A nano drug delivery system for enhancing the efficacy of gastric cancer immunotherapy and its application

Abstract

The present invention relates to the field of bioengineering technology, and discloses a nano drug delivery system for enhancing the therapeutic effect of gastric cancer immunotherapy, wherein the nano drug delivery system comprises a nano carrier PLGA-PEG and a nano drug si-circRHBDD1, wherein the mass ratio of PLGA-PEG to si-circRHBDD1 is 100:1. The PLGA-PEG (si-circRHBDD1) nano drug delivery system of the present invention can control the release of si-circRHBDD1 and improve the absorption rate. PLGA-PEG (si-circRHBDD1) combined with PD-1mAb significantly inhibits tumor growth; it is feasible and safe to use PLGA-PEG as a carrier to deliver circRHBDD1 siRNA for anti-tumor treatment, and it may be used as a nano therapeutic target to enhance the efficacy of immunotherapy.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a nano drug delivery system for enhancing the therapeutic effect of gastric cancer immunotherapy and its application. Background Art

[0002] Nano drug delivery systems can reduce the cytotoxicity of anti-tumor drugs and improve the efficacy by delivering various drugs including siRNAs. In addition, nano drug delivery systems can reduce the degradation of siRNAs and prolong the drug action time and targeting ability. Studies have shown that poly(lactide-co-glycolic acid) (PLGA) nano drug delivery systems have been used as carriers for drug delivery. PLGA-polyethylene glycol (PEG) nano drug delivery systems are used to control drug release and are expected to be used in cancer treatment. Nano drug delivery systems can also promote T cell activation and improve anti-tumor effects with low toxicity. In order to clarify the role of nano drug delivery systems in the efficacy of gastric cancer immunotherapy, a nano drug delivery system and its application for enhancing the efficacy of gastric cancer immunotherapy are proposed. Summary of the invention

[0003] In order to solve the technical problem of the role of nano drug delivery system in the therapeutic effect of gastric cancer immunotherapy, the present invention provides a nano drug delivery system and application thereof for enhancing the therapeutic effect of gastric cancer immunotherapy.

[0004] The present invention adopts the following technical scheme to achieve: a nano drug delivery system for enhancing the efficacy of gastric cancer immunotherapy, the nano drug delivery system comprising a nano carrier PLGA-PEG and a nano drug si-circRHBDD1, wherein the mass ratio of PLGA-PEG to si-circRHBDD1 is 100:1, that is, 10 mg of PLGA-PEG is dissolved in 500 ul of dichloromethane, and 0.4 ml of si-circRHBDD1 solution (0.1 mg) is added.

[0005] The nucleic acid sequence of the si-circRHBDD1 is: 5'-UGGGACCGAGGACUUCCUUTT-3'.

[0006] A nano drug delivery system for enhancing the efficacy of gastric cancer immunotherapy, the preparation steps are:

[0007] S1 Reconstitute 1 mg of si-circRHBDD1 in 4 ml of DEPC water to prepare si-circRHBDD1 solution (0.25 mg / ml).

[0008] S2: Dissolve 10 mg PLGA-PEG in 500 ul dichloromethane and add 0.4 ml si-circRHBDD1 solution (0.1 mg).

[0009] S3 ice bath ultrasonic treatment (80 W, 3 min), the primary emulsion was further emulsified in 4 ml PVA solution (2.5%, w / v) to form a water-in-oil-in-water emulsion. The second emulsion was then stirred at room temperature for 4 h to evaporate the organic solvent.

[0010] S4 was prepared by collecting the precipitate by centrifugation at 12000 rpm / min for 10 minutes; the collected sediment was then washed 3-5 times and then resuspended in ddH2O.

[0011] A nano drug delivery system is used in a product for enhancing the efficacy of gastric cancer immunotherapy, wherein the nano drug delivery system combined with PD-1 mAb significantly inhibits tumor growth.

[0012] As a further improvement of the above solution, the product is a reagent, a kit and / or a chip.

