Non-toxigenic Aspergillus flavus APqn-3, its biological agent and its application in inhibiting toxigenic Aspergillus flavus and preventing and controlling peanut diseases

Abstract

The invention discloses a strain of non-toxic aflatoxin Aspergillus flavus APqn‑3, a biological agent thereof and its application in inhibiting toxic aflatoxin and preventing and controlling peanut diseases, and belongs to the field of microbial technology. The non-toxic aflatoxin of the invention is a strain of Aspergillus flavus (Aspergillus flavus) APqn‑3, and the deposit number is CGMCC NO.40537. The strain can not only inhibit the growth and toxin production of toxic aflatoxin, but also has a preventive effect on diseases such as peanut fruit rot and root rot. The strain is prepared into a biological agent, which can improve the ability of the strain to resist the natural environment, can grow and reproduce rapidly in different types of soils such as dry slopes, depressions, rice fields, sandy loam, saline-alkali land, etc., and inhibit the growth and toxin production of toxic aflatoxin; therefore, the strain APqn‑3 of the invention has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a non-toxigenic aflatoxin APqn-3, a biological bacterial agent thereof, and an application thereof in inhibiting toxigenic aflatoxin and preventing and controlling peanut diseases. Background Art

[0002] Aflatoxin (AFT) is a secondary metabolite mainly produced by Aspergillus flavus and Aspergillus parasiticus. It is a highly toxic substance. Among them, aflatoxin B1 is the most toxic and one of the strongest carcinogens in the world. Aspergillus flavus is widely present in soil, plants and fruits, and has strong vitality. Peanuts are one of the crops most susceptible to aflatoxin infection. Aflatoxin contamination will cause the quality of peanuts to decline, which has a great impact on food quality and safety. Therefore, the prevention and control of toxin-producing Aspergillus flavus is the top priority to prevent agricultural products from being contaminated by aflatoxin.

[0003] At present, there have been reports at home and abroad on the separation of non-toxic Aspergillus flavus from soil for the prevention and control of toxic Aspergillus flavus. However, these studies are limited to reports on the inhibition of the growth of toxic Aspergillus flavus in the laboratory, and there are no reports on relevant field trials and actual application effects. The natural environment is more complex and changeable than the laboratory environment, which has a greater impact on the growth and reproduction of non-toxic Aspergillus flavus, often resulting in a large gap in field application effects compared to the laboratory. In addition, the reproduction of molds in a complex and changeable natural environment often leads to a higher proportion of mutations, and some non-toxic Aspergillus flavus may undergo reverse mutations and re-produce toxins. Therefore, it is very important to provide a native Aspergillus flavus that does not secrete aflatoxin and prepare it into a biological agent that can adapt to a variety of complex soil environments, which is very important for the biological prevention and control of toxic Aspergillus flavus and the prevention of aflatoxin contamination of agricultural products. Summary of the invention

[0004] In view of the problems existing in the prior art, the object of the present invention is to provide a non-toxigenic Aspergillus flavus APqn-3, its biological bacterial agent and its application in inhibiting toxigenic Aspergillus flavus and preventing and controlling peanut diseases.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] A non-toxic Aspergillus flavus strain is provided, wherein the Aspergillus flavus strain is Aspergillus flavus APqn-3 strain, and its preservation number is CGMCC NO.40537.

[0007] The application of the above-mentioned non-toxigenic aflatoxin in the biological control of aflatoxin and the prevention and control of peanut diseases.

[0008] The application of the above non-toxic aflatoxin in the preparation of preparations for biological control of aflatoxin and peanut disease prevention and control.

[0009] A biological bacterial agent, the active ingredient of which is the APqn-3 strain with a preservation number of CGMCC NO.40537.

[0010] Based on the above scheme, the number of Aspergillus flavus spores in the biological agent is ≥10 8 Pieces / g.

[0011] On the basis of the above scheme, the preparation method of the biological agent is as follows:

[0012] (1) Preparation of inoculant culture medium: Soil was collected from peanut fields, and impurities such as stones and dead grass were removed. The soil and distilled water were mixed in a mass ratio of 2:1-1:1, and sterilized at 121°C for 20 min.

[0013] (2) inoculating the activated non-toxic Aspergillus flavus strain APqn-3 onto the sterilized soil, culturing at 30° C. for 5-8 days, shaking once a day, so that the Aspergillus flavus grows evenly on the culture medium; drying the soil culture medium at 45° C. after the culturing;

[0014] (3) adding sterilized distilled water to the soil culture medium dried in step (2) at a mass ratio of 2:1 to 1:1 between soil and distilled water, and then inoculating the activated non-toxic Aspergillus flavus strain APqn-3 onto the dried culture medium, culturing again at 30° C. for 8-10 days, and drying at 45° C.;

[0015] (4) Add sterile distilled water to the soil culture medium after drying in step (3) at a mass ratio of 2:1 to 1:1 between soil and distilled water, and then inoculate the activated non-toxic Aspergillus flavus strain APqn-3 onto the dried culture medium, culture again at 30° C. for 10-12 days, and dry at 45° C. to obtain the product.

[0016] The application of the above-mentioned biological agents in the biological control of Aspergillus flavus and the prevention and control of peanut diseases.

[0017] Based on the above scheme, the peanut disease is at least one of fruit rot and root rot.

[0018] A method for biological control of Aspergillus flavus and peanut disease control comprises the following steps: before sowing peanuts, the biological microbial agent and organic fertilizer are evenly spread in a peanut field, and the field is ploughed and swirled to evenly disperse the biological microbial agent and organic fertilizer in the peanut soil.

[0019] Based on the above plan, the usage of biological agents is 30kg / mu.

[0020] Advantages of the technical solution of the present invention:

[0021] The present invention separates and obtains a non-toxigenic Aspergillus flavus APqn-3 strain, which can not only inhibit the growth and toxin production of toxigenic Aspergillus flavus, but also has a preventive and therapeutic effect on peanut fruit rot, root rot and other diseases.

[0022] The present invention uses peanut planting soil as a culture medium to prepare the APqn-3 strain into a biological agent. The preparation method adopts the method of inoculation, cultivation, drying; re-inoculation, cultivation, and drying, thereby improving the stress resistance of the biological agent; the biological agent prepared by the present invention is applied in spring, spread together with organic fertilizer, and the biological agent and soil are fully mixed after plowing and turning the land, and the nutrition of the organic fertilizer is helpful to the growth of the APqn-3 strain. The biological agent prepared by the method of the present invention can grow and reproduce rapidly in different types of soils such as dry slopes, depressions, rice fields, sandy loam and saline-alkali land, and inhibit the growth and toxin production of toxin-producing Aspergillus flavus; therefore, the strain APqn-3 of the present invention has a good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Growth graph of soil bacterial suspension on modified red Bengal medium;

[0024] Figure 2 The morphology of strain APqn-3 grown on modified red Bengal medium;

[0025] Figure 3 Morphology of strain APqn-3 in malt extract agar medium (MEA medium);

[0026] Figure 4 The morphology of strain APqn-3 grown on chloranil 18% glycerol medium (DG18 medium);

[0027] Figure 5 Morphology of strain APqn-3 in aspergillus agar basal medium (AFPA medium);

[0028] Figure 6 Determination of aflatoxin content in the fermentation broth of strain APqn-3. DETAILED DESCRIPTION

[0029] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art.

[0030] The present invention is further described in detail below in conjunction with specific examples and with reference to data. The following examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0031] Example 1 Isolation, purification and identification of strains

[0032] 1. Sample collection: The peanut soil was collected in Zhanjiang, Guangdong in May 2018. For each sample (100g), 5 sub-samples (2cm wide and 5cm deep soil) were taken diagonally within the range of 10×10m and mixed as one sample. The collected samples were put into plastic bags, pierced with pinholes to facilitate gas exchange, transported to the laboratory, and stored at 4℃ for aflatoxin screening.

[0033] 2. Isolation and purification of strains.

[0034] (1) Preparation of soil sample bacterial suspension

[0035] Take 10 g of soil sample, add 90 mL of 0.1% peptone sterile water (w / v), shake at room temperature for 30 min, and make 10 -1 Bacterial suspension; then take 0.5mL 10 -1 Add 4.5 mL of 0.1% peptone sterile water to the bacterial suspension to prepare 10 -2 Dilution of bacterial suspension; prepare 10 -3 Dilution of bacterial suspension.

[0036] (2) Isolation and purification of strains

[0037] Take 0.1mL of bacterial solution for each dilution, spread it on modified Bengal red medium, and culture it in the dark at 30℃ for 5 days. Repeat each dilution 3 times. Pick the Aspergillus flavus with yellow-green spores and perform secondary streaking on the modified Bengal red medium until a single colony is obtained. Pick a single colony of Aspergillus flavus on MEA slant test tube medium, culture it at 30℃ for 3 days, and then store it at 4℃.

[0038] The growth of soil bacteria suspension on modified Bengal red medium is shown in the figure Figure 1 shown.

[0039] By the above method, strain APqn-3 was isolated and obtained.

[0040] 3. Identification of strain APqn-3

[0041] (1) Morphological identification

[0042] Strain APqn-3 produced yellow-green spores and white hyphae on modified red Bengal medium ( Figure 2 ); strain APqn-3 in malt extract agar medium (MEA medium) morphology as Figure 3 As shown; yellow-green spores are produced on chloranil 18% glycerol medium (DG18 medium) Figure 4 ), the surface of the colony is loose and scattered; it produces a bright orange color reaction on AFPA medium ( Figure 5 );

[0043] (2) Physiological and biochemical reactions

[0044] The strain APqn-3 was cultured in aflatoxin-producing culture medium, and the results showed that it did not produce aflatoxin.

[0045] (3) Molecular biological identification

[0046] Molecular biological identification was performed by cloning the ITS gene sequence of strain APqn-3. The primer sequences used are as follows:

[0047] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' (SEQ ID NO: 1);

[0048] ITS4: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO: 2).

[0049] PCR amplification conditions: PCR amplification reaction program: 94℃ pre-denaturation for 5min, 1 cycle; 94℃ denaturation for 30s, 54℃ annealing for 30s, 72℃ extension for 90s, 30 cycles; 72℃ final extension for 7min. After amplification, the product was stored at 4℃. The product was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared on BLAST researches (http: / / www.ncbi.nlm.nih.gov / ).

[0050] The sequencing revealed that the ITS sequence of the cloned strain APqn-3 was as follows:

[0051] SEQ ID NO:3(5'→3')

[0052] GATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTG

[0053] TACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGG

[0054] CCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATT

[0055] GTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGA

[0056] ACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTT

[0057] TGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCT

[0058] GCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCC

[0059] CCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGC

[0060] TCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCG

[0061] GATCAGGTAGGGATACCCGCTGAACTTAAG

[0062] ITS sequence comparison showed that the ITS gene sequence of strain APqn-3 was 100% similar to the small subunit ribosomal RNA gene sequence of Aspergillus flavus strain LUOHE.

[0063] Universal primers were used to detect the expression of toxin-producing genes in strain APqn-3. The results showed that nine key toxin-producing genes, including aflT, nor-1, hypD, aflR, aflJ, adhA, estA, hypB, and ordB, were not expressed in the toxin-producing gene cluster of strain APqn-3. Therefore, this strain does not produce toxins.

[0064] Morphological identification combined with physiological and biochemical characteristics and molecular biological identification results identified strain APqn-3 as aflatoxin-free Aspergillus flavus; it was deposited on March 24, 2023 at the General Microbiology Center of China Culture Collection Administration, with the deposit number CGMCC NO:40537, and the address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the requested depository is Qingdao Agricultural University.

[0065] Example 2 Identification of toxin production by strain APqn-3

[0066] (1) Toxicity culture

[0067] The strain APqn-3 was inoculated on the MEA slant test tube culture medium and cultured at 28°C for 3 days to activate it; 4 mL of sterile water was added to the slant test tube culture medium and rinsed to prepare the strain APqn-3 suspension. The number of spores was recorded using a hemocytometer under a microscope.

[0068] 10 mL of toxin-producing culture medium (the composition of toxin-producing culture medium is 150.0 g sucrose, 20.0 g yeast extract, 10.0 g soy peptone, 1000 mL distilled water, pH 5.9) was added to a 50 mL centrifuge tube, and then a certain amount of strain APqn-3 bacterial suspension was added to make the final spore concentration of 10 5 / mL, 30℃, 200rpm, culture for 7 days.

[0069] (2) Determination of aflatoxin in toxin-producing culture medium

[0070] The aflatoxin in the fermentation broth was detected by immunoaffinity chromatography purification, liquid chromatography separation, and fluorescence detector detection. The specific operation is as follows: 2 mL of fermentation broth is passed through the immunoaffinity chromatography column at a flow rate of 3 mL per minute, eluted twice with 20 mL of water, the eluent is discarded, air is allowed to enter the column, water is squeezed out of the column, and then eluted with 1.5 mL of methanol in batches, the eluent is collected, concentrated to 0.7 mL, and diluted to 1 mL with water, shaken, loaded, separated by high performance liquid chromatography, and detected by fluorescence detector.

[0071] Chromatographic conditions: the chromatographic column is Venusil MP C18 (5μm, 4.6mm×150mm); the column temperature is 40℃; the mobile phase is methanol:water (V:V=45:55); the flow rate is 1.3mL / min; post-column photochemical derivatization method is adopted: photochemical derivatizer 254nm; detection is carried out with a fluorescence detector, excitation wavelength is 360nm, emission wavelength is 450nm, and injection volume is 20μL.

[0072] The results are as follows Figure 6 As shown (from top to bottom are the Aspergillus flavus standard and APqn-3 test results), no aflatoxin was detected in the toxin-producing fermentation broth of strain APqn-3, further confirming that strain APqn-3 is a non-toxigenic Aspergillus flavus strain.

[0073] Example 3 Biological agent containing strain APqn-3

[0074] A biological bacterial agent, the active ingredient of which includes strain APqn-3. The preparation method is as follows:

[0075] (1) Activation of strains: strain APqn-3 was inoculated on MEA medium and cultured at 30°C for 3-5 days until yellow-green spores were produced.

[0076] (2) Preparation of inoculant culture medium: Soil was collected from peanut fields, and impurities such as stones and dead grass were removed. The soil and distilled water were mixed in a mass ratio of 2:1-1:1, and sterilized at 121°C for 20 min.

[0077] (3) The activated non-toxic Aspergillus flavus strain APqn-3 was inoculated into the sterilized soil at an inoculation rate of 10 per 100 g of culture medium. 7 The non-toxin-producing strain APqn-3 spores were cultured at 30°C for 5-8 days, and shaken once a day to allow the Aspergillus flavus to grow evenly on the culture medium; after the culture was completed, the soil culture medium was dried in an oven at 45°C;

[0078] (4) adding sterilized distilled water to the soil culture medium after drying in step (3) at a mass ratio of 2:1 to 1:1 between soil and distilled water, and then inoculating the activated non-toxic Aspergillus flavus strain APqn-3 onto the dried culture medium at an inoculation rate of 10 per 100 g of culture medium. 7 Spores of the non-toxigenic strain APqn-3 were cultured again at 30°C for 8-10 days and dried in an oven at 45°C;

[0079] (5) Adding sterilized distilled water to the soil culture medium dried in step (4) at a mass ratio of 2:1 to 1:1 between soil and distilled water, and then inoculating the activated non-toxic Aspergillus flavus strain APqn-3 onto the dried culture medium at an inoculation rate of 10 per 100 g of culture medium. 7 The non-toxic strain APqn-3 spores are cultured again at 30°C for 10-12 days and dried in an oven at 45°C. The biological inoculant is prepared and stored at room temperature. The number of Aspergillus flavus spores in the biological inoculant is ≥10 8 Pieces / g.

[0080] Comparative Example 1

[0081] A biological bacterial agent, the active ingredient of which includes strain APqn-3. The preparation method is as follows:

[0082] (1) Activation of strains: strain APqn-3 was inoculated on MEA medium and cultured at 30°C for 3-5 days until yellow-green spores were produced.

[0083] (2) Preparation of microbial agent: The MEA medium covered with spores was dried in an oven at 45°C and crushed to obtain biological microbial agent control 1.

[0084] Comparative Example 2

[0085] A biological bacterial agent, the active ingredient of which includes strain APqn-3. The preparation method is as follows:

[0086] (1) Activation of strains: strain APqn-3 was inoculated on MEA medium and cultured at 30°C for 3-5 days until yellow-green spores were produced.

[0087] (2) Preparation of inoculant culture medium: Soil was collected from peanut fields, and impurities such as stones and dead grass were removed. The soil and distilled water were mixed in a mass ratio of 2:1-1:1, and sterilized at 121°C for 20 min.

[0088] (3) The activated non-toxic Aspergillus flavus strain APqn-3 was inoculated into the sterilized soil at an inoculation rate of 10 per 100 g of culture medium. 7 The spores of the non-toxin-producing strain APqn-3 were cultured at 30°C for 5-8 days and shaken once a day to allow the Aspergillus flavus to grow evenly on the culture medium; after the culture was completed, the soil culture medium was dried in an oven at 45°C to obtain the biological agent control 2.

[0089] Comparative Example 3

[0090] (1) Activation of strains: strain APqn-3 was inoculated on MEA medium and cultured at 30°C for 3-5 days until yellow-green spores were produced.

[0091] (2) Preparation of inoculant culture medium: Soil was collected from peanut fields, and impurities such as stones and dead grass were removed. The soil and distilled water were mixed in a mass ratio of 2:1-1:1, and sterilized at 121°C for 20 min.

[0092] (3) The activated non-toxic Aspergillus flavus strain APqn-3 was inoculated into the sterilized soil at an inoculation rate of 10 per 100 g of culture medium. 7 The non-toxigenic strain APqn-3 spores were cultured at 30°C for 5-8 days, with shaking once a day to ensure that the Aspergillus flavus grew evenly on the culture medium;

[0093] (4) After the cultivation in step (3) is completed, the activated non-toxic Aspergillus flavus strain is inoculated into the culture medium after the cultivation in step (3), and the inoculation amount is 10 per 100g of culture medium. 7 Spores of the non-toxigenic strain APqn-3 were cultured again at 30°C for 8–10 days;

[0094] (5) After the cultivation in step (4) is completed, the activated non-toxic Aspergillus flavus strain is inoculated into the culture medium after the cultivation in step (4), and the inoculation amount is 10 per 100 g of culture medium. 7 The spores of the non-toxigenic strain APqn-3 were cultured again at 30°C for 10-12 days and then dried in an oven at 45°C to obtain the biological agent control 3.

[0095] Example 4 Application of biological agents containing strain APqn-3 in inhibiting aflatoxin production by Aspergillus flavus

[0096] (1) Matrix preparation

[0097] Select intact corn and peanut kernels that are not damaged, then weigh 10g of peanuts and corn of uniform size respectively, put them into a conical flask, and sterilize them at 121℃ for 15 minutes.

[0098] (2) Preparation of bacterial suspension

[0099] The toxin-producing Aspergillus flavus NRRL3357 was inoculated on MEA slant test tube culture medium and cultured at 20°C for 5 days. Then, the spores on the culture medium were dipped into sterile water with a cotton swab and vortexed evenly. Then, the spore concentration was adjusted to 2×10 4 Spores / mL, set aside.

[0100] Weigh 0.1 g of the biological agent prepared in Example 3 into sterile water, vortex and shake evenly, and then adjust the spore concentration to 2×10 4 Spores / mL, set aside.

[0101] (3) Inhibitory effect test

[0102] Add 1 mL of the diluted biological agent suspension and the toxin-producing aflatoxin spore suspension (10 mL) into the above-mentioned conical flask containing peanuts or corn. 4 :10 4 ) as the test group. Then add 1 mL of toxin-producing bacteria (10 4 ) and sterile water in equal volumes as the positive control group, and the bottle was gently shaken to cover the spores on the peanuts and corn. Each was done in triplicate and cultured at 30°C in the dark for 14 days.

[0103] (4) Determination of aflatoxin content

[0104] The cultured corn and peanut samples were sterilized in an autoclave at 121°C for 30 minutes (to inactivate Aspergillus flavus); the sterilized samples were crushed in a high-speed universal grinder, and then 50 ml of 80% methanol was added to a triangular flask, and the samples were shaken at high speed for 30 minutes with an oscillator, and then filtered with sterilized filter paper. The extract was used to determine the content of aflatoxin B1 by HPLC. The results are shown in Table 1.

[0105] Table 1 Effect of biological agents on inhibiting toxin-producing bacteria

[0106]

[0107] As can be seen from Table 1, the inhibition rate of the biological agent on the toxin-producing fungi in peanuts is 92.78±0.32%, and the inhibition rate of the biological agent on the toxin-producing fungi in corn is 88.91±0.63%. The biological agent can effectively inhibit the toxin production of toxin-producing fungi.

[0108] Example 5 Application of biological agents containing strain APqn-3 in antagonizing toxin-producing Aspergillus flavus in different types of soil

[0109] The biological agents and organic fertilizers prepared in Example 3 and Comparative Examples 1-3 were evenly spread on a peanut field that was not sown in spring. The amount of the biological agent used was 30 kg / mu, and the field was plowed and swollen to evenly disperse the biological agent and organic fertilizer in the peanut soil. The peanut fields were selected from five different types of common peanut planting soil types, namely dry slopes, depressions, rice fields, sandy loam and saline-alkali land; the control group was blank; and other daily management test groups were the same as the control group.

[0110] Soil samples were taken before and after the application of the biological agent, and the number of bacteria in the soil samples was detected and the Aspergillus flavus was isolated and identified. The number of Aspergillus flavus in the soil samples and the changes in the proportion of toxin-producing Aspergillus flavus before and after the application of antagonistic bacteria were compared. The results are shown in Table 2.

[0111] Table 2 Changes in the number and proportion of Aspergillus flavus in the soil after applying biological agents

[0112]

[0113] As can be seen from Table 2, the biological agent prepared in Example 3 can grow and reproduce in different types of soils, not only in sandy loam plain soil, but also in soil types such as dry slopes, rice fields and depressions with relatively harsh conditions, and can even survive in saline-alkali soil environments. Therefore, the biological agent prepared in Example 3 has strong adaptability.

[0114] At the same time, by comparing the biological agent prepared in Example 3 with the biological agents prepared by different methods in Comparative Examples 1-3, it can be seen that the bacterial agent prepared using conventional microbial agar medium (MEA) as the culture medium (Comparative Example 1) has a very weak reproduction ability in the soil. After application, the number of Aspergillus flavus colonies in the soil is 325.6±4.3-634.6±5.2 cfu / g soil, and the inhibitory effect on toxin-producing fungi is also small. The reduction ratio of toxin-producing Aspergillus flavus in different soil types ranges from 6.5% to 19.01%, and in paddy fields with harsh conditions, The inhibitory effect is smaller in depressions and saline-alkali land. After applying the biological agent of comparative example 1, the proportion of toxin-producing fungi in depressions is reduced by 8.1%, the proportion of toxin-producing fungi in rice fields is reduced by 9%, and the proportion of toxin-producing fungi in saline-alkali land is reduced by 6.5%. After applying the biological agent prepared in Example 3, the proportion of toxin-producing fungi is reduced to 0.77±0.41%-3.89±0.45%. It can not only effectively inhibit the growth of toxin-producing Aspergillus flavus in common sandy loam, but also in soils with harsh conditions such as rice fields, depressions and saline-alkali land, It can also effectively inhibit the growth of toxin-producing Aspergillus flavus.

[0115] It can be seen from Comparative Examples 1 and 2 that after the culture medium is changed from MEA agar culture medium to soil, the application ability of the prepared biological agent in the field is significantly increased. The number of Aspergillus flavus colonies in the soil of Comparative Example 1 is 325.6±4.3-634.6±5.2 cfu / g soil, and the number of Aspergillus flavus colonies in the soil of Comparative Example 2 increases to 547.5±6.2-1437.8±7.2 cfu / g soil, indicating that using soil as a culture medium to prepare antagonistic bacteria is more suitable for field application and improves the survival ability of the bacteria in the field. The reason is that the antagonistic bacteria are mainly used as a matrix in the field. Therefore, in the process of preparing the bacteria, using soil as a culture medium can allow the antagonistic bacteria to adapt well to the soil environment and improve its reproduction ability.

[0116] It can be seen from the antagonistic bacteria control 2 and control 3 that in the process of preparing the bacterial agent, repeated inoculation and cultivation for three times can better improve the survival ability of the bacterial agent in field application than only one inoculation and cultivation. The number of Aspergillus flavus colonies in the soil of control 2 was 547.5±6.2-1437.8±7.2 cfu / g soil, and the number of Aspergillus flavus colonies in the soil of control 3 increased to 1347.4±7.5-2965±5.3 cfu / g soil, indicating that repeated cultivation of the bacterial agent can improve the field survival ability of the bacterial agent.

[0117] It can be seen from the antagonistic bacteria control 3 and the antagonistic bacteria that in the process of preparing the bacteria, adding a drying step can significantly improve the adaptability of the bacteria in the field, especially in the soil environment with harsh conditions, such as saline-alkali land, depressions and paddy fields, the number of Aspergillus flavus colonies in the soil of the control 3 is 1347.4±7.5-2965±5.3cfu / g soil, and the number of Aspergillus flavus colonies in the soil of the biological bacteria prepared in Example 3 increases to 6043.3±26.4-8793.3±20.1cfu / g soil. The reason for this is that low-nutrient soil is used as a culture medium in the preparation of the bacteria, and it can better adapt to the soil environment after spreading. At the same time, the bacteria are cultured, dried, re-cultured, re-dried, re-cultured and dried in the preparation process, and the stress resistance is enhanced, so that it can adapt to different soil environments.

[0118] From the above results, it can be seen that after applying the biological bacterial agent prepared in Example 3, non-toxin-producing fungi can grow and reproduce rapidly in peanut soil, and can competitively inhibit the growth and reproduction of toxin-producing aflatoxin fungi, thereby reducing the proportion of toxin-producing fungi. It can be seen from the experiment that after applying non-toxin-producing fungi, the proportion of toxin-producing fungi decreased from 60.8±0.51%-71.3±0.47% in the control group to 0.77±0.41%-3.89±0.45% before harvest, and the proportion of toxin-producing fungi decreased rapidly, thereby reducing the proportion of toxin-producing fungi infecting peanuts and reducing the risk of aflatoxin contamination in peanuts.

[0119] Example 6 Application of biological agents containing strain APqn-3 in the prevention and treatment of peanut root rot

[0120] The biological agent and organic fertilizer prepared in Example 3 were evenly spread on the peanut field that was not sown in spring. The amount of biological agent used was 30 kg / mu. The field was plowed and swamped to make the biological agent and organic fertilizer evenly dispersed in the peanut soil. The peanut fields were selected from five different types of common peanut planting soil types, namely dry slope land, depression land, rice field, sandy loam land and saline-alkali land; the control group was blank; other daily management test groups were the same as the control group.

[0121] Pick peanuts grown on dry slopes, depressions, rice fields, sandy loam and saline-alkali land, randomly select 100 peanuts, pick out plants with root rot, and calculate the incidence of peanut root rot according to the following formula:

[0122] Peanut root rot incidence % = number of plants with root rot / total number of peanut plants*100.

[0123] Three replicates were performed for each soil type and the results are shown in Table 3:

[0124] Table 3 Effects of biological agents on peanut root rot

[0125] Dry slope land depression Sandy plain Rice fields Salt-alkali land Root rot incidence rate of control % 13.53±0.51 14.23±0.42 8.23±0.35 19.24±0.97 13.65±0.54 Root rot disease rate of fungal agents % 5.12±0.42 8.54±0.15 3.04±0.43 10.62±0.37 7.23±0.67

[0126] It can be seen from Table 3 that the addition of the biological agent of Example 3 can significantly reduce the incidence of peanut root rot. The incