An SNP molecular marker related to the IREB2 gene and its application

The diagnostic kit designed by the IREB2 gene-related SNP molecular markers and its primer pairs solves the problem of high cost and long cycle of whole exon sequencing, and achieves rapid and low-cost identification of NDCAMA patients, providing an important research basis.

CN117417999BActive Publication Date: 2025-07-25PEOPLES HOSPITAL OF HENAN PROV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311592625.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-27
Publication Date
2025-07-25
Estimated Expiration
2043-11-27

AI Technical Summary

Technical Problem

In the prior art, whole exon sequencing and whole genome sequencing are costly and long-term for NDCAMA diagnosis, making it difficult to quickly and at low cost to distinguish patients, carriers and normal people.

Method used

SNP molecular markers and primer pairs associated with the IREB2 gene are provided for designing diagnostic kits to rapidly identify NDCAMA patients through PCR amplification, including the first molecular marker (SEQ ID NO.1, 74 bp A/G mutation) and the second molecular marker (SEQ ID NO.2, 102 bp A/T mutation) and the detection is carried out in combination with PCR amplification reaction reagent.

Benefits of technology

It has achieved rapid and accurate distinction between NDCAMA patients, carriers and normal people, reduced diagnostic costs, and provided a theoretical basis for the study of the pathogenesis of NDCAMA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117417999B_ABST
    Figure CN117417999B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biological genetic engineering, and particularly to an SNP molecular marker related to the IREB2 gene and its application. The present invention provides an SNP molecular marker related to the IREB2 gene, and the molecular marker includes a first molecular marker and a second molecular marker; the nucleotide sequence of the first molecular marker is as shown in SEQ ID NO.1, and there is an A / G mutation at the 74th bp of this sequence; the nucleotide sequence of the second molecular marker is as shown in SEQ ID NO.2, and there is an A / T mutation at the 102nd bp of this sequence. The SNP molecular marker of the present invention can accurately distinguish NDCAMA patients, carriers and normal people, and the time required for the identification result is short and the price is low.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological genetic engineering, and particularly relates to an SNP molecular marker related to the IREB2 gene and its application. Background Art

[0002] Early-onset neurodegenerative changes with choreoathetosis and microcytic anemia (NDCAMA, OMIM number 618451) is an autosomal recessive genetic disease, and its clinical manifestations mainly include severe neurodegenerative changes, epilepsy, hearing impairment, language impairment, movement disorders, and iron deficiency anemia, etc. NDCAMA patients are normal at birth, and as they grow older, the clinical manifestations worsen. The clinical manifestations of NDCAMA are similar to those of intellectual disability, developmental delay, and genetic metabolic diseases, resulting in an increased risk of missed diagnosis and misdiagnosis in the clinical diagnosis of NDCAMA patients. Based on the application of whole exome sequencing technology in the diagnosis of genetic diseases, scientists have found that mutations in the iron-responsive element-binding protein 2 (IREB2) gene are the main cause of NDCAMA. Therefore, whole exome sequencing is the main method for NDCAMA diagnosis. Since whole exome sequencing and whole genome sequencing are relatively expensive and have a long analysis cycle, there is an urgent need to establish a screening method that is inexpensive, has a short analysis cycle, and can accurately distinguish NDCAMA patients, carriers, and normal people. Summary of the Invention

[0003] The purpose of the present invention is to provide an SNP molecular marker related to the IREB2 gene and its application to solve the problems existing in the above-mentioned prior art. The SNP molecular marker of the present invention can accurately distinguish NDCAMA patients, carriers, and normal people, and the time required for the identification result is short and the price is low.

[0004] To achieve the above purpose, the present invention provides the following solutions:

[0005] The present invention provides an SNP molecular marker related to the IREB2 gene, and the molecular marker includes a first molecular marker and a second molecular marker; the nucleotide sequence of the first molecular marker is as shown in SEQ ID NO.1, and there is an A / G mutation at the 74th bp of this sequence; the nucleotide sequence of the second molecular marker is as shown in SEQ ID NO.2, and there is an A / T mutation at the 102nd bp of this sequence.

[0006] The present invention provides a primer pair for amplifying the above SNP molecular marker, and the primer pair includes a primer pair for amplifying the first molecular marker and a primer pair for amplifying the second molecular marker;

[0007] The primer pair for amplifying the first molecular marker includes an upstream primer with a nucleotide sequence shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence shown in SEQ ID NO.4;

[0008] The primer pair for amplifying the second molecular marker includes an upstream primer with a nucleotide sequence shown in SEQ ID NO.5 and a downstream primer with a nucleotide sequence shown in SEQ ID NO.6.

