SNP molecular marker related to lean meat percentage of pig on chromosome 4 and application thereof
By detecting the T>C mutation at the SNP site on pig chromosome 4 and using primer pairs for molecular marker-assisted selection, the problem of improving lean meat percentage in traditional breeding methods has been solved, achieving the effect of rapidly increasing lean meat percentage and meat quality, thereby improving breeding efficiency and economic benefits.
Patent Information
- Application Number
- CN202311420644.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-30
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2043-10-30
AI Technical Summary
Traditional breeding methods are difficult to improve the lean meat percentage of pigs quickly and effectively, are time-consuming and yield little result, and existing technologies lack efficient molecular marker-assisted selection methods.
By detecting the T>C mutation at the SNP site on chromosome 4 of pigs, molecular marker-assisted selection was performed using primer pairs primer-F and primer-R to eliminate the CC and CT genotypes, retain the T genotype, and increase the frequency of the T allele in each generation, thereby increasing the lean meat percentage.
This has accelerated the breeding process of Duroc and its synthetic lines, improved the lean meat percentage and meat quality of breeding pigs, reduced breeding costs, and enhanced the competitiveness and economic benefits of enterprises.
Smart Images

Figure CN117487928B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on chromosome 4 of pigs that is associated with lean meat percentage and its application. Background Technology
[0002] Lean meat percentage is one of the important goals of pig genetic improvement. By selecting parent pigs with high lean meat percentages, the genetic makeup of pigs can be improved generation by generation, resulting in offspring with even higher lean meat percentages. For decades, people have used traditional breeding methods to increase lean meat percentage to obtain superior breeding pigs, thus improving this trait to some extent. However, lean meat percentage is a complex quantitative trait, regulated by multiple genes. Therefore, improving this trait through traditional breeding methods is time-consuming and yields limited results.
[0003] With the development of high-throughput sequencing technology, SNP loci affecting quantitative traits can be identified by detecting single nucleotide polymorphisms (SNPs) in the pig genome combined with genome-wide association study (GWAS). Therefore, in the pig breeding process, using SNPs identified by GWAS for marker-assisted selection to improve lean meat percentage will further accelerate the breeding process of lean-type pigs and significantly improve the economic benefits of pig farming.
[0004] Duroc pigs are the terminal sires of Duroc-Landrace-Landrace-Landrace-Landrace-Trade Union pigs. For commercial pig farming, improving Duroc pigs is a key factor in enhancing production performance and economic efficiency. Improving the lean meat percentage trait of the core Duroc herd helps ensure that more advantages are passed on to offspring, thereby enhancing the competitiveness of the entire industry. Therefore, improving the lean meat percentage trait of the core Duroc herd can maximize the inheritance of improved advantages to commercial pig offspring, enhancing the production competitiveness of commercial pigs and thus improving the economic benefits of farms. Summary of the Invention
[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a SNP molecular marker located on chromosome 4 of pigs that is associated with lean meat percentage in pigs.
[0006] Another object of the present invention is to provide the application of the above-mentioned SNP molecular markers located on chromosome 4 of pigs that are associated with lean meat percentage in pigs.
[0007] Another object of the present invention is to provide a primer pair for identifying the aforementioned SNP molecular markers located on chromosome 4 of pigs that are associated with lean meat percentage.
[0008] A fourth objective of this invention is to provide applications of the aforementioned primer pairs.
[0009] The fifth objective of this invention is to provide a method for genetic improvement of pigs.
[0010] The objective of this invention is achieved through the following technical solution:
[0011] A molecular marker of a SNP located on chromosome 4 of pigs that is associated with lean meat percentage in pigs, the SNP site of which corresponds to the T>C mutation at 74748396 bp on chromosome 4 in International Pig Reference Genome Version 11.1;
[0012] The nucleotide sequence of the SNP molecular marker located on chromosome 4 of pigs that is associated with lean meat percentage is shown in SEQ ID NO.1, where M in the sequence is T or C, which leads to differences in the lean meat percentage trait of pigs;
[0013] The SNP site of the SNP molecular marker on pig chromosome 4 that is related to the lean meat percentage of pigs is the C123-T123 nucleotide mutation at position 123 of the sequence marked in SEQ ID NO:1 (a single base mutation at the 123rd nucleotide of this sequence fragment, named: g.74748396T>C);
[0014] The aforementioned SNP molecular markers located on chromosome 4 of pigs and associated with lean meat percentage are used in the identification of lean meat percentage traits and genetic breeding of Duroc pigs;
[0015] A method for detecting the lean meat percentage trait in pork includes the following steps:
[0016] The detection of SNP molecular markers located on pig chromosome 4 that are associated with lean meat percentage in pigs, wherein the SNP site of the SNP molecular marker is either T or C;
[0017] The method for screening pig breeds with high lean meat percentage using the aforementioned SNP molecular markers located on chromosome 4 of pigs and associated with lean meat percentage includes the following steps:
[0018] The above-mentioned SNP molecular markers located on pig chromosome 4 that are related to lean meat percentage were detected. The single nucleotide of the SNP site of the molecular marker was either T or C, and C was eliminated and T was retained.
[0019] The pigs mentioned are Duroc synthetic strains;
[0020] The preferred pigs are the Canadian Duroc strain and its synthetic strains;
[0021] A primer pair for identifying the aforementioned SNP molecular markers located on chromosome 4 of pigs and associated with lean meat percentage, comprising primers primer-F and primer-R, has the following nucleotide sequence:
[0022] Upstream primer-F: 5'-CTGAGCCCCAGCAAAGAACA-3';
[0023] Downstream primer primer-R: 5'-GTTGTTGGAGCCCAGGTCAA-3';
[0024] The application of the primer pairs described above in identifying traits affecting lean meat percentage in breeding pigs;
[0025] Application of the primer pairs in marker-assisted breeding of pigs;
[0026] Application of the primer pairs in improving the lean meat percentage of breeding pigs;
[0027] A method for genetic improvement of pigs, comprising the following steps:
[0028] Identify the aforementioned SNP molecular markers on chromosome 4 of pigs in the core breeding herd that are associated with lean meat percentage, and make corresponding selections based on these molecular markers: select breeding pigs with the TT genotype at 74748396 bp on chromosome 4 according to the International Swine Reference Genome 11.1 version, and eliminate breeding pigs with the CT and CC genotypes at this point, in order to increase the frequency of the T allele at this locus in each generation, thereby increasing the lean meat percentage of offspring pigs;
[0029] The pigs mentioned are Duroc synthetic strains;
[0030] The preferred pigs are the Canadian Duroc strain and its synthetic strains;
[0031] The present invention has the following advantages and effects compared with the prior art:
[0032] (1) This invention studies and identifies molecular markers related to lean meat percentage located on the nucleotide sequence of chromosome 4 in pigs, verifies their effect on the lean meat percentage trait, and ultimately establishes a molecular marker-assisted selection breeding technology for rapid improvement of the lean meat percentage trait. This greatly improves the breeding process of Duroc and its synthetic lines, meets the needs of the breeding pig market, increases the price of breeding pigs, reduces breeding costs for enterprises, and enhances their core competitiveness. By optimizing the dominant allele of this SNP, the frequency of the dominant allele can be increased generation by generation, improving the lean meat percentage of breeding pigs, indirectly improving the quality of breeding pig meat, accelerating the progress of pig genetic improvement, and thus effectively improving the economic benefits of pig breeding.
[0033] (2) This invention provides a primer pair for identifying the above-mentioned SNP molecular markers located on chromosome 4 of pigs that are related to lean meat percentage. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select traits and accelerate the breeding process. Attached Figure Description
[0034] Figure 1 This is a genome-wide association (GWAS) diagram of the lean meat percentage trait in Canadian Duroc pigs on chromosome 4 at a body weight of 100 kg; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents the -logP value;
[0035] Figure 2 This is a graph showing the lean meat percentage of pigs with different genotypes at a weight of 100kg. Detailed Implementation
[0036] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0037] Experimental pig herd: A total of 2082 Canadian Duroc pigs were used in this experiment.
[0038] Example 1 details the process for determining the factors affecting lean meat percentage and gene markers in this invention.
[0039] (1) Laboratory animals
[0040] The lean meat percentage of live pigs weighing 100 kg was determined using the New Zealand HGS (Hennessy Grading System). The experimental pig herd used in this invention consisted of 2082 purebred Canadian Duroc pigs from Guangdong Zhongxin Seed Industry Technology Co., Ltd., representing the core herd of the breeding pig division, with detailed pedigree records. This experiment selected Canadian Duroc pigs from this resource group. The pigs were raised under standardized feeding conditions, with free access to feed and water, until they reached a weight of 100 ± 5 kg.
[0041] (2) Sample collection
[0042] DNA was extracted from ear-like tissue samples of Canadian Duroc pigs using the phenol-chloroform method described in the standard extract. The DNA from the purebred Canadian Duroc population was analyzed for quality and concentration using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.
[0043] (3) Pig genome 50K SNP genotyping
[0044] Genotyping of the entire porcine genome using 50K SNPs: The GeneSeek Genomic Profiler Porcine 50K SNP genotyping platform was used. Microarray hybridization and result scanning were performed following the Illumina Infinium user manual and standard procedures. Genotypic data were then retrieved using GenomeStudio software. Quality control of the obtained genotypic data was performed using PLINK v1.07, with rejection rates <99%, mimor allelic frequencies (MAF) <1%, or deviations from Hardy-Weinberg equilibrium (HWE) p-values ≤10. -6 SNP markers were identified, excluding individuals with a detection rate <90%, a family Mendelian error rate >0.1, and SNPs located at unknown locations or on sex chromosomes. The remaining 727,113 SNP markers and 2,082 samples from the 100kg lean meat percentage quality control were used for subsequent data analysis.
[0045] (4) Pig whole genome 50K chip genotyping
[0046] To increase the density of SNP markers and improve the success rate of identifying key mutation sites for lean meat percentage, this invention uses the SWIM website (http: / / 192.168.142.36:9088 / # / home) to fill the 50K SNP chip of the entire genome of the above-mentioned Canadian Duroc pigs. The genotypic filling data of all samples were quality controlled using PLINK software, removing individuals with a detection rate below 90%, a family Mendelian error rate above 0.1, a minimum allele frequency below 0.01, and a Hardy-Weinberg equilibrium significance level above 10. -6 The SNPs were analyzed, and ultimately, 11,388,559 valid genotype data for SNPs were obtained.
[0047] (5) Genome-wide association study (GWAS):
[0048] To eliminate population stratification effects, this invention employs a linear mixture model with single-point regression analysis combined with GWAS analysis using the GenABEL software package in R. The analysis model utilizes inter-individual genome similarity to correct for stratification effects. A genome-level significance threshold of 1×10⁻⁶ is set. -5 .
[0049] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It is known that in the Canadian Duroc strain, there is a locus on chromosome 4 that significantly affects the lean meat percentage per 100 kg, with the strongest association SNP being 4:74748396:T:C (P=2.63×10⁻⁶). -6(The 123rd nucleotide in SEQ NO. 1 corresponds to the T>C mutation at 74748396 bp on chromosome 4 in International Pig Reference Genome Version 11.1).
[0050] (6) Association analysis between different genotypes and the lean meat percentage phenotype of breeding pigs at 100kg body weight: According to Table 1, the SNP locus 4:74748396:T:C of the molecular marker was significantly correlated with the lean meat percentage trait (P<0.01), indicating that this molecular marker significantly affects the lean meat percentage of pigs. Assisted selection at this SNP locus in pigs can improve the lean meat percentage of this population, thereby accelerating the breeding process of lean-type breeding pigs. Furthermore, according to Table 1, Figure 2 It was also found that the lean meat percentage of the CC genotype was lower than that of the CT and TT genotypes, indicating that homozygous CC is the most detrimental to the lean meat percentage of breeding pigs. Lean meat percentage is an important indicator of the growth performance of breeding pigs; a high lean meat percentage indicates good growth performance. Therefore, pigs with the CC genotype have the worst growth performance. In the breeding process, we need to gradually cull CC and CT genotype breeding pigs and retain TT genotype breeding pigs to increase the frequency of the T allele at this locus through each generation.
[0051] Table 1. Correlation between SNP sites of molecular markers 4:74748396:T:C and traits
[0052]
[0053] Example 2 explains in detail the invention process of detecting SNP markers.
[0054] (1) The target fragment containing the SNP site that is significantly associated with the lean meat percentage performance of Duroc at 100kg body weight is a 291bp nucleotide sequence from chromosome 4. The upstream and downstream primers for sequence amplification are primer-F and primer-R, and their nucleotide sequences are as follows:
[0055] Upstream primer-F: 5'-CTGAGCCCCAGCAAAGAACA-3';
[0056] Downstream primer primer-R: 5'-GTTGTTGGAGCCCAGGTCAA-3'.
[0057] (2) PCR amplification system and conditions
[0058] Prepare a 10 μL system, including 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR conditions are: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, and a final extension at 72℃ for 5 min.
[0059] (3) DNA Sequence Sequencing Identification: Sequencing was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions for each gene fragment. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:
[0060] CTGAGCCCCAGCAAAGAACAATATAAGGAGGTGACCCAACTCTAGAAAC
[0061] ATGACAGGGTAACTTAGAAGGAAAAGCCAAAAAAAAAAAAAAATTAGTTCTGGAATCTGAGACCCAATGCTGA M(T>C) TGACACTTGTTCAAGTGACTGGCTATGATTCCCCAGTGAAAATGTCAATCAAATACCTGGAGCTTTCCCGCATCCACGTGCCAGATCCATGTGGTTGCCTGTGCCATTTCCTTACCCAAGTGCTCTTAGAGAGGTACAGCATCTCTCAGTTGACCTGGGCTCCAACAAC
[0062] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The beginning and end of the sequence are bolded to indicate the primer binding position.
[0063] Example 3: SNP site analysis of molecular markers 4:74748396:T:C effect
[0064] This invention provides a SNP molecular marker that can significantly improve the lean meat percentage of Duroc breeding pigs. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the lean meat percentage breeding process of Duroc pigs. As shown in Table 1, the frequency of the dominant allele T at the SNP site g.74748396T>C is 0.614 in the population. Therefore, by using molecular marker-assisted selection to gradually cull pigs with genotypes CT and CC within the population, the allele frequency of allele T can be significantly increased, thereby increasing the lean meat percentage of breeding pigs, indirectly improving meat quality, accelerating the improvement of lean-type pigs, and effectively improving the economic benefits of pig breeding.
[0065] This invention utilizes the detection of the mutation site at position 123 in the SEQ ID NO:1 sequence to conduct preliminary association analysis between its genotype and lean meat percentage, providing a new molecular marker for marker-assisted selection of breeding pigs.
[0066] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of a SNP molecular marker located on chromosome 4 of pigs and associated with lean meat percentage in the identification of lean meat percentage traits and in the genetic breeding of lean meat percentage traits, characterized in that: The nucleotide sequence of the SNP molecular marker located on chromosome 4 of pigs and associated with lean meat percentage is shown in SEQ ID NO.1, where M in the sequence is T or C, resulting in different lean meat percentage traits in pigs; among them, the CC genotype has a lower lean meat percentage than the CT and TT genotypes; the pigs mentioned are Duroc breeds and their synthetic lines.
2. A method for detecting the lean meat percentage trait in pork, characterized in that... It includes the following steps: The detection method involves identifying the SNP molecular marker located on chromosome 4 of pigs as described in claim 1, which is associated with lean meat percentage. The SNP site of the SNP molecular marker is either T or C, wherein the CC genotype has a lower lean meat percentage than the CT and TT genotypes; and the pigs are Duroc breeds and their synthetic lines.
3. Use of a primer pair for identifying a SNP molecular marker located on pig chromosome 4 associated with lean meat percentage in identifying the lean meat percentage trait of breeding pigs, characterized in that The primer pair comprises primers primer-F and primer-R, and their nucleotide sequences are as follows: Upstream primer-F: 5'-CTGAGCCCCAGCAAAGAACA-3'; Downstream primer primer-R: 5'-GTTGTTGGAGCCCAGGTCAA-3'; The SNP molecular marker is the SNP molecular marker described in claim 1, wherein the CC genotype at the location of the SNP molecular marker has a lower lean meat percentage than the CT and TT genotypes; the pig is a Canadian Duroc strain or its synthetic strain.
4. A primer pair for identifying a SNP molecular marker located on pig chromosome 4 associated with lean meat percentage of pigs in molecular marker assisted breeding of lean meat percentage trait of pigs, characterized in that The primer pair comprises primers primer-F and primer-R, and their nucleotide sequences are as follows: Upstream primer-F: 5'-CTGAGCCCCAGCAAAGAACA-3'; Downstream primer primer-R: 5'-GTTGTTGGAGCCCAGGTCAA-3'; The SNP molecular marker is the SNP molecular marker described in claim 1, wherein the CC genotype at the location of the SNP molecular marker has a lower lean meat percentage than the CT and TT genotypes; the pig is a Canadian Duroc strain or its synthetic strain.
5. A method of genetic improvement of swine, characterized in that It includes the following steps: Identify the SNP molecular markers on chromosome 4 of pigs in the core breeding herd that are associated with lean meat percentage, as described in claim 1, and make corresponding selections based on the molecular markers: select breeding pigs with the TT genotype of the SNP molecular marker described in claim 1 for successive generations, and eliminate breeding pigs with the CC and CT genotypes, so as to increase the frequency of the T allele at this locus in each generation, thereby increasing the lean meat percentage of offspring pigs; The pigs mentioned are the Canadian Duroc strain and its synthetic strains.