[0013] As a further improvement of the above solution, the product is a reagent, a kit and / or a chip containing a nano drug delivery system.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The PLGA-PEG (si-circRHBDD1) nano-drug delivery system of the present invention can control the release of si-circRHBDD1 and improve the absorption rate. The results of the cell uptake experiment showed that the nano-drug delivery system enhanced the uptake of tumor cells, which may promote the accumulation of the nano-drug delivery system at the tumor site. Fluorescence images showed that the nano-drug delivery system had strong tumor targeting both in vivo and in vitro. Importantly, the results of the C57BL / 6 model showed that PLGA-PEG (si-circRHBDD1) combined with PD-1mAb significantly inhibited tumor growth. It is worth noting that H&E staining analysis and blood biochemical examination confirmed that it had no obvious toxic side effects in vitro and in vivo. These results show that it is feasible and safe to use PLGA-PEG as a carrier to deliver circRHBDD1 siRNA for anti-tumor treatment, and it may be used as a nano-therapeutic target to enhance the efficacy of immunotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Analytical spectrum for the preparation and characterization of PLGA-PEG (si-circRHBDD1) nanodrug delivery system; wherein:

[0017] Figure 1 A is a schematic diagram of a representative photograph of the PLGA-PEG (si-circRHBDD1) nanodrug delivery system;

[0018] Figure 1B is a representative image of TEM results showing the PLGA-PEG (si-circRHBDD1) nanodrug delivery system;

[0019] Figure 1 C is a schematic diagram of the size distribution of the PLGA-PEG (si-circRHBDD1) nanodrug delivery system;

[0020] Figure 1 D is a schematic diagram of the zeta potential of the PLGA-PEG (si-circRHBDD1) nanodrug delivery system;

[0021] Figure 1 E is a schematic diagram of the size and PD of the PLGA-PEG (si-circRHBDD1) nanodrug delivery system measured using dynamic light scattering;

[0022] Figure 2 It is an analytical spectrum of sustained release and drug uptake capacity of nano drug delivery system; wherein:

[0023] Figure 2 A is a schematic diagram of the release percentage of circRHBDD1 siRNA from PLGA-PEG (si-circRHBDD1) nanodrug delivery system at 37°C;

[0024] Figure 2 B is a schematic diagram of incubating MKN-28 cells with the coumarin-6 labeled nanodrug delivery system to detect the uptake of the nanodrug delivery system into MKN-28 cells;

[0025] Figure 3 The analysis spectrum of the targeting and anti-tumor efficacy of the nano-drug delivery system in the C57BL / 6 gastric cancer model;

[0026] Figure 3 A is the in vivo dynamic fluorescence imaging after intravenous injection of free DiR or DiR-NPs;

[0027] Figure 3 B is the in vivo dynamic fluorescence imaging statistics after intravenous injection of free DiR or DiR-NPs;

[0028] Figure 3 C is the fluorescence image of tumors and isolated organs with free DiR or DiR-NPs;

[0029] Figure 3 D is the fluorescence statistics of tumors and isolated organs of free DiR or DiR-NPs;

[0030] Figure 3E is a schematic diagram of the C57BL / 6 model showing the therapeutic effect of PLGA-PEG (si-circRHBDD1) combined with PD-1mAb;

[0031] Figure 3 F is a schematic diagram of the statistical analysis of tumor volume after treatment with PLGA-PEG (si-circRHBDD1) combined with PD-1 mAb;

[0032] Figure 3 G is a schematic diagram of the statistical analysis of tumor weight after treatment with PLGA-PEG (si-circRHBDD1) combined with PD-1 mAb;

[0033] Figure 4 The analytical spectrum of the biosafety of the PLGA-PEG (si-circRHBDD1) nanodrug delivery system in vivo; wherein:

[0034] Figure 4 A is a representative H&E staining image of the heart, liver, spleen, lung, and kidney of mice after intravenous injection of PLGA-PEG (si-circRHBDD1) + PD-1mAb group treatment;

[0035] Figure 4 B is a schematic diagram of the ALT level of mice after intravenous injection of PLGA-PEG (si-circRHBDD1) + PD-1mAb group treatment;

[0036] Figure 4 C is a schematic diagram of the AST levels of mice after intravenous injection of PLGA-PEG (si-circRHBDD1) + PD-1mAb group treatment;

[0037] Figure 4 D is a schematic diagram of the BUN level of mice after intravenous injection of PLGA-PEG (si-circRHBDD1) + PD-1mAb group treatment;

[0038] Figure 4 E is a schematic diagram of the Cr levels in mice after intravenous injection of PLGA-PEG(si-circRHBDD1)+PD-1mAb group. DETAILED DESCRIPTION

[0039] The present invention is further described below in conjunction with the accompanying drawings and specific implementation methods. It should be noted that, under the premise of no conflict, the various embodiments or technical features described below can be arbitrarily combined to form a new embodiment.