[0009] The present invention provides the application of the above primer pair in the preparation of a reagent for diagnosing or predicting early-onset neurodegenerative changes associated with chorea-acanthocytosis and microcytic anemia.

[0010] The present invention provides a reagent for diagnosing or predicting early-onset neurodegenerative changes associated with chorea-acanthocytosis and microcytic anemia, and the reagent includes the above primer pair.

[0011] The present invention provides the application of the above primer pair in the preparation of a kit for diagnosing or predicting early-onset neurodegenerative changes associated with chorea-acanthocytosis and microcytic anemia.

[0012] The present invention provides a kit for diagnosing or predicting early-onset neurodegenerative changes associated with chorea-acanthocytosis and microcytic anemia, including the above primer pair.

[0013] Preferably, the kit further includes PCR amplification reaction reagents.

[0014] Preferably, the PCR amplification reaction reagents include 2×Master Mix and ddH2O.

[0015] Preferably, the concentration of each primer in the primer pair is 10 μM.

[0016] Preferably, the test sample of the kit is blood or amniotic fluid;

[0017] The blood includes venous blood or cord blood.

[0018] The present invention discloses the following technical effects:

[0019] The present invention provides an SNP molecular marker related to the IREB2 gene. The molecular marker includes a first molecular marker and a second molecular marker. The nucleotide sequence of the first molecular marker is as shown in SEQ ID NO.1, and there is an A / G mutation at the 74th bp of this sequence. The nucleotide sequence of the second molecular marker is as shown in SEQ ID NO.2, and there is an A / T mutation at the 102nd bp of this sequence. The SNP molecular marker of the present invention can be used to quickly and effectively diagnose NDCAMA, and can accurately distinguish NDCAMA patients, carriers and normal people. In addition, the present invention lays an important foundation for the study of the pathogenesis of NDCAMA and provides a new theoretical basis for the treatment of NDCAMA patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0021] Figure 1 It is a pedigree chart (A) and the brain MRI result chart of II-2 (B);

[0022] Figure 2 It is the prediction chart of different missense mutation functions of the prediction software. Among them, A is the prediction result of different missense mutation functions of the prediction software, B is the picture of the influence on the stability and structure of the protein, and C and D are the conservation prediction results;

[0023] Figure 3 It is the influence of the SNP site on the function of the IREB2 protein. Among them, A is the schematic diagram of the overexpression vector, B is the transfection situation (left side) and sequencing situation (right side) under fluorescence, C is the western blot result chart, and D is the relative protein expression levels of different proteins;

[0024] Figure 4 It is the PCR result of the primer pair (A) and the genotype results of the SNP1 site and SNP2 site of the father, mother and proband. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0025] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.

[0026] It should be understood that the terms used in this invention are only for describing specific embodiments and are not intended to limit the invention. Additionally, for the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in this invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0028] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the specification of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of this invention are obvious to those skilled in the art. The specification and examples of this invention are merely exemplary.

[0029] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0030] Example 1 Discovery of Clinical Cases

[0031] A reanalysis of whole-exome data and Sanger sequencing verification were performed on 1350 genetic disease families, including 68 families with a history of intellectual disability / developmental delay. As a result, two SNP loci were found, denoted as SNP1 locus and SNP2 locus respectively. The specific information of SNP1 locus and SNP2 locus is shown in Table 1. Among the 1350 genetic disease families, there were 2 families carrying only the SNP1 locus; 7 families carrying only the SNP2 locus; and 1 family carrying both the SNP1 locus and the SNP2 locus. In the family carrying both the SNP1 locus and the SNP2 locus, the father was a carrier of the SNP2 locus and the mother was a carrier of the SNP1 locus. Subsequently, this family was studied.

[0032] Table 1 Specific Information of SNP1 and SNP2

[0033] SNP locus Genomic location Exon Reference transcript Base change Mutation type SNP1 chr15:78768617 Exon9 NM_004136.4 c.1111A>G Missense SNP2 chr15:78786488 Exon20 NM_004136.4 c.2477A>T Missense

[0034] Note: The reference genome is Human GRCh37 / hg19, and the genomic location of IREB2 is chr15:78,730,518 - 78,793,798.

