Primer probe set for detecting yellowish Neisseria and kit and application thereof

Abstract

The present invention provides a primer probe set for detecting yellowish Neisseria, a kit and an application thereof, and belongs to the field of gene detection technology. The present invention designs a pair of yellowish Neisseria-specific amplification products and a probe, which can quickly and accurately identify saliva stains. The primer probe set for detecting yellowish Neisseria provided by the present invention has high specificity for saliva stain samples, and the accuracy rate in body fluid identification can reach 100%. The primer probe set provided by the present invention has high detection sensitivity, and can be detected in samples as low as 0.625 copies / μL. The kit for detecting yellowish Neisseria provided by the present invention can detect in samples stored for 10 days, with a detection rate of 100%, and can partially detect in samples stored for more than 3 years, with a detection rate of 20%, which is of great significance in actual forensic identification work. The detection process does not require an amplifier, an electrophoresis instrument and a quantitative PCR instrument, and can be used for rapid testing at the forensic site.

Description

Technical Field

[0001] The invention relates to the technical field of gene detection, in particular to a primer probe set for detecting yellowish Neisseria, a kit and an application thereof. Background Art

[0002] The identification of unknown body fluid samples helps to characterize the case and further identify suspects. Currently, there are many methods for forensic evidence identification of body fluid stains, mainly traditional identification methods based on enzymatic reactions or immunological detection and identification methods based on molecular markers such as RNA and DNA methylation.

[0003] However, traditional identification methods require a large amount of sample, are time-consuming and labor-intensive, and have poor specificity and sensitivity. Although identification methods based on molecular markers have high specificity and sensitivity, they require large instruments for amplification and detection and are not suitable for rapid on-site testing.

[0004] For RNA-based identification methods, conventional RNA has a short half-life and a fast degradation rate, making it difficult to apply to forensic degradation samples. Non-coding RNA, such as miRNA and circRNA, has the characteristics of long-term existence and differential expression in different body fluids. Some miRNA and circRNA even show specific existence in certain body fluids, and body fluid identification is often based on this in the prior art. However, the species specificity of miRNA is poor, and human miRNA can be interfered with by environmental bacteria or other species. At the same time, the repeatability of miRNA is not strong, and there are differences in the test results of the same sample even in different laboratories or different environments. Therefore, there is currently a lack of unified detection markers and detection standards for body fluid identification using RNA, which is not conducive to accurate identification.

[0005] For identification methods based on DNA methylation markers, the method of achieving body fluid identification requires not only bisulfite conversion of the extracted DNA, but also electrophoresis detection on a capillary electrophoresis platform. The required instruments are expensive and need to be operated in a relatively stable experimental environment. However, it is often difficult to carry large instruments during forensic practice and on-site investigations, and the biological samples on site are often low in content and have quality deviations, resulting in the sample identification process often delaying the progress of on-site investigations.

[0006] Some spectral detection methods are also disclosed in the prior art. However, conventional spectral detection methods such as Fourier infrared spectroscopy and Raman spectroscopy have special requirements for the background color of solid samples. Since forensic samples often come from complex environments, a piece of suspicious sample often contains many other components, which greatly affects the spectral characteristics of the sample itself. Although the hyperspectral imaging technology based on laser technology solves the requirements for the background color of the sample, the detection instrument is too specialized and difficult to popularize. At the same time, it is still difficult to distinguish samples from complex environments.

[0007] Chinese patent CN113881787A discloses the application of changes in the structure of microbial communities in saliva stains in predicting the residual time of saliva stains. It uses 16S amplicon sequencing technology to characterize the changes in the structure of microbial communities in saliva stains with residual time, and uses a machine learning (random forest) model to establish a saliva stain residual time prediction method, providing a theoretical basis and technical support for rapid investigation of cases, in-depth discovery of biological evidence information involved in the case, enhancing the value of evidence, and improving forensic DNA case-handling capabilities.

[0008] The prior art still lacks reagents that can effectively and quickly identify saliva stains. Summary of the invention

[0009] The purpose of the present invention is to provide a primer probe set for detecting yellowish Neisseria and a kit and application thereof, which can quickly and accurately identify saliva stains.

[0010] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0011] The present invention provides a primer probe set for detecting yellowish Neisseria, comprising an amplification primer pair and a probe;

[0012] In the amplification primer pair, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.2;

[0013] The nucleotide sequence of the probe is shown in SEQ ID NO.3.

[0014] Preferably, the 33rd base of the probe, counted from the 5' end of the probe sequence, is dSpacer modified.

[0015] Preferably, the 5' end of the downstream primer is labeled with biotin.

[0016] Preferably, the 5' end of the probe is labeled with a reporter group;

[0017] And / or, the 3' end of the probe is labeled with an amine group, a phosphate group or a C3 spacer.

[0018] Preferably, the reporter group is selected from one or more of FAM, VIC, ROX, HEX, TET, JOE, NED, Cy5, and Cy3.

[0019] The present invention also provides the use of the primer probe group for detecting yellowish Neisseria in preparing a kit or reagent for detecting yellowish Neisseria.

[0020] The present invention also provides a kit for detecting yellowish Neisseria, comprising a detection reagent, a nucleic acid colloidal gold test strip and the primer probe group for detecting yellowish Neisseria.

[0021] Preferably, the final concentration of the amplification primer pair in the kit is 0.2-0.6 μmol / L.

[0022] Preferably, the final concentration of the probe in the kit is 0.1-0.2 μmol / L.

[0023] The present invention also provides the use of the primer probe set or the kit in preparing a saliva stain identification reagent.

[0024] Beneficial effects of the present invention:

[0025] The primer probe set for detecting yellowish Neisseria provided by the present invention has high specificity for saliva stain samples, and the accuracy rate in body fluid identification can reach 100%. In addition, the primer probe set provided by the present invention has high detection sensitivity, and can realize detection in samples as low as 0.625 copies / μL.

[0026] The kit for detecting yellowish Neisseria provided by the present invention can detect some samples stored for 3-4 years, with a detection rate of 60%, which is of great significance in actual forensic identification work. The detection process does not require an amplification instrument, an electrophoresis instrument, and a quantitative PCR instrument, and can be used for rapid testing at the forensic scene. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Figure 2 is the test result under different DNA concentration conditions;

[0028] Figure 2 Figure 1 is a graph showing the test results of body fluids from different sources;

[0029] Figure 3 The test results of fresh samples after different storage time;

[0030] Figure 4 The test results of samples with different storage years;

[0031] Figure 5 The results are real-time fluorescence quantitative detection. DETAILED DESCRIPTION

[0032] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] Example 1 Primer and probe design

[0034] The primer probe set for detecting yellowish Neisseria was designed and synthesized, and the nucleotide sequence is as follows:

[0035] Upstream primer F: CCTGTCAACCGCAACGTCATCGACAATGGTCTCAA, as shown in SEQ ID NO.1;

[0036] Downstream primer R: Biotin-GCGCTGGAAGGATCGGCAAGCTCGTCTG, as shown in SEQ ID NO.2.

[0037] P: FAM-ACTACATCGGCGGCAACTGTACCGTTTCCCTGA[THF]TGC TGATGGCTTTGG-C3spacer, as shown in SEQ ID NO. 3, starting from the 5' end of the probe sequence, the 33rd base is modified with dSpacer (tetrahydrofuran, THF).

[0038] Example 2 Sample Detection

[0039] Extracting DNA from samples: Using PureLink TM The Genomic DNA Mini Kit is used to extract bacterial genomic DNA from suspicious stains. The specific steps are as follows:

[0040] 1. Sample preparation:

[0041] Cut the suspected body fluid sample into pieces and place it in a sterile 2mL microcentrifuge tube. Add 400μL PBS buffer to the sample; add 20μL Proteinase K to the sterile centrifuge tube and mix well by pipetting; add an equal volume of Genomic Lysis / Binding Buffer was added and mixed thoroughly by brief vortexing and incubated at 55°C for 10 min. Brief centrifugation was performed to collect any lysate in the cap of the centrifuge tube. 200 μL of 98% ethanol was added to the tube and mixed thoroughly by vortexing for 5 s to obtain a homogenous solution.

[0042] 2. Binding to DNA

[0043] 1) Take out Spin Column;

[0044] 2) Transfer all liquid obtained from sample preparation to Spin Column;

[0045] 3) Centrifuge at 10,000 × g for 1 min at room temperature;

[0046] 4) Discard the collection tube and place the spin column in the clean Collection Tube.

[0047] 3. DNA Cleaning

[0048] 1) Add 500 μL of Wash Buffer 1 prepared with ethanol to the centrifuge column;

[0049] 2) Centrifuge at 10,000 × g for 1 min at room temperature;

[0050] 3) Discard the lower collection tube and place the spin column in the clean collectiontube collection tube;

[0051] 4) Add 500 μL of Wash Buffer 2 prepared with ethanol to the column;

[0052] 5) Centrifuge at 13300 rpm for 3 min at room temperature;

[0053] 4. DNA Elution

[0054] 1) Place the spin column in a sterile 1.5 mL centrifuge tube;

[0055] 2) Add 60 μL to the column Genomic Elution Buffer;

[0056] 3) Incubate at room temperature for 1 min. Then centrifuge at 13300 rpm for 1 min at room temperature;

[0057] Purified genomic DNA is obtained in a test tube.

[0058] Isothermal PCR amplification and detection:

[0059] use nfo-DNA constant temperature rapid amplification kit (colloidal gold test strip type) was used to amplify the extracted DNA samples. Disposable nucleic acid test strips | Nucleic acid colloidal gold test strips (single label) are used to interpret the amplification results.

[0060] Take out the required components of the kit 30 minutes in advance, melt at room temperature, and shake to mix.

[0061] 1). Add 29.4 μL A buffer to each dry powder reaction tube;

[0062] 2). Add 2 μL upstream primer, 2 μL downstream primer and 0.6 μL probe to each reaction tube (primer and probe concentration is 10 μM, primers are yellow Neisseria specific amplification primers and fluorescent probe / antigen primers);

[0063] 3). Add 3.5 μL ddH2O and 10 μL nucleic acid template to the reaction tube in sequence (the volume of nucleic acid template added can be adjusted according to the nucleic acid concentration, and the volume of ddH2O added can be adjusted accordingly, so that the total volume of template and ddH2O is 13.5 μL);

[0064] 4). Finally, add 2.5 μL B Buffer to the reaction tube and mix thoroughly (for multiple reactions, it is recommended to add B Buffer to the inside of the lid of the reaction tube and invert the reaction tube 8-10 times to mix thoroughly);

[0065] 5). After mixing, shake (or quickly centrifuge) the reaction solution to the bottom of the tube, and then incubate the reaction tube at 37°C for 20 minutes;

[0066] 6). After the reaction is completed, take 10μL of the reaction mixture and add it to a centrifuge tube containing 140μL of loading buffer. After mixing evenly, take 100μL of the diluted product and drop it into the colloidal gold card spotting hole. Wait for 3-5 minutes, observe the quality control line and the test line to read the results. If the quality control line and the test line are both positive, the test sample is a saliva sample. If the quality control line is positive and the test line is negative, the test sample is not a saliva sample. If the quality control line is negative, the test result is unreliable.

[0067] The above method was used to perform sensitivity testing, and the sample used was a yellowish Neisseria standard. The results were as follows: Figure 1 As shown, Figure 1 Each column is two replicates of the same group, with a total of 7 groups of results. From left to right, the DNA concentrations added to the amplification reaction are 10 copies / μL, 5 copies / μL, 2.5 copies / μL, 1.25 copies / μL, 0.625 copies / μL, 0.3125 copies / μL, and 0.15625 copies / μL. The rightmost side is the negative control sample. It can be seen from the figure that the protein can still be detected when the input DNA concentration is as low as 0.625 copies / μL.

[0068] The above method was used for specific detection, and the results were as follows Figure 2 As shown, Figure 2From left to right in the figure are the detection results of microbial DNA amplification products of blood samples, semen samples, vaginal fluid samples, menstrual blood samples and negative control samples, wherein, except for the negative control sample, each body fluid sample is a mixture of samples from 5 different individuals. The results show that the detection method provided by the present invention has strong specificity.

[0069] The above method was used to perform simulated sample testing. The sample was saliva smeared on the FTA saliva card. A portion of the sample of equal size was cut every 24 hours for microbial DNA extraction. The test results are as follows: Figure 3 As shown, Figure 3 From left to right in the figure are samples stored for 0 days, 1 day, 2 days, 4 days, 6 days, 8 days, 10 days and the negative control. The results show that except for the negative sample, corresponding positive results can be detected.

[0070] Using the above method to test case samples, the test results are as follows Figure 4 As shown, Figure 4 From left to right in the middle are the results of DNA testing using different oral swab samples stored for 3 years, 4 years, 3 years, 4 years and 3 years respectively. Sample No. 3 had a weak test result.

[0071] The above method was used to compare the results between technologies. The test results are as follows: Figure 5 As shown, the real-time fluorescence quantitative detection result at the detection concentration of 0.625 copies / μL is a ct value of 33.38, indicating that the detection can be achieved on a real-time fluorescence quantification instrument (ABI 7500) at this working concentration, proving the feasibility of this rapid detection method.

[0072] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer probe set for detecting yellowish Neisseria, characterized in that: including amplification primer pairs and probes; In the amplification primer pair, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.2; The nucleotide sequence of the probe is shown in SEQ ID NO.3; Counting from the 5' end of the probe sequence, the 33rd base of the probe is dSpacer modified; The 5' end of the downstream primer is labeled with biotin; The 5' end of the probe is labeled with a reporter group; and / or, the 3' end of the probe is labeled with an amine group, a phosphate group or a C3spacer; The reporter group is selected from one or more of FAM, VIC, ROX, HEX, TET, JOE, NED, Cy5, and Cy3.

2. Use of the primer probe set for detecting yellowish Neisseria according to claim 1 in preparing a kit or reagent for detecting yellowish Neisseria.

3. A kit for detecting yellowish Neisseria, characterized in that: The invention comprises a nucleic acid colloidal gold test strip and the primer probe set for detecting yellowish Neisseria as claimed in claim 1.

4. The kit for detecting yellowish Neisseria according to claim 3, characterized in that: The final concentration of the amplification primer pair in the kit is 0.2-0.6 μmol / L.

5. The kit for detecting yellowish Neisseria according to claim 3, characterized in that: The final concentration of the probe in the kit is 0.1-0.2 μmol / L.

6. Use of the primer probe set according to claim 1 or the kit according to any one of claims 3 to 5 in the preparation of a saliva stain identification reagent; The saliva contained yellowish Neisseria.

Images