[0040] Embodiment 1:

[0041] The present embodiment provides a nano-drug delivery system for enhancing the efficacy of gastric cancer immunotherapy, wherein the nano-drug delivery system includes a nano-carrier PLGA-PEG and a nano-drug si-circRHBDD1, wherein the mass ratio of PLGA-PEG to si-circRHBDD1 is 100:1, that is, 10 mg of PLGA-PEG is dissolved in 500 ul of dichloromethane, and 0.4 ml of si-circRHBDD1 solution (0.1 mg) is added.

[0042] The nucleic acid sequence of the circRNA circRHBDD1 is GACTTCCTTCGCTGGGCATCTGGCTGGGATTCTTGTTGGACTAATGTACACTCAAGGGCCTCTGAAGAAAATCATGGAAGCATGTGCAGGCGGTTTTTCCTCCAGTGTTGGTTACCCAGGACGGCAATACTACTTTAATAGTTCAGGCAGCTCTGGATATCAGGATTATTATCCGCATGGCAGGCCAGATCACTATGAAGAAGCACCCAGG, as shown in SEQ ID NO.1; the nucleic acid sequence of the si-circRHBDD1 is: 5'-UGGGACCGAGGACUUCCUUTT-3', as shown in SEQ ID NO.2.

[0043] A nano drug delivery system for enhancing the efficacy of gastric cancer immunotherapy, the preparation steps are:

[0044] S1 Reconstitute 1 mg of si-circRHBDD1 in 4 ml of DEPC water to prepare si-circRHBDD1 solution (0.25 mg / ml).

[0045] S2: Dissolve 10 mg PLGA-PEG in 500 ul dichloromethane and add 0.4 ml si-circRHBDD1 solution (0.1 mg).

[0046] S3 ice bath ultrasonic treatment (80W, 3min), the primary emulsion was further emulsified in 4ml PVA solution (2.5%, w / v) to form a water-in-oil-in-water emulsion. The second emulsion was then stirred at room temperature for 4h to evaporate the organic solvent.

[0047] S4 was prepared by collecting the precipitate by centrifugation at 12000 rpm / min for 10 minutes; the collected sediment was then washed 3-5 times and then resuspended in ddH2O.

[0048] A nano drug delivery system is used in a product for enhancing the efficacy of gastric cancer immunotherapy. The nano drug delivery system combined with PD-1 mAb significantly inhibits tumor growth.

[0049] The product is a reagent, a kit and / or a chip.

[0050] The product is a reagent, a kit and / or a chip containing a nano drug delivery system.

[0051] Embodiment 2:

[0052] Preparation and characterization of PLGA-PEG (si-circRHBDD1) nanodrug delivery system

[0053] like Figure 1 As shown: Taking advantage of the nano drug delivery system to accurately deliver drugs to the tumor site. PLGA-PEG was prepared using w / o / w emulsion, such as Figure 1 As shown in A. Transmission electron microscopy (TEM) images show that the PLGA-PEG (si-circRHBDD1) nanodrug delivery system is spherical and evenly distributed. Figure 1 As shown in B. DLS was used to detect the size, zeta potential and PDI of the nanodrug delivery system. The average diameter of PLGA-PEG (si-circRHBDD1) was 145.5 ± 2.8 nm. Figure 1 C. The zeta potential is 24.4±7.62mV, as shown in Figure 1 D, PDI is 0.16 ± 0.01. Figure 1 As shown in E.

[0054] Embodiment 3:

[0055] Sustained release and drug uptake ability of rice drug delivery system

[0056] like Figure 2 Next, the in vitro release ability of si-circRHBDD1 from the PLGA-PEG (si-circRHBDD1) nanodrug delivery system was evaluated. Figure 2As shown in A. Within the first 24 hours, the cumulative release of siRNA in free si-circRHBDD1 and PLGA-PEG (si-circRHBDD1) nanodrug delivery systems were 86.1% and 44.6%, respectively. The embedded si-circRHBDD1 was slowly released from the nanodrug delivery system, and the release of siRNA was 72.2% after 120 hours. The results showed that the PLGA-PEG (si-circRHBDD1) nanodrug delivery system has a sustained release effect. After incubating MKN-28 cells with coumarin-6-NP (Coumarin-6-NP), fluorescence microscopy showed that the intracellular fluorescence signal of the Coumarin-6-NP group was significantly higher than that of the control group, indicating that the nanodrug delivery system can promote the cell uptake of drugs, as shown in Figure 2 As shown in B.

