification primer:
[0126] CIITA-F1 : CTGTGCCTCTACCACTTCTATG
[0127] CIITA-R1 : CCTTCCATGTCACACAACAGCC
[0128] CIITA-F1 + CIITA-R1 = 368 bp
[0129] After knockout: no band
[0130] CIITA-F2 : TGGAATCCACACTTTCCAGTTC
[0131] CIITA-R2:TGGAGTCTCCGTTCCTCCAG
[0132] CIITA-F2 + CIITA-R2 = 889bp
[0133] After knockout: 459bp
[0134] The specific steps are as follows:
[0135] 1) Human pluripotent stem cells were cultured to 80% confluence using mTeSR1 in Matrigel-coated 6-well plates as usual. After digestion with Tryple, DMEM / F12 was added for neutralization, and the cells were counted. 2 × 10⁻⁶ cells were aspirated. 6 Cells were placed in EP tubes, centrifuged, and the supernatant was discarded.
[0136] 2) Based on the 100 μL electroporation volume of the Neon transfection system, add 15 μg TrueCut TM The RNP system was composed of Cas9 Protein and 3 μg gRNA (B2M gRNA1+B2M gRNA2+CIITA gRNA1+CIITA gRNA2), mixed and incubated at room temperature for 20 min.
[0137] 3) Resuspend cells in 100 μL of RNP electroporation system and perform electroporation using the Neon transfection system at 1200 V, 30 ms, and 1 pause. After electroporation, cells are quickly added to preheated culture medium and evenly seeded into one well of a 6-well plate coated with Matrigel.
[0138] 4) Change the mTeSR1 medium daily with fresh medium. Once single cells have grown, pick a single clone and place it in a 48-well plate. After the clone has amplified, collect genomic samples for PCR detection of gene editing. The PCR results are shown below. Figure 1 and 2 As shown. PCR-positive clones were sent to the company for further Sanger sequencing verification.
[0139] 5) Identify positive B2M / CIITA biallelic knockout clones DKO, amplify, culture, and cryopreserve them.
[0140] The expression levels of B2M and CIITA at the RNA level in the B2M / CIITA biallelic knockout clone DKO were detected using qPCR. Figure 3 As shown, the removal is confirmed.
[0141] B2M-F:AAGATGAGTATGCCTGCCGT
[0142] B2M-R:ATGCGGCATCTTCAAACCTC
[0143] CIITA-F: CCTGGAGCTTCTTAACAGCGA
[0144] CIITA-R: TGTGTCGGGTTCTGAGTAGAG
[0145] B2M protein level expression of B2M / CIITA double knock-out clone DKO was detected using Western-Blot, as shown in Figure 3A, knock-out was confirmed. Figure 4
[0146] INF-gamma stimulation of WT and DKO: cells were plated, the next day when media was changed, INF-gamma containing media was added to the cells, 48h later cells were trypsinized and flow cytometry was used to detect HLA-I / II expression. Results are shown in Figure 4A, B2M / CIITA double knock-out stem cell positive clone (DKO) was unable to express HLA-I / II class molecules in response to INF-gamma stimulation. T cells were used as positive control for detection of HLA-I / II class molecules. Figure 5
[0147] Karyotype analysis of obtained B2M / CIITA double knock-out positive clone (DKO): chromosome preparation was fixed on slides, trypsinized and stained with Giemsa. Metaphase chromosomes were analyzed for chromosome number and morphology, to determine if the karyotype was consistent with the normal karyotype. Results are shown in Figure 5, DKO karyotype was normal. Figure 6
[0148] Example 2. Verification of stemness and immune function of DKO cell line in Example 1
[0149] 1. Expression of stemness genes in WT and DKO cells
[0150] Immunofluorescence detection showed that WT and DKO cells expressed stemness genes POU5F1 and NANOG at protein level: cells were plated in 12-well plates, when cells reached 60-80% confluency, media was removed and 4% paraformaldehyde was added for fixation. After cell membrane was broken, primary antibodies for POU5F1 and NANOG were used for overnight incubation at 4°C, after washing away primary antibodies, secondary antibodies with fluorescent labels were incubated at room temperature, then fluorescent microscope was used for taking pictures. Results are shown in Figure 6A. RT-qPCR detection showed that WT and DKO cells expressed stemness genes POU5F1, NANOG and SOX2 at RNA level: results are shown in Figure 6B. (MSC was used as negative control for stemness gene expression) Figure 7 Figure 7
[0151] Flow cytometry results showed that WT and DKO cells both highly expressed the stemness genes SSEA-4 and Tra1-81, with the percentage of 100%, 99.98% and 96.75%, 99.13% respectively. The results are shown in Figure 8
[0152] 2. Differentiation ability of the obtained B2M / CIITA double allele knockout positive clone (DKO)
[0153] The immunodeficient mice (SCID Beige) were subcutaneously injected with 100 μL of a suspension containing 5E+5 DKO cells. When the teratoma volume was greater than 1.5 cm 3 , it was removed and sectioned for staining.
