A blocking probe for RNA library construction, a library construction kit, and a preparation method

Abstract

The present invention relates to the technical field of nucleotide raw materials, and specifically relates to a blocking probe for RNA library construction, a library construction kit, and a preparation method. The blocking probe provided by the present invention has a polymer molecule with a specific structure connected to its 5'-end. The blocking probe targets a target region and binds to RNA to form a double-stranded composite structure. The polymer molecule improves the stability of the double-stranded composite structure through intermolecular forces such as hydrogen bonds and molecular entanglement, as well as the chimeric effect of the linear functional groups in the polymer structure and the double-stranded composite structure in the molecular spatial structure. At the same time, it can effectively prevent the reverse transcriptase from displacing the blocking probe under the action of strand displacement activity, improve the blocking effect of the blocking probe, reduce the library content of unnecessary RNA in the RNA library, optimize the library quality, and improve the convenience and accuracy of RNA sequence information analysis.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleotide raw materials, and particularly relates to a blocking probe for RNA library construction, a library construction kit, and a preparation method. Background Art

[0002] In recent years, with the rapid development of high-throughput sequencing technology, various RNA library construction technologies and sequencing technologies have emerged in an endless stream and been iteratively upgraded, greatly reducing the difficulty and cost of RNA library construction and sequencing. This has also made the RNA high-throughput sequencing technology an important research means in the fields of life progress and disease diagnosis. However, the proportion of RNA types in samples from different sources is extremely inconsistent. For example, ribosomal RNA (rRNA) in normal cells accounts for about 90%-95% of the total RNA, and the mRNA of globulin in blood accounts for more than 76% of the total mRNA. The existence of these RNAs occupies most of the sequencing data, seriously affecting the detection of low-abundance RNAs and increasing the cost of sequencing.

[0003] In the prior art, there are two directions to solve the problems existing in the above-mentioned RNA library construction, that is, to isolate the target RNA or remove / consume the unnecessary RNA, which mainly involves three types of technologies. The first type of technology is to target and isolate the target RNA; the second type of technology is to remove or consume the unnecessary RNA from the sample, such as ribosomal RNA, globin mRNA, etc.; the third type of technology is to block the function of synthesizing cDNA using the unnecessary RNA as a template, such as by preventing the probe from binding to the unnecessary RNA to avoid the unnecessary RNA being used as a template to synthesize cDNA. The specific methods of the first type of technology include the polyA enrichment method, which uses oligo(dT) magnetic beads to capture and enrich the mRNA containing polyA. This method is only applicable to RNA with good integrity, and the types of RNA that can be captured are limited, greatly reducing the sequencing diversity. Moreover, the longer the polyA length of the RNA, the higher the capture efficiency, which will cause the preference of RNA library construction; the specific methods of the second type of technology include using antisense DNA or RNA probes to hybridize the unnecessary RNA in the RNA sample before constructing the NGS library. After hybridization, a double-stranded RNA-specific enzyme is used to digest the sample to remove the RNA probe and the unnecessary RNA. Although this method is effective, there is uncertainty in technical implementation; another specific implementation method of the second type of technology also includes that the antisense DNA or RNA probe is a biotinylated probe, which can selectively remove the unnecessary RNA from the sample by capturing the probe / target RNA molecule onto the streptavidin-coated beads or surface. However, the bead binding and washing are very laborious, and due to non-specific binding and capture, it usually results in significant sample loss. Therefore, this type of technology as a whole has defects such as high cost, complex operation (about 20 - 40 steps), long time consumption (about 2h), high requirements for sample sources and RNA abundance, and difficulty in storing reagents.

[0004] The third type of technology is a technology that has been gradually developed and evolved to address the technical deficiencies existing in the first and second types of technologies. The specific methods and implementation processes are as described in Patent CN201980062732.4. Its core principle involves annealing one or more blocking oligonucleotides that cannot be extended at the 3' end to the RNA sample to be analyzed. The blocking oligonucleotides stably bind to the unwanted RNA substances, and the unwanted RNA is inhibited during the cDNA synthesis process and cannot serve as a template for cDNA synthesis. Analyzing from the core principle of this technology, the key factor affecting the application effect of this technology is the blocking effect of the blocking oligonucleotides. Therefore, to ensure the blocking effect, the solutions given in this patent include designing multiple probes for combined use. The multiple probes target different regions of the same unwanted RNA to ensure the blocking of the process of using this RNA as a template for cDNA synthesis. Another auxiliary solution is to design modified oligonucleotides in the structure of the blocking oligonucleotide probe to enhance the binding force between the blocking oligonucleotide and the complementary region of the unwanted RNA and prevent the blocking oligonucleotide from falling off.