[0057] Embodiment 4:

[0058] Targeting and anti-tumor efficacy of nanodrug delivery system in C57BL / 6 gastric cancer model

[0059] like Figure 3 As shown: The fluorescence signal of DiR-NPs at the tumor site is significantly higher than that of the free DiR group. Figure 3 A and B. Fluorescence images of tumors and organs showed the same results, as shown in Figure 3 CD shows the tumor targeting ability of the nano-drug delivery system in vivo. In order to study the synergistic anti-tumor effect of the nano-drug delivery system, a C57BL / 6 mouse gastric cancer model was constructed. It was found that the PLGA-PEG (si-circRHBDD1) combined with PD-1mAb group showed the most significant effect on tumor growth inhibition, as shown in Figure 2. Figure 3 As shown in EG.

[0060] Embodiment 5:

[0061] PLGA-PEG (si-circRHBDD1) nanodrug delivery system is biosafe in vivo

[0062] like Figure 4 As shown: In addition, systemic toxicity was evaluated by H&E staining, and the results showed that the intravenous injection of PLGA-PEG(si-circRHBDD1)+PD-1mAb group did not show significant toxicity to major organs (including heart, liver, spleen, lung, and kidney), as shown Figure 4 As shown in A. In addition, blood indicators ALT, AST, BUN and Cr were tested and it was found that there was no significant change between the different groups. Figure 4The above results show that PLGA-PEG (si-circRHBDD1) combined with PD-1mAb significantly inhibits tumor growth and is safe in vivo

[0063] Embodiment 6:

[0064] Materials and methods

[0065] 1. Cell culture

[0066] The human gastric cancer cell line MKN-28 was purchased from the JCRB cell bank (National Institute of Hygienic Sciences). The mouse gastric cancer cell line MFC was purchased from Guangzhou Saiku Biotechnology Co., Ltd. All cell lines were cultured in RPMI-1640 medium (Gibco) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The cells were placed in an incubator at 37°C and 5% CO2.

[0067] 2. Animal Model

[0068] Female C57BL / 6 mice and nude mice aged about 3–4 weeks were purchased from Nanjing Qinglongshan Experimental Animal Co., Ltd. All mice were raised in a specific pathogen-free (SPF) facility, and all animal experiments were approved by the Ethics Committee of Wannan Medical College.

[0069] 3. Preparation and characterization of PLGA-PEG nano-drug delivery system

[0070] Nanodrug delivery systems loaded with siRNAs were prepared by double emulsification-solvent evaporation technology. 1 mg of si-circRHBDD1 was reconstituted in 4 ml of DEPC water to prepare si-circRHBDD1 solution (0.25 mg / ml). 10 mg of PLGA-PEG was dissolved in 500 ul of dichloromethane and 0.4 ml of si-circRHBDD1 solution (0.1 mg) was added. The primary emulsion was further emulsified in 4 ml of PVA solution (2.5%, w / v) by ice bath ultrasonic treatment (80 W, 2 min) to form a water-in-oil-in-water emulsion. The second emulsion was then stirred at room temperature for 4 h to evaporate the organic solvent. Subsequently, the precipitate was collected by centrifugation at 12000 rpm / min for 10 minutes; the collected sediment was then washed 3-5 times and then resuspended in ddH2O to prepare.

[0071] The morphology and size of the nanoparticles were observed by transmission electron microscopy. The size, zeta potential and polydispersity index (PDI) were measured by dynamic light scattering (DLS) using a nanoparticle analyzer (Zetasizer Nano ZSE).

[0072] 4. In vivo anti-tumor efficacy and toxicity evaluation of nano-drug delivery systems

[0073] In order to study the inhibitory effect of PLGA-PEG (si-circRHBDD1) nanodrug delivery system on gastric cancer cell growth in vivo, we constructed a C57BL / 6 tumor model. 3 At the same time, PLGA-PEG (si-circRHBDD1) nanodrug delivery system or PLGA-PEG (siRNA control) nanodrug delivery system was injected into mice via the tail vein twice a week at a dose of 200 mg / kg. Anti-PD-1 mAb or IgG isotype control was injected intraperitoneally at a concentration of 100 μg per mouse on days 3, 6, 9, and 12, respectively. Tumor length (L) and width (W) were measured every 3 days using a caliper, and tumor volume was calculated as follows: V = L × W2 / 2. Tumors were resected, weighed, and fixed with 4% paraformaldehyde. Major organs, including heart, liver, spleen, lung, and kidney, were extracted and fixed with 4% paraformaldehyde for further H&E staining. In vivo dynamic fluorescence imaging after injection of free DiR or DiR-NP via the tail vein was detected using an animal in vivo imaging system (Biolight Biotechnology). Mice were killed 48 h later, and organs and tumors were dissected and fluorescent images were acquired.

