A high specific activity alpha-amylase mutant and its application

Abstract

The present invention relates to the field of genetic engineering and protein modification technology, and proposes a high specific activity alpha-amylase mutant and its application. The present invention is based on wild-type alpha-amylase A1, and provides a mutant comprising at least one mutation site in N39T, P145N, D159Y, F191N, Q240S, D279N, R306S, T310N, H319T, and I477V. Compared with wild-type alpha-amylase A1, the specific activity of the xylanase mutant provided by the present invention is generally increased by 26.2%-35.7%; wherein, the specific activity of the alpha-amylase mutant containing the T310N single-point mutation is the highest, reaching 1251.38U / mg, which is conducive to reducing the production cost of the enzyme and promoting its wide application in the industrial field.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering and protein engineering, and in particular to a high specific activity alpha-amylase mutant and application thereof. Background Art

[0002] α-amylase is widely found in animals, plants and microorganisms. It is an endo-glucosidase that acts on starch molecules to cut α-1,4 bonds from the inside of the molecule to generate dextrin and reducing sugar hydrolases. The terminal glucose residue C1 carbon atom of the product is α-configuration, so it is called α-amylase. α-amylase is one of the most important industrial enzyme preparations at present, and plays a huge role in industries such as monosodium glutamate, maltose, glucose, alcohol, beer, lactic acid, and citric acid. The enzyme preparations widely used today began in 1906 when humans discovered bacterial amylase for liquefying starch to produce ethanol. The first α-amylase used in industry came from fungi. Because some bacterial α-amylases have the characteristics of high temperature resistance, acid resistance, and alkali resistance, they are more in line with various extreme conditions in industrial production. Therefore, bacterial α-amylase is currently the most widely used in industries such as fermentation that require high temperatures, especially the high-temperature resistant α-amylase from Bacillus (such as Bacillus amyloliquefaciens and Bacillus licheniformis), which has occupied a considerable market.

[0003] α-Amylase can be obtained from different microbial sources. Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus licheniformis, and Bacillus stearothermophilus are used as α-amylase production strains in industrial production. People now focus on the functional properties of heat-resistant and salt-resistant amylases to facilitate the starch degradation process in industrial production and save costs. At present, heat-resistant α-amylases obtained from Bacillus stearothermophilus and Bacillus licheniformis have been used in industrial production. Fungi that produce amylase are generally mesophilic fungi, mostly Aspergillus and Penicillium. Aspergillus is an important strain in the fermentation industry and food processing industry, which can efficiently secrete proteases, amylases, pectinases, etc. Aspergillus oryzae is considered to be the best strain for producing exogenous proteins such as α-amylase in industry.

[0004] In order to adapt to some special requirements of industry, the catalytic properties of enzymes must be modified. Directed mutagenesis is a very advantageous tool to discover new or improved functions of enzymes. Directed evolution is used to modify the properties of many enzymes, such as enzyme activity, selectivity, stability and substrate specificity. Now the starch processing industry occupies the largest market for enzyme preparations, so directed evolution has replaced natural evolution, because natural evolution is no longer suitable for industrial applications. Richardson et al. used directed evolution to screen two α-amylases with superior properties and suitable for industrial processing through high-throughput screening.

[0005] Residues involved in salt bond formation, calcium binding or potential deamidation can affect the thermal stability of the protein and can therefore be used for site-directed mutagenesis. Mutations that can change thermal stability are mainly located in domain B and at the interface between domain B and domain A, where the site (Ca-Na-Ca) and substrate binding are located. Priyadharshini et al. also reported that the region near the calcium binding site in BLA is also quite sensitive to any modification. The amino acid residues encoding the calcium binding site (N104, D161, D183, D200 and D430) were site-directedly mutated to D104, N161, N183, N200 and N430. The mutant protein had increased specific activity at pH 5.0 and 70 °C, but decreased activity at 30 °C. However, the N104 D and D430N mutations did not affect the stability of the amylase. The D161N mutation significantly reduced the thermal stability of the amylase. In another study, site-directed mutagenesis was applied to a mesophilic α-amylase from Bacillus megaterium WHO to enhance its thermostability and calcium ion independence. Mutations in the calcium binding site (A53S and H58I) affected the α-amylase, with the A53S mutant having enhanced calcium binding, which likely led to increased enzyme stability. Another calcium-independent mutant (H58I) was highly thermostable. The H238D mutation in the B. stearothermophilus α-amylase, which is involved in calcium ion binding to substrates, reduced both enzyme activity and thermostability.