[0005] However, in the actual application process, there are still problems such as unstable binding of the blocking oligonucleotides, which cannot efficiently block the reverse transcriptase from using the RNA complementary to the probe as a template for cDNA synthesis. Especially for RNAs in high GC regions (such as exon regions), generally, the reverse transcriptase needs to have a certain strand displacement activity to ensure effective reverse transcription in these regions. However, the strand displacement activity of the reverse transcriptase will also affect the blocking effect of the blocking oligonucleotide probe. Therefore, to achieve a balance between the two and solve the limitations of the existing technology, it is necessary to further optimize the structure of the blocking oligonucleotides to improve the quality of the RNA library. Summary of the Invention

[0006] To solve the technical problems existing in the prior art, one of the objectives of the present invention is to provide a blocking probe for RNA library construction. A polymer with a specific structure is connected to the 5' end of the probe. The polymer forms a winding structure with the probe and the target RNA through intermolecular forces, enhancing the blocking effect of the probe and improving the construction effect of the RNA library.

[0007] Another objective of the present invention is to provide a library construction kit for RNA library construction, which includes the blocking probe provided by the present invention.

[0008] Meanwhile, the present invention also provides a preparation method for the blocking probe for RNA library construction.

[0009] To achieve the above objectives, the technical solutions adopted by the present invention are as follows:

[0010] A blocking probe for RNA library construction, the blocking probe being complementary paired and bound to a target region of unwanted RNA; wherein the 3'-end of the blocking probe contains a modified structure that prevents the extension of the blocking probe; the 5'-end of the blocking probe is covalently linked to a polymer shown in formula (Ⅰ):

[0011]

[0012] wherein X 1 、X 2 is O or amino or substituted amino;

[0013] L 1 、L 2 is an alkylene or substituted alkylene or heteroalkylene having 2 to 4 carbon atoms.

[0014] Preferably, in order to reduce the non-specific binding of the polymer to nucleic acid molecules, the number average molecular weight range of the polymer is 4595.1 ± 5%, and the PD value is 1.2. The molecular weight of the polymer molecular structure is controlled by the material input amount and reaction time during the synthesis process of the polymer and its intermediates.

[0015] Optionally, the X 1 、X 2 is amino or substituted amino.

[0016] Optionally, the L 1 、L 2 is an alkylene having 2 to 4 carbon atoms; more preferably an alkylene having 3 carbon atoms.

[0017] Optionally, the modified structure at the 3'-end is -NH 2 C 6 ; more preferably, in order to further improve the binding force between the blocking probe and the target RNA region, the modified structure at the 3'-end further includes a dihydrocyclopyrrole tripeptide.

[0018] Optionally, the nucleotide chain length of the blocking probe is 30 to 60 nt; the melting temperature (Tm) of the double-stranded body formed with the target RNA region is ≥ 80 °C; more preferably ≥ 90 °C.

[0019] Optionally, the nucleotide chain of the blocking probe includes locked nucleic acid; more preferably, the number of locked nucleic acids is 5 to 7; even more preferably, the position of the locked nucleic acid is close to the 5'-end of the blocking probe.

[0020] A library construction kit for RNA library construction, comprising a plurality of the above-mentioned blocking probes, random primers, reverse transcriptase, and reaction buffer; wherein the plurality of blocking probes can achieve that at least 1 / 6 of the full length of the unwanted RNA is covered with blocking probes, and the spacing distance between adjacent blocking probes does not exceed 100 nt;

[0021] Further preferably, the spacing distance between adjacent blocking probes does not exceed 30 nt; the nucleotide sequence length of the blocking probe is 25-45 nt; preferably, the nucleotide sequence length of the blocking probe is 40 nt.

[0022] A preparation method of a blocking probe for RNA library construction, characterized in that it includes synthesizing a polymer and connecting the polymer to the 5'-end of the blocking probe through a click chemical reaction.

[0023] The above-mentioned preparation method of a blocking probe for RNA library construction is characterized in that it further includes synthesizing an intermediate product of formula (Ⅱ) Then connecting the intermediate product to the 5'-end of the blocking probe. Wherein X 3 is O or amino or substituted amino;

[0024] Wherein the intermediate product of formula (Ⅱ) is composed of monomer 1 of formula (Ⅲ) monomer 2 of formula (Ⅳ) monomer 3 of formula (Ⅴ) synthesized.