[0035] The specific information of the family carrying both SNP1 and SNP2 sites is as shown in Figure 1 A in the figure. Among them, I-1 is the father; I-2 is the mother; II-1 is the first child, a girl; II-2 is the second child, a boy; II-3 is the third child, a boy; II-1 died prematurely; II-2 is the proband; II-3 is healthy. In this family, II-1 showed delayed growth and development at an early stage, was diagnosed with "infantile spasm", and died of renal failure at 6 months of age. And II-2 showed symptoms such as epilepsy, language disorder, mental retardation, leukodystrophy, and small corpus callosum during the growth and development process, which are in line with the clinical manifestations of DNCAMA. At the same time, brain MRI, clinical manifestations, and blood routine of II-2 were investigated. The results of brain MRI are as shown in Figure 1 B in the figure, and the clinical manifestations and blood routine test results are shown in Table 2. Among them, the clinical manifestations were obtained through genetic diagnosis and related tests.

[0036] As can be seen from Figure 1 B in the figure, II-2 had brain volume loss, ventricular enlargement, delayed myelination, and reduced white matter volume.

[0037] Table 2 Clinical manifestations and blood routine test results of II-2

[0038]

[0039] Note: "+" represents mild, "++" represents moderate, and "+++" represents severe.

[0040] As can be seen from Table 2, the clinical manifestations of II-2 were moderate language disorder, severe spasm and muscle rigidity, mild epilepsy, moderate plagiocephaly, mild special facial features, inability to walk independently (motor disorder), and there were also disorders in cognition and learning; in addition, the blood routine results indicated microcytic anemia. Therefore, the second child, a boy, was determined to be a NDCAMA patient.

[0041] 2. Exome sequencing

[0042] After signing the informed consent form, peripheral blood of II-2 in the family was collected as a research sample for whole-exome sequencing. The results showed that II-2 contained two missense variant sites of IREB2. According to the guidelines of the American College of Medical Genetics and Genomics (ACMG), the pathogenicity of these two variant sites was evaluated: the result was likely pathogenic. The IREB2 gene variant is the main cause of NDCAMA. Therefore, a preliminary conclusion was drawn that II-2 carried compound heterozygosity of two missense variant sites of IREB2 (SNP sites: SNP1 site and SNP2 site), resulting in NDCAMA. The specific information of the two missense variant sites is shown in Table 3.

[0043] Table 3 Specific information of the two missense variant sites

[0044]

[0045]

[0046] 3. Evaluation of candidate pathogenic sites (SNP sites)

[0047] The pathogenicity of these two SNP sites was evaluated by five different missense mutation function prediction software, namely Missense 3D (http: / / missense3d.bc.ic.ac.uk / missense3d), MutationTaster (https: / / www.genecascade.org / MutationTaster2021), PolyPhen-2 (http: / / genetics.bwh.harvard.edu / pph2), VarSite (https: / / www.ebi.ac.uk / thornton-srv / databases / cgi-bin / VarSite), and DUET (https: / / biosig.lab.uq.edu.au / duet / stability). The results showed that the two SNP sites had an impact on the amino acid sequence and were shown to be pathogenic or likely pathogenic sites ( Figure 2 in A).

[0048] The changes in protein stability and higher-order structure caused by the amino acid sequence changes induced by the two SNP sites were predicted: the prediction results are shown in Table 4 and Figure 2 in B. SNP1 led to an amino acid change of P.I371V, causing a decrease in protein stability, while SNP2 led to an amino acid change of P.D826V, causing a change in the higher-order structure of the protein.

[0049] Table 4 Prediction Results

[0050] SNP locus Base change Amino acid change Mutation type SNP1 c.1111A>G I371V Missense SNP2 c.2477A>T D826V Missense

[0051] Meanwhile, the amino acid conservation of these two mutation sites was verified, and it was found that the amino acid sequences at these two sites were highly conserved among different mammals ( Figure 2 C-D in ).

[0052] 4. Effects of SNP Sites on the Function of IREB2 Protein

[0053] IREB2 protein binds to the stem-loop structure of the 5’UTR of iron metabolism-related gene mRNAs such as FTH to regulate the translation and degradation of FTH, etc. When the expression of IREB2 increases, it will cause the degradation of FTH mRNA, thereby resulting in a decrease in the expression of FTH.

[0054] To further clarify the effects of SNP1 site and SNP2 site on the function of IREB2 protein, we used the lentiviral overexpression vector pCDH-CMV-MCS-EF1-copGFP-T2A-puro( Figure 3 A in ) to construct overexpression plasmids of wild type, SNP1 and SNP2 mutants respectively. Through lentiviral packaging, the lentiviruses of the empty vector group (the empty vector is pCDH-CMV-MCS-EF1-copGFP-T2A-puro), wild type WT group, SNP1 group and SNP2 group were respectively used to infect the human neuroblastoma cell line - SH-SY5Y.

[0055] After infection, screening was carried out with 2 μg / ml puromycin. After screening, it was divided into the empty vector group (Blank), the wild type group overexpressing SH-SY5Y cell line (WT), the SNP1 group overexpressing SH-SY5Y cell line (A1111G) and the SNP2 group overexpressing SH-SY5Y cell line (A2477T). Observation under fluorescence showed a high transfection rate( Figure 3 the left side of B in ); sequencing of each group of cells was carried out, and the sequencing results were shown as B in Table 3, indicating that the construction of the SNP site overexpression vector was successful( Figure 3 the right side of B in ); and the expression of IREB2 and the regulation of the downstream iron metabolism-related protein FTH were detected by western blot, and the results were as Figure 3As shown in C in [reference], compared with the wild-type overexpression group, A2477TT significantly induced the protein degradation of IREB2, suggesting that A2477T led to a decrease in the protein stability of IREB2 and caused the protein degradation of IREB2; although A1111G did not cause the protein degradation of IREB2, it increased the expression of the downstream negative regulatory protein FTH of IREB2, suggesting that A1111G mainly affected the binding of IREB2 to the mRNA of FTH and thus affected the function of IREB2. Generally speaking: A1111G directly affected the binding of IREB2 to the mRNA of downstream target genes, while A2477T caused the protein degradation of IREB2, thereby affecting the expression of downstream target gene mRNA. The two SNP sites had a certain impact on the protein function of IREB2, and the mutations of the two SNPs would lead to the occurrence of NDCAMA.

[0056] Example 2 Development of the kit

[0057] 1. Primer design

[0058] Based on the 2 newly discovered pathogenic SNP sites of IREB2 (SNP1 site and SNP2 site) by our research group, primers were designed, and the specific information of the primers is shown in Table 4.

[0059] Table 4 Specific information of upstream and downstream primers

[0060]

[0061] 2. Kit, amplification system and amplification conditions developed based on the SNP site

[0062] A kit for diagnosing or predicting early-onset neurodegenerative changes associated with choreoathetosis and microcytic anemia, the kit includes upstream and downstream primers for SNP1 or SNP2, 2×Master Mix (CWbio) and ddH2O; the specific information of the upstream and downstream primers is shown in Table 4.

[0063] The amplification system is: 400 ng genomic DNA, 0.5 μL upstream primer (concentration 10 μM), 0.5 μL downstream primer (concentration 10 μM), 10 μL 2×Master Mix (CWbio), and the remaining is supplemented with ddH2O to 20 μL.

[0064] The amplification conditions are: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, full extension at 72 °C for 5 min, and 35 cycles of denaturation-extension are set.

[0065] Prepare 1.5% agarose gel, take 3 μL of the PCR product and run DNA gel electrophoresis, and detect the DNA sequence of the PCR product by Sanger sequencing.

[0066] The diagnostic criteria are shown in Table 5:

[0067] Table 5 Diagnostic Results

[0068] SNP locus Diagnostic result No mutation in both SNP1 and SNP2 Normal person Carrying any one of the heterozygous mutations of SNP1 and SNP2 Carrier Any one of the homozygous mutations of SNP1 and SNP2 DNCAMA patient Carrying the compound heterozygous mutations of SNP1 and SNP2 simultaneously DNCAMA patient

[0069] Example 3

[0070] After signing the informed consent form, peripheral blood of I-1, I-2, and II-2 in the pedigree was collected, and the kit for diagnosing or predicting early-onset neurodegenerative changes with choreoathetosis and microcytic anemia in Example 2 was used for detection. The amplification system was: 400 ng of whole blood genomic DNA, 0.5 μL of upstream primer (concentration 10 μM), 0.5 μL of downstream primer (concentration 10 μM), 10 μL of 2× Master Mix (CWbio), and the rest was supplemented with ddH2O to 20 μL; the amplification conditions were: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, full extension at 72 °C for 5 min, and 35 cycles were set for denaturation-extension. Prepare 1.5% agarose gel, take 3 μL of the PCR product to run DNA gel electrophoresis, and detect the DNA sequence of the PCR product by Sanger sequencing. At the same time, Sanger sequencing was used for verification, and the results are as Figure 4 shown. It can be seen that by agarose gel electrophoresis detection, the size of the PCR product containing the SNP1 site is close to 128 bp, and the size of the PCR product containing the SNP2 site is close to 221 bp, which meets the expectations ( Figure 4 in A), and the amplified product sequence containing the SNP1 site is shown in SEQ ID NO.1, specifically: AGGAGTGGCTGGAAAGTTTGTTGAGTTTTTTGGAAGTGGAGTTTCACAATTATCTATAGTTGATCGAACTACA A TAGCAAACATGTGTCCGGAATATGGTGCTATCCTCAGCTTTTTCCCTGTTGACA, and the amplified product sequence containing the SNP2 site is shown in SEQ ID NO.2, specifically: TCAGGACAGACGGTGAGAATGCAAACAAAGTATTTAGACAATTTATAACTGGATCAAAATTTGTATTAAAAAATTTTGTGTTTGTTTTAATCTACAGCTAG ATGTATTTGAGGCTGCAGAGCTGTACCAGAAAGAAGGTATCCCACTGATTATTTTAGCAGGAAAGAAATATGGTTCAGGAAACTCCAGAGACTGGGCTGCCAAAGGACCGTATTTACTGG, where the bold and underlined part is the mutation site.

[0071] As can be seen from B in Figure 4 I-1 is a heterozygous mutation at the SNP2 locus and is a carrier; I-2 is a heterozygous mutation at the SNP1 locus and is a carrier, and II-2 is a compound heterozygous mutation of SNP1 and SNP2 and is a DNCAMA patient.

[0072] Example 4

[0073] After signing the informed consent form, the family carrying both SNP1 and SNP2 was tested during the third pregnancy using the kit for diagnosing or predicting early-onset neurodegenerative changes with choreoathetosis and microcytic anemia in Example 2. Specifically, amniotic fluid was collected as a sample and tested using the kit for diagnosing or predicting early-onset neurodegenerative changes with choreoathetosis and microcytic anemia in Example 2. The amplification system was: 400 ng of amniotic fluid cell genomic DNA, 0.5 μL of upstream primer (concentration 10 μM), 0.5 μL of downstream primer (concentration 10 μM), 10 μL of 2× Master Mix (CWbio), and the remaining was supplemented with ddH2O to 20 μL; the amplification conditions were: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, full extension at 72 °C for 5 min, with 35 cycles of denaturation-extension. Prepare a 1.5% agarose gel, take 3 μL of the PCR product to run DNA gel electrophoresis, and detect the DNA sequence of the PCR product by Sanger sequencing. At the same time, Sanger sequencing was used for verification. The results showed that SNP1 was wild type and SNP2 was a compound heterozygous mutation: the fetus was a heterozygous mutation at the SNP1 locus and was a carrier. Currently, the third-born boy is developing well and has not shown clinical manifestations related to DNCAMA.

[0074] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. A SNP molecular marker related to the IREB2 gene, characterized in that, The molecular markers include a first molecular marker and a second molecular marker; the nucleotide sequence of the first molecular marker is as shown in SEQ ID NO.1, and there is an A / G mutation at the 74th bp of this sequence; the nucleotide sequence of the second molecular marker is as shown in SEQ ID NO.2, and there is an A / T mutation at the 102nd bp of this sequence.

2. Use of a primer pair for amplifying the SNP molecular marker described in claim 1 in the preparation of a reagent for diagnosing or predicting early-onset neurodegenerative changes with choreoathetosis and microcytic anemia, characterized in that, The primer pair includes a primer pair for amplifying the first molecular marker and a primer pair for amplifying the second molecular marker; The primer pair for amplifying the first molecular marker includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4; The primer pair for amplifying the second molecular marker includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

6.

3. Use of the primer pair for amplifying the SNP molecular marker described in claim 1 in the preparation of a kit for diagnosing or predicting early-onset neurodegenerative changes with choreoathetosis and microcytic anemia, characterized in that, The primer pair includes a primer pair for amplifying the first molecular marker and a primer pair for amplifying the second molecular marker; The primer pair for amplifying the first molecular marker includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4; The primer pair for amplifying the second molecular marker includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.6.