[0074] 5. Statistical analysis

[0075] SPSS26.0 (Chicago) and GraphPad Prism 8 (San Diego) were used for statistical analysis of the experimental data. All statistical data were expressed as mean ± standard deviation (SD). The t test was used for comparison between two groups, and one-way analysis of variance was used for comparison between multiple groups. p < 0.05 was considered statistically significant.

[0076] The PLGA-PEG (si-circRHBDD1) nano-drug delivery system of the present invention can control the release of si-circRHBDD1 and improve the absorption rate. The results of the cell uptake experiment showed that the nano-drug delivery system enhanced the uptake of tumor cells, which may promote the accumulation of the nano-drug delivery system at the tumor site. Fluorescence images showed that the nano-drug delivery system had strong tumor targeting both in vivo and in vitro. Importantly, the results of the C57BL / 6 model showed that PLGA-PEG (si-circRHBDD1) combined with PD-1mAb significantly inhibited tumor growth. It is worth noting that H&E staining analysis and blood biochemical examination confirmed that it had no obvious toxic side effects in vitro and in vivo. These results show that it is feasible and safe to use PLGA-PEG as a carrier to deliver circRHBDD1 siRNA for anti-tumor treatment, and it may be used as a nano-therapeutic target to enhance the efficacy of immunotherapy.

[0077] The above-mentioned embodiments are only preferred embodiments of the present invention and cannot be used to limit the scope of protection of the present invention. Any non-substantial changes and substitutions made by technicians in this field on the basis of the present invention shall fall within the scope of protection required by the present invention.

Claims

1. A nano drug delivery system for enhancing the efficacy of gastric cancer immunotherapy, characterized in that: The nano drug delivery system includes a nanocarrier PLGA-PEG and a nano drug si-circRHBDD1, wherein the mass ratio of PLGA-PEG to si-circRHBDD1 is 100:1, i.e., 10 mg of PLGA-PEG is dissolved in 500 ul of dichloromethane, and 0.1 mg of 0.4 ml of si-circRHBDD1 solution is added; The nucleic acid sequence of the si-circRHBDD1 is: 5'-UGGGACCGAGGACUUCCUUTT-3'.

2. A nano drug delivery system for enhancing the efficacy of gastric cancer immunotherapy as claimed in claim 1, characterized in that: The preparation steps are: S1 Reconstitute 1 mg of si-circRHBDD1 in 4 ml of DEPC water to prepare 0.25 mg / ml si-circRHBDD1 solution; S2: Dissolve 10 mg PLGA-PEG in 500 ul dichloromethane and add 0.4 ml si-circRHBDD1 solution (0.1 mg); S3 was treated with ultrasound in an ice bath at a power of 80 W for 3 min to obtain a primary emulsion, which was further emulsified in 4 ml of a 2.5% (w / v) PVA solution to form a water-in-oil-in-water emulsion; the second emulsion was then stirred at room temperature for 4 h to evaporate the organic solvent; S4 was prepared by collecting the precipitate by centrifugation at 12000 rpm / min for 10 minutes; the collected sediment was then washed 3-5 times and then resuspended in ddH2O.

3. Use of the nano drug delivery system according to any one of claims 1 to 2 in the preparation of a product that enhances the efficacy of gastric cancer immunotherapy, characterized in that: The nano-drug delivery system combined with PD-1 mAb significantly inhibited tumor growth.

4. The use of the nano drug delivery system according to claim 3 in preparing a product for enhancing the efficacy of gastric cancer immunotherapy, characterized in that: The product is a reagent, a kit and / or a chip.

5. Use of the nano drug delivery system according to claim 4 in the preparation of a product for enhancing the efficacy of gastric cancer immunotherapy, characterized in that: The product is a reagent, a kit and / or a chip containing a nano drug delivery system.

Images