[0025] The blocking probe provided by the present invention has a polymer molecule with a specific structure connected to its 5'-end. The blocking probe targets the target region and binds to RNA to form a double-stranded composite structure. The polymer molecule improves the stability of the double-stranded composite structure through intermolecular forces such as hydrogen bonds and molecular entanglement, as well as the chimeric effect of the straight-chain functional groups in the polymer structure and the double-stranded composite structure in the molecular spatial structure. At the same time, it can effectively prevent reverse transcriptase from displacing the blocking probe under the action of strand displacement activity, improve the blocking effect of the blocking probe, reduce the library content of unwanted RNA in the RNA library, optimize the library quality, and improve the convenience and accuracy of RNA sequence information analysis.

[0026] The library construction kit for RNA library construction of the present invention adopts the blocking probe structure provided by the present invention. For unwanted RNAs such as ribosomal RNA and globulin RNA, they bind to the unwanted RNAs in an array spacing distribution manner to form a double helix structure, and achieve high-efficiency and high-specificity inhibition of unwanted RNAs such as ribosomal RNA and globulin RNA during the synthesis of the first-strand cDNA in RNA library construction, reducing or eliminating the participation of unwanted RNAs such as ribosomal RNA and globulin RNA in the subsequent library construction process and sequence information detection and analysis process, and reducing the interference of these unwanted RNAs on downstream sequencing or analysis.

[0027] Furthermore, during the preparation of the closed probe of the present invention, the main structure of the oligonucleotide chain can be synthesized by custom synthesis or self-synthesis according to conventional methods, and at the 3' end of the oligonucleotide main structure, raw materials with 3'OH modified to a non-extendable structure are used for synthesis at the 3' end during the synthesis process; the corresponding polymer is synthesized according to the polymer structure by custom synthesis or self-synthesis according to the polymerization methods known in the chemical field, and a molecular structure with click chemistry functional groups is connected to one side of the polymer, and is quickly and efficiently connected to the 5' end of the oligonucleotide chain main body by click chemical reaction, completing the synthesis and preparation of the overall structure of the closed probe. The process operation is simple and suitable for industrial popularization and application. Detailed Embodiments

[0028] Definition:

[0029] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention pertains.

[0030] The following further illustrates the present invention in conjunction with specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0031] Among them, the closed probes provided in the following examples and comparative examples have nucleotide sequences custom-synthesized by Sangon Biotech (Shanghai) Co., Ltd.; the compound monomer molecules used for synthesizing the polymer are custom-synthesized by Wuhu Huaren, specifically monomer 1:

[0032] Monomer 2: The initiator for connecting the polymer and the probe main structure:

[0033] Example 1

[0034] This example provides a closed probe structure for constructing an RNA library, and its overall molecular structure is:

[0035]

[0036] Among them, the nucleotide sequence probe specifically and complementarily binds to the target region to form a double helix structure, and the first 5 nucleotides near the 5' end are locked nucleic acids; its 5' end is covalently connected to a polymer molecule: Its number average molecular weight range is 4595.1 ± 5%, and the PD value is 1.2.

[0037] The specific operation steps of the preparation method of the closed probe provided in this example are as follows:

[0038] 1) Synthesize a nucleotide sequence probe according to the designed sequence structure, with an alkyne functional group modified at the 5'-end and the 3'-end OH modified to NH 2 C 6 ;

[0039] 2) Polymer and intermediate synthesis:

[0040] ① Weigh monomer 1 (1.41 mmol) and monomer 2 (1.41 mmol) into a 100 mL three-necked flask, add 14 mL of ultrapure water to dissolve them, and stir at room temperature; weigh the initiator (0.141 mmol), add it to the above three-necked flask, and bubble argon into the mixture under stirring at room temperature for 30 min, controlling at about 3 bubbles per second.

[0041] ② Take another 50 mL three-necked flask, add 2 mL of ultrapure water, and use a pipette to measure Me6TREN (0.0131 mmol)

[0042] into it, displace argon 4 times at room temperature, and place it under stirring at room temperature.

[0043] ③ Weigh CuBr (0.01787 mmol) and add it to the solution in step ②. After reacting for 1 min, displace argon 4 times and place it under stirring at room temperature.

[0044] ④ Quickly add the reaction solution with bubbling ended in step ① to the mixture in step ③. There are three-way valves with argon balloons inserted on both three-necked flasks to keep the system in an argon stream all the time. After stirring at room temperature for 4 h, the reaction ends.

[0045] ⑤ Under mechanical stirring, dropwise add the polymer solution into 300 mL of acetonitrile to crystallize out the polymer intermediate, and use a self-sealing bag to squeeze out the residual acetonitrile in the polymer intermediate, then redissolve the polymer intermediate in 40 mL of water.

[0046] ⑥ Aliquot the redissolved polymer intermediate solution into 50 mL centrifuge tubes, about 22.5 mL per tube, freeze at -80 °C, and use a freeze dryer for freeze drying to obtain a dry powder polymer intermediate product. Quality control detects that the molecular weight of the polymer intermediate is controlled at 4861.2 ± 5%;

[0047] 3) Reaction process of covalent connection between the polymer intermediate and the 5'-end of the probe through click chemistry

[0048] ① Dissolve the probe modified with an alkyne group at the 5'-end in an appropriate amount of ultrapure water, dilute it to 0.2 M with a 2 M TEAA solution at pH 7.0, and add it to a small-capacity reaction flask;

[0049] ② Add a DMSO solution of 1.5 equivalents of 10 mM polymer intermediate. After mixing evenly, add a 5 mM ascorbic acid solution, protect with nitrogen gas and seal.

[0050] ③ Add a DMSO solution of 10 mM Copper(II)-TBTA and react at room temperature for 24 hours under sufficient nitrogen protection.

[0051] ④ Purify the product by ethanol precipitation, wash it 3 times with acetone, remove the supernatant after centrifugation in a centrifuge to obtain the target product.

[0052] Example 2

[0053] This example provides a blocking probe structure for RNA library construction, and its overall molecular structure is:

[0054]

[0055] Other structures and preparation processes are the same as those in Example 1.

[0056] Comparative Example 1

[0057] This comparative example provides a blocking probe structure for RNA library construction. The difference in its overall molecular structure from that in Example 2 is that no polymer molecular structure is connected at the 5' end.

[0058] Comparative Example 2

[0059] This comparative example provides a blocking probe structure for RNA library construction. The difference in its overall molecular structure from that in Example 2 is that the molecular weight of the polymer molecular structure connected at the 5' end is 7524 ± 5%, and the molecular weight of the polymer molecular structure is controlled by the material input amount and reaction time during the synthesis process of the polymer and its intermediate.

[0060] Test Example:

[0061] Test method:

[0062] 1. Design the nucleotide sequence of the blocking probe:

[0063] According to the human 5.8S rRNA sequence, design a set of blocking probes targeting 5.8S rRNA. The number of probes in the set of blocking probes is 3, the nucleotide sequence length of each probe is 40 nt, and the binding regions of each probe do not overlap.

[0064] 2. Design a reverse transcription primer for 5.8S rRNA, and its nucleotide sequence is: AAGCGACGCTCAGACAGGCGTAG;

[0065] 18S rRNA reverse transcription primer with the nucleotide sequence: TACCGACGCTCAGACAGGCGTAG;

[0066] 2. Experimental grouping:

[0067] Four groups of parallel experiments were conducted:

[0068] In the first group, no blocking probe was used;

[0069] In the second group, the overall molecular structure of each blocking probe was the blocking probe structure provided in Example 2;

[0070] In the third group, the overall molecular structure of each blocking probe was the blocking probe structure provided in Comparative Example 1;

[0071] In the fourth group, the overall molecular structure of each blocking probe was the blocking probe structure provided in Comparative Example 2.

[0072] 3. Experimental procedure:

[0073] 1) Hybridization:

[0074] Universal Human Reference RNA (UHRR) (Agilent Technologies, 100 ng); 1 μM blocking probe 1 μL; 1 μM 5.8S rRNA reverse transcription primer 1 μL; 1 μM 18S rRNA reverse transcription primer 1 μL; 10 mM dNTPs mix 1 μL; quantified to 15 μL; after thermal cycling incubation, kept at 4°C;

[0075] 2) Reverse transcription reaction:

[0076] To the system in step 1), add 3 μL of reverse transcription buffer, 1 μL of RNase inhibitor, and 1 μL of reverse transcriptase, and incubate in a thermal cycler: 25°C for 10 minutes, 42°C for 30 minutes, kept at 4°C;

[0077] 3) Purification:

[0078] Add 80 μL of water and 130 μL of QIAseq beads to the system in step 2). Wash the bound cDNA twice with 200 μL of 80% ethanol (EtOH). Dry and elute with 20 μL of water;

[0079] 4) QPCR quantification:

[0080] To the cDNA sample purified in step 3), add the multiplex QPCR Mix buffer and the quantitative primers targeting 5.8S rRNA. The forward primer is: CTCTTAGCGGTGGATCACTCG; the reverse primer is: GCAAGTGCGTTCGAAGTGTC;

[0081] The quantitative primers targeting 18S rRNA. The forward primer is: GTTTTCGGAACTGAGGCCATG; the reverse primer is: TCGGAACTACGACGGTATCTG;

[0082] Incubate in a thermal cycler: 95°C for 9 minutes, 98°C for 1 minute, 40 cycles (98°C for 15 seconds, 60°C for 1.5 minutes), and quantify the cDNA concentration synthesized using 5.8S rRNA as a template and the cDNA concentration synthesized using 18S rRNA as a template.