[0154] The obtained B2M / CIITA double allele knockout positive clone (DKO) can form teratomas in vivo and differentiate into cells of the endoderm, mesoderm and ectoderm. The results are shown in Figure 9
[0155] 3. Verification of the immune function of DKO cells
[0156] The killing experiment of T cells and NK cells used xCELLigence RTCA Instrument. The same number of WT and DKO cell lines were resuspended in Essential 8 medium containing IL-2 and inoculated in 96-well E-plates coated with Matrigel, and activated T cells or NK cells were added for killing detection. The RTCA detection data were analyzed using xCELLigence software to calculate the killing rate and escape function.
[0157] Table 2
[0158] Name Cat No. Size Manufacturer PE anti-human CD4 980804 500ul / tube Biolegend APC anti-human CD8 980904 500ul / tube Biolegend FITC anti-human CD3 300440 500tests Biolegend APC anti-human CD16 301012 100tests Biolegend PE anti-human CD56(NCAM) 318306 100tests Biolegend human IL-2 202-1L-050 / CF 50ug R&D Y-27632 2HCl S1049 5mg Selleck Matrigel 354277 5ml Gibco Essential 8 TM culture medium A1517001 500ml Gibco E-Plate VIEW 96PET 300601030 6wells / box Agilent
[0159] The RTCA data as shown in Figure 10 , the WT cells escaped the killing of NK cells due to the expression of HLA-I, but were killed by T cells. The DKO cells could escape the killing of T cells, and were more sensitive to the killing of NK cells.
[0160] Example 3. Construction of DKO+CD47 cell line and verification of immune function
[0161] The DKO cells obtained in Example 1 were used to overexpress CD47 (NM_198793) using a lentiviral vector, and the amino acid sequence of CD47 is shown in SEQ ID NO. 18. The cDNA (SEQ ID NO. 19) of the overexpression sequence was constructed in a lentiviral plasmid (pGC-EF1a) with EF1a promoter and puromycin selection marker. The structure of the pGC-EF1a plasmid is shown inFigure 11 The plasmid was digested with BamHI / NheI, and after successful ligation, Sanger sequencing was used to verify the correctness of the inserted sequence and virus packaging. The DKO human pluripotent stem cells constructed in Example 2 were transfected, and the medium was changed 24 h later. After 48 h, the medium containing puromycin was changed for screening. The results of the constructed stable strain cell DKO+CD47 are shown in Figure 12 After confirming the correct expression, the cells were expanded and subjected to subsequent functional detection.
[0162] Referring to Example 2, RTCA was used to detect whether the overexpressed DKO+CD47 cell strain could successfully escape the killing of NK cells while escaping the killing of T cells, as shown in Figure 13 The NK cells can effectively kill the DKO cells, and the WT and DKO+CD47 overexpressed cells can escape the killing of NK cells.
[0163] Example 4. Screening of universal cell lines expressing molecules containing fetal-maternal tolerance and tumor immune escape molecules
[0164] Construction strategy and screening of each molecule of the present application:
[0165] A total of 22 candidate targets were screened, and their amino acid and cDNA sequences are shown in Table 3. The candidate targets are related to fetal-maternal tolerance or tumor immune escape, including:
[0166] Molecules related to fetal-maternal tolerance: HLA-E, HLA-G, CTLA4-Ig.
[0167] Inhibitory immune receptors (immune checkpoints) expressed by tumors: MICA, MICB, ULBP1, ULBP2, ULBP3, CTLA4-Ig, C1-Inhibitor, LGALS9, CD46, CD55, CD59, CD20, HER2.
[0168] Regulatory factors in the tumor microenvironment: TDO, IDO1, IDO2, IL-10, IL37, IL-12A, IL-35B.
[0169] Table 3
[0170]
[0171]
[0172] Reengineering pluripotent stem cells using natural immune suppression mechanisms to confer hypoimmunogenicity, but these types of approaches rely on immune-inhibitory receptor-ligand pairs or specific microenvironments, and whether they are present on the transplanted cells and immune cells, so introducing these genes alone can not necessarily result in complete hypoimmunogenicity, which needs to be functionally confirmed by actual detection (Zhao et al., 2020).
[0173] DKO cells obtained in Example 1 were used to overexpress 22 candidate target points screened this time, respectively, the amino acid sequences of the 22 candidate target points are shown in Table 3, and the cDNA of the overexpression sequence (NM_009587.3) was constructed in a lentiviral plasmid (pGC-EF1a) with an EF1a promoter and a puromycin screening marker. The structure of the pGC-EF1a plasmid is shown in Figure 11 The plasmid was digested with BamHI / NheI, and after successful ligation, Sanger sequencing was used to verify the correctness of the inserted sequence and perform virus packaging. The DKO human pluripotent stem cells constructed in Example 2 were transfected, the medium was changed 24 h later, and the medium containing puromycin was changed 48 h later for screening. The stable transfection of the 22 candidate target points was subjected to multiple NK in vitro killing experiments (n≥5), and the candidate new target with the optimal escape ability to NK cells was screened. The relative killing ratio was normalized to the negative control H1 DKO cells, and was summarized at high (high: E:T = 2:1) and low (low: E:T = 1:1 or 0.5:1) NK ratios (E:T). The killing ratio less than 1 indicates that there is an escape ability relative to DKO, and the lower the ratio, the stronger the escape ability. The positive control is H1 WT and H1 DKO+CD47 constructed in Example 3. The results are shown in Figure 14 DKO+LGALS9 multiple ratios, and the multiple killing rates are less than DKO, which are similar to the average killing rates of the positive control H1 WT and the prior art DKO+CD47, which are the optimal cells for escaping NK killing. The effect is even better than the common sense star molecules HLA-G, CTLA4-Ig, etc., achieving an unexpected effect.
[0174] Example 5. Construction of DKO+LGALS9 cell line and verification of immune function
[0175] 1. Construction of DKO+LGALS9 cells and overexpression detection
[0176] The nucleic acid sequence encoding LGALS9 (the amino acid sequence of LGALS9 is shown in NP_033665.1) was directly synthesized and constructed in a lentiviral plasmid (pGC-EF1a) with an EF1a promoter and a puromycin screening marker, and the structure of the pGC-EF1a plasmid is shown in Figure 11The plasmid was digested with BamHI / NheI, and after successful ligation, Sanger sequencing was used to verify the correctness of the inserted sequence and virus packaging. After transfection of the DKO human pluripotent stem cells obtained in Example 2, the medium was replaced with a medium containing puromycin for screening. The constructed DKO+LGALS9 cells were used to detect the overexpression level of mRNA by qPCR, and DKO cells were used as negative controls. The results are shown in Figure 15 .
[0177] LGALS9 F1: TCTGGGACTATTCAAGGAGGTC
[0178] LGALS9 R1: CCATCTTCAAACCGAGGGTTG
[0179] 2. Expression of stemness genes in DKO+LGALS9 cells
[0180] According to Reference Example 2, immunofluorescence detection showed that DKO+LGALS9 cells expressed stemness genes OCT4, NANOG, SOX2, TRA-1-60, and TRA-1-81 at the protein level. The results are shown in Figure 16 A. Flow cytometry results showed that DKO+LGALS9 cells highly expressed stemness genes SSEA-4, OCT4, TRA-1-60, and Tra1-81 on the cell surface, accounting for 99.20%, 98.52%, 99.69%, and 97.93%, respectively. The results are shown in Figure 16 B.
[0181] 3. Immune function detection of DKO+LGALS9 cells
[0182] After confirming the construction of DKO+LGALS9 cells and the correct expression of stemness, cell expansion and subsequent functional detection were performed. Referring to Example 2, in the NK cell killing experiment detected by RTCA, the DKO cells constructed in Example 2 were completely killed by NK cells, and H1WT and DKO+LGALS9 successfully escaped. The results are shown in Figure 17 .
[0183] The above describes embodiments of the present application. However, the present application is not limited to the above-described embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.
Claims
1. A universal cell, characterized in that, comprising: 1) reduced expression or no expression of MHC-I and MHC-II human leukocyte antigens; 2) overexpression of LGALS9 gene; the amino acid sequence of LGALS9 is shown as SEQ ID NO: 1; the cell is human embryonic stem cell line H1 or human induced pluripotent stem cell; the cell has a genetic modification targeting the transcriptional regulators encoding MHC-I and MHC-II using a gene editing tool to achieve reduced expression or no expression of MHC-I and MHC-II genes; the transcriptional regulators are B2M and CIITA.
2. The universal cell of claim 1, wherein, The cell further comprises a modification to increase expression of one or more of the following polypeptides: DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9.
3. The universal cell of claim 2, wherein, The cell further comprises a genetic modification targeting the CIITA gene by a rare-cutting endonuclease that selectively inactivates the CIITA gene, and a genetic modification targeting the B2M gene by a rare-cutting endonuclease that selectively inactivates the B2M gene.
4. The universal cell of claim 3, wherein, The rare-cutting endonuclease is selected from the group consisting of a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease and a homing nuclease.
5. The universal cell of claim 4, wherein, The genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide ribonucleic acid sequence for specific targeting of the CIITA gene or the B2M gene.
6. The universal cell of claim 5, wherein, The CRISPR / CAS9 system is used to perform a two-end direct knockout on the exon segments of B2M and CIITA, respectively, wherein the target sequences of the guide ribonucleic acid sequence gRNA for the B2M gene are SEQ ID NO: 2 and 3, and the target sequences of the guide ribonucleic acid sequence gRNA for the CIITA gene are SEQ ID NO: 4 and 5.
7. A method for preparing the universal cell according to any one of claims 1 to 6, characterized in that, comprising the steps of: 1) knocking out the transcriptional regulator B2M of MHC-I of the stem cell; 2) knocking out the transcriptional regulator CIITA of MHC-II of the stem cell; 3) introducing a nucleic acid sequence encoding a LGALS9 protein into the cell.
8. The preparation method according to claim 7, characterized in that, The knocking out of step 1) or 2) is a genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease that selectively inactivates the CIITA gene or the B2M gene, wherein the rare-cutting endonuclease is selected from the group consisting of a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease and a homing nuclease.
9. The production method according to claim 8, characterized by, The genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide ribonucleic acid sequence for specific targeting of the CIITA gene or the B2M gene.
10. The method of claim 9, wherein, Steps 1) and 2) are two-end direct knock-out of B2M and CIITA exon segments using the CRISPR system, wherein the target sequences of gRNAs for the B2M gene are SEQ ID NO: 2 and 3, and the target sequences of gRNAs for the CIITA gene are SEQ ID NO: 4 and 5.
11. The preparation method according to claim 7, characterized in that, The step 3) introduces a nucleic acid sequence encoding the LGALS9 protein into the cell using an expression vector.
12. The method of claim 11, wherein, The expression vector used in the step 3) is a viral vector.
13. The method of claim 12, wherein, The viral vector is a lentivirus.
14. The preparation method according to claim 7, characterized in that, The step 3) introduces the nucleic acid sequence encoding the LGALS9 protein into a selected site of the universal cell.
15. The method of claim 14, wherein, The selected site of the universal cell is a safe harbor gene site.
16. The method of making according to any one of claims 7-15, wherein, The universal stem cell further comprises a second expression vector comprising a polynucleotide sequence encoding one selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9.
17. The preparation method according to claim 16, characterized in that, The second expression vector is an inducible expression vector.
18. The method of claim 17, wherein, The second expression vector is a viral vector.
19. A method of preparing a differentiated universal cell, comprising culturing the universal cell of any one of claims 1-6 under differentiation conditions, thereby preparing a differentiated hypoimmunogenic cell.
20. The method of claim 19, wherein the differentiation conditions are suitable for differentiating the cell into a cell type selected from the group consisting of a cardiomyocyte, a neural cell, a glial cell, an endothelial cell, a T cell, an NK cell, an NKT cell, a macrophage, a hematopoietic progenitor cell, a mesenchymal cell, an islet cell, a chondrocyte, a retinal pigment epithelial cell, a kidney cell, a hepatocyte, a thyroid cell, a skin cell, a blood cell, and an epithelial cell.
21. A composition characterized in that, The composition comprises the universal cell of any one of claims 1-6.
22. Use of the universal cell of any one of claims 1-6, or the composition of claim 21, in the manufacture of a product for cell therapy.
23. Use of the universal cell of any one of claims 1-6, or the composition of claim 21, in the manufacture of a product for organ transplantation.
24. Use of the universal cell of any one of claims 1-6, or the composition of claim 21, in the construction of a universal PSCs cell bank.
Citation Information
Patent Citations
Universal donor stem cells and related methods
CN107921148A
Medicine rapid screening method based on Tim-3 / Galectin-9 blocking function and biological effect thereof
CN109666698A
Hypoimmunogenic neural cells for the treatment of neurological disorders and conditions
TW202202155A
Methods of engineering immune cells for enhanced potency and persistence and uses of engineered cells in immunotherapy
WO2022120370A2