[0006] This patent aims to obtain a high specific activity α-amylase mutant through site-directed mutagenesis, thereby helping to reduce the production cost of the enzyme and promote its widespread application in the industrial field. Summary of the invention

[0007] The purpose of the present invention is to provide a high specific activity α-amylase mutant. The specific activity of the mutant is significantly improved compared with the wild type, which is conducive to its wide application in the industrial field.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention relates to an alpha-amylase mutant, which comprises an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprises an amino acid substitution at at least one position selected from the following group: 39, 145, 159, 191, 240, 279, 306, 310, 319, 477 compared with SEQ ID NO:1.

[0010] In some embodiments of the invention, the amino acid sequence of the mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID NO:1.

[0011] In some more specific embodiments, the amino acid sequence of the mutant is at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identical to SEQ ID NO:1.

[0012] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid in the following group: N39T, P145N, D159Y, F191N, Q240S, D279N, R306S, T310N, H319T, I477V.

[0013] The present invention also relates to a DNA molecule encoding the above α-amylase mutant.

[0014] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0015] The present invention also relates to a host cell, comprising the above-mentioned recombinant expression vector.

[0016] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed α-amylase mutant is significantly improved.

[0017] In some embodiments of the present invention, the host cell is Pichia pastoris ( Pichia pastoris ).

[0018] The present invention also provides application of the α-amylase mutant in the field of papermaking.

[0019] The present invention is based on wild-type α-amylase A1 and provides a mutant containing at least one mutation site among N39T, P145N, D159Y, F191N, Q240S, D279N, R306S, T310N, H319T, and I477V. Compared with wild-type α-amylase A1, the specific activity of the α-amylase mutant provided by the present invention is generally increased by 26.2%-35.7%; among them, the specific activity of the α-amylase mutant containing the T310N single-point mutation is the highest, reaching 1251.38U / mg, achieving unexpected technical effects.

[0020] In summary, the specific activity of the α-amylase mutant provided by the present invention is significantly improved, which is beneficial to reduce the production cost of α-amylase and promote its wide application in the industrial field. DETAILED DESCRIPTION

[0021] The present invention discloses an amylase mutant, a preparation method and application thereof, a DNA molecule encoding the amylase mutant, a vector, and a host cell. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired effect. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0022] The present invention has used the conventional techniques and methods used in the field of genetic engineering and molecular biology, such as MOLECΜLAR CLONING: A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS INMOLECΜLAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, on the basis of the technical solutions described in the present invention, adopt other conventional methods, experimental schemes and reagents in this area, without being limited to the limitations of the specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents:

[0023] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0024] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0025] Culture medium formula:

[0026] Escherichia coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0027] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0028] Yeast screening medium (MD medium): 2% peptone, 2% agarose;

[0029] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5% biotin, 1% glycerol;

[0030] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;

[0031] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0032] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0033] Upper medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose;

[0034] Lower culture medium plate: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar.

[0035] The present invention will be further described below in conjunction with embodiments:

[0036] Example 1 Construction of recombinant plasmid

[0037] The bacteria from Geobacillus stearothermophilus ( Geobacillus stearothermophilus The amylase gene (GeneBank: 747155414) of Pichia pastoris was optimized according to the codon preference of Pichia pastoris, and 6 bases GAATTC (EcoR I restriction site) were added before its start codon ATG, and GCGGCCGC (Not I restriction site) was added after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. The amylase was named A1, its amino acid sequence was SEQ ID NO: 1, and its encoding nucleotide sequence was SEQ ID NO: 2.

[0038] The amylase gene was digested with restriction enzymes EcoRI and Not I (Fermentas); at the same time, the plasmid pPIC9K was digested with restriction enzymes EcoRI and Not I. The digestion products were purified using a gel purification kit and ligated with T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. Several clones were sequenced for accuracy (Invitrogen).

[0039] The plasmid was purified from the E. coli clone with the correct sequencing results using a plasmid miniprep kit (Omega) to obtain a recombinant plasmid, which was named pPIC9K-A1.

[0040] Example 2 Screening of high specific activity mutants

[0041] Amylase A1 is a glycoside hydrolase G11 family amylase. In order to further improve the enzymatic activity of amylase A1, the applicant screened a large number of mutations of the enzyme using directed evolution technology.

[0042] 1.1 Design PCR primers A1-F1, A1-R1:

[0043] A1-F1: GGC GAATTC GCCGCACCGTTTAACCCAACCATG (underlined is the restriction endonuclease EcoRI recognition site);

[0044] A1-R1: ATA GCGGCCGC CTATCTTTGGACATAAATTGAAAC (the underline indicates the recognition site of restriction endonuclease NotI).

[0045] A1 gene (SEQ ID NO: 1) was used as a template and PCR amplification was performed using the above primers and GeneMorph II random mutation PCR kit (Bomais). The PCR product was recovered from gel, digested with EcoRI and NotI, and ligated with the pET21a vector digested with the same enzymes, transformed into Escherichia coli BL21 (DE3), spread on LB+Amp plates, and cultured inverted at 37°C. After transformants appeared, they were picked up one by one with a toothpick to a 96-well plate, 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well, and the cells were cultured at 37°C and 220 rpm for about 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain Escherichia coli cell lysate containing amylase.

[0046] Take out 10μl of lysate to two new 96-well plates respectively; add 190μl of substrate to one of the 96-well plates, react at 60℃ for 5 min, then take 20μl of reaction system to a new 96-well plate, add 160μl of iodine solution and 20μl of Hcl (0.1mol / L) to stop and develop color, determine the remaining starch content by iodine colorimetric method, and calculate the hydrolyzed starch content; add 190μl of Coomassie Brilliant Blue solution to the other plate, let it stand for 10min, determine the protein content by Coomassie Brilliant Blue (Bradford) binding method, and calculate the enzyme activity level and protein content of different mutants respectively.

[0047] Finally, the applicant screened out single-point mutants M96I, Y265F, M309L, and M309F that significantly improved the specific activity of amylase from more than 10,000 transformants.

[0048] Based on the above wild-type amylase A1, the present invention provides mutants containing single mutation sites of M96I, Y265F, M309L and M309F respectively.

[0049] Example 3 Expression of amylase in Pichia pastoris

[0050] 3.1 Construction of expression vector

[0051] The gene sequences of amylase A1 and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.

[0052] According to the method described in Example 1, the gene sequences of the synthesized amylase A1 and its mutants were double-digested with EcoRI and NotI, and then connected with the pPIC-9K vector digested with the same enzymes at 16°C overnight, and transformed into Escherichia coli DH5a, coated on LB+Amp plates, and inverted cultured at 37°C. After the transformants appeared, colony PCR (reaction system: template-picked single clone, rTaqDNA polymerase 0.5μl, 10×Buffer 2.0μL, dNTPs (2.5mM) 2.0μL, 5'AOX primer (10mM): 0.5μL, 3'AOX primer: 0.5μL, ddH2O 14.5μL, reaction procedure: 95°C pre-denaturation 5min, 30 cycles: 94°C 30sec, 55°C 30sec, 72°C 2min, 72°C 10min). The positive clones were verified, and the correct recombinant expression plasmid was obtained after sequencing verification.

[0053] 3.2 Construction of Pichia pastoris engineered strains

[0054] 3.2.1 Preparation of competent yeast

[0055] The Pichia pastoris GS115 strain was activated on a YPD plate, cultured at 30°C for 48 h, and then the activated GS115 monoclonal was inoculated into 6 mL YPD liquid medium. The culture was incubated at 30°C and 220 rpm for about 12 h, and then the bacterial solution was transferred to a conical flask containing 30 mL YPD liquid medium. The culture was incubated at 30°C and 220 rpm for about 5 h. The bacterial density was detected by a UV spectrophotometer. When the OD600 value was in the range of 1.1–1.3, 4 mL of the bacterial cells were collected into sterile EP tubes by centrifugation at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The remaining supernatant was absorbed with sterile filter paper, and the bacterial cells were resuspended with 1 mL of precooled sterile water, centrifuged at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. After repeated washing with 1 mL of sterile water, the cells were centrifuged at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were then washed with 1 mL of sterile water, centrifuged at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were then washed with 1 mL of precooled sorbitol (1 mol / L); centrifuge at 4°C, 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the cells in 100-150 μl pre-cooled sorbitol (1 mol / L).

[0056] 3.2.2 Transformation and screening

[0057] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I, and the linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).

[0058] The obtained transformants were transferred to BMGY medium and cultured at 30°C and 250 rpm for 1 day; then transferred to BMMY medium and cultured at 30°C and 250 rpm; 0.5% methanol was added every day to induce expression for 4 days; the bacteria were removed by centrifugation at 9000 rpm for 10 min to obtain the fermentation supernatant containing amylase A1 and amylase mutants, respectively.

[0059] , Amylase activity determination method

[0060] (1) Definition of mesophilic amylase activity unit

[0061] 1g of solid enzyme powder can liquefy 1g of soluble starch in 1h at 60℃ and pH 6.0. This is 1 enzyme activity unit, expressed as u / g.

[0062] (2) Method for determining amylase activity at medium temperature

[0063] Weigh 1g enzyme powder (accurate to 0.0001g), fully dissolve it with a small amount of phosphate buffer, carefully pour the supernatant into a volumetric flask, if there is any residue, add a small amount of phosphate buffer to fully grind, finally transfer all the samples into a volumetric flask, dilute to the mark with phosphate buffer, shake well, filter with four layers of gauze, and set the filtrate aside.

[0064] Pipette 20.0 mL of soluble starch solution into a test tube, add 5.00 mL of phosphate buffer, shake well, and preheat in a constant temperature water bath at 60℃ ± 0.2℃ for 8 min.

[0065] Add 1.00 mL of the diluted enzyme solution to be tested, start the timer immediately, shake well, and react for 5 minutes.

[0066] Immediately use an automatic pipette to draw 1.00 mL of the reaction solution, add it to a test tube containing 0.5 mL of hydrochloric acid solution and 5.00 mL of dilute iodine solution, shake well, and use 0.5 mL of hydrochloric acid solution and 5.00 mL of dilute iodine solution as blanks, and quickly measure the absorbance (A) at a wavelength of 660 nm using a 10 mm cuvette. According to the absorbance, the concentration of the test enzyme solution is obtained.

[0067] Calculation of enzyme activity of medium temperature α-amylase preparation: X1 = c×n

[0068] Where:

[0069] X1—enzyme activity of the sample, u / mL (or u / g);

[0070] c—test enzyme sample concentration, u / mL (or u / g);

[0071] n—dilution factor of the sample.

[0072] The results are expressed as integers.

[0073] (3) Measurement results

[0074] Enzyme activity was detected according to the above method, and the results showed that the enzyme activity of the fermentation supernatant of the Pichia pastoris recombinant strain expressing amylase A1 and its mutants constructed above was 370-450 U / mL.

[0075] , Protein content determination method

[0076] The Coomassie Brilliant Blue (Bradford) binding method for determining protein content is a composite method that combines colorimetry with pigmentation. Coomassie Brilliant Blue G-250 is brown-red in acidic solution, and turns blue when combined with protein. It conforms to Beer's law within a certain protein concentration range and can be measured colorimetrically at 595nm. A large amount of absorption is achieved in 3 to 5 minutes and is stable for at least 1 hour. In the range of 10 to 1000 μg / mL, the absorbance is proportional to the protein concentration.

[0077] The enzyme solution and Coomassie Brilliant Blue solution were mixed in a volume ratio of 1:5, and allowed to stand for 10 minutes. The protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0078] The protein content was detected according to the above method. The results showed that the protein content of the fermentation supernatant of the Pichia pastoris recombinant strain expressing amylase A1 and its mutants constructed above was 0.348-0.399 mg / mL.

[0079] , Specific activity calculation

[0080] “Specific Activity” refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.

[0081] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0082] The specific calculation results are shown in Table 1.

[0083] Table 1 Comparison of specific activities of amylase mutants

[0084] Amylase and its single point mutants Specific activity (U / mg) Wild type A1 938.65 N39T 1187.03 P145N 1146.59 D159Y 1249.79 F191N 1123.37 Q240S 1267.11 D279N 1099.48 R306S 1083.94 T310N 1251.38 H319T 1212.68 I477V 1049.24

[0085] It can be seen from the results in Table 1 that compared with the wild-type amylase A1, the specific activity of the α-amylase mutant provided by the present invention is increased by 26.2%-35.7%; among them, the amylase mutant containing the T310N single-point mutation has the highest specific activity, reaching 1251.38 U / mg, achieving unexpected technical effects.

[0086] In summary, the specific activity of the α-amylase mutant provided by the present invention is significantly improved, which is beneficial to reduce the production cost of the enzyme and promote its wide application in the industrial field.

Claims

1. An α-amylase mutant, characterized in that Compared with SEQ ID NO: 1, the mutant only has the following amino acid substitution: Q240S.

2. A DNA molecule encoding the α-amylase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3; the host cell is Pichia pastoris ( Pichia pastoris ) or Trichoderma reesei ( Trichoderma reesei ).

5. Use of the α-amylase mutant according to claim 1 in the field of papermaking.