[0083] 4. Performance evaluation:

[0084] Based on the detection result of the quantitative concentration of 5.8S rRNA in the first group without adding the blocking probe as the base concentration, and the detection results of other groups as the experimental group concentrations, calculate the blocking efficiency of the added blocking probe on 5.8S rRNA for other groups = (base concentration - experimental group concentration) / base concentration * 100%. The results are shown in Table 1 below:

[0085] Table 1

[0086] Grouping Example 2 Comparative Example 1 Comparative Example 2 Sealing efficiency (%) 98.78％ 78.09％ 97.78％

[0087] Based on the detection result of the quantitative concentration of 18S rRNA in the first group without adding the blocking probe as the base concentration, and the detection results of other groups as the experimental group concentrations, calculate the non-specific blocking efficiency of the added blocking probe on 18S rRNA for other groups = (base concentration - experimental group concentration) / base concentration * 100%. The results are shown in Table 2 below:

[0088] Table 2

[0089]

[0090]

[0091] The above experimental results show that the present invention improves the blocking effect on the target target region by connecting a specific polymer molecular structure to the 5' end of the blocking probe. Further, by optimizing the polymer molecular weight, the non-specific blocking of other non-target target regions is reduced, and the application effect of the blocking probe in RNA library construction is improved.

[0092] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A blocking probe for RNA library construction, characterized in that, the blocking probe is complementary paired and bound to the target region of the unwanted RNA; wherein the 3'-end of the blocking probe contains a modified structure to prevent the extension of the blocking probe; the 5'-end of the blocking probe is covalently linked to a polymer; the overall structure of the blocking probe is shown in the following formula (Ⅰ-1): Wherein A is a modification structure for preventing the extension of the closed probe; The preparation method includes first synthesizing the intermediate of formula (II-1) (II-1), and then connecting the intermediate to the 5'-end of the blocking probe through a click chemical reaction; Among them, the intermediate of formula (II-1) is composed of monomer 1 of formula (III) monomer 2 of formula (IV) monomer 3 of formula (V) synthesized, where monomer 3 is used as an initiator; wherein the molar mass ratio of monomer 1, monomer 2 and monomer 3 is 10:10:1; the number-average molecular weight range of the intermediate product of formula (Ⅱ-1) is 4861.2 ± 5%, and the PD value is 1.

2.

2. The blocking probe for RNA library construction according to claim 1, characterized in that, The modification structure at the 3'-end is -NH 2 C 6 .

3. The blocking probe for RNA library construction according to claim 2, characterized in that, the modified structure at the 3'-end further includes a dihydrocyclopyrrole tripeptide.

4. The blocking probe for RNA library construction according to claim 3, characterized in that, the nucleotide chain length of the blocking probe is 30 - 60 nt; the melting temperature Tm of the duplex formed between the blocking probe and the target RNA region is ≥ 80 °C.

5. The blocking probe for RNA library construction according to claim 4, characterized in that, the melting temperature Tm of the duplex formed between the blocking probe and the target RNA region is ≥ 90 °C.

6. The blocking probe for RNA library construction according to claim 5, characterized in that, the nucleotide chain of the blocking probe includes locked nucleic acid.

7. The blocking probe for RNA library construction according to claim 6, characterized in that, the number of locked nucleic acids contained in the nucleotide chain of the blocking probe is 5 - 7.

8. The blocking probe for RNA library construction according to claim 7, characterized in that, the position of the locked nucleic acid contained in the nucleotide chain of the blocking probe is close to the 5'-end of the blocking probe.

9. A library construction kit for RNA library construction, characterized in that, it includes a plurality of blocking probes according to any one of claims 1 - 8, random primers, reverse transcriptase and reaction buffer; wherein the plurality of blocking probes can achieve that at least 1 / 6 of the full length of the unwanted RNA is covered with blocking probes, and the spacing distance between adjacent blocking probes does not exceed 100 nt.

10. The library construction kit for RNA library construction according to claim 9, characterized in that, the spacing distance between adjacent blocking probes does not exceed 30 nt; the nucleotide sequence length of the blocking probe is 25 - 45 nt.

11. The library construction kit for RNA library construction according to claim 10, characterized in that, the nucleotide sequence length of the blocking probe is 40 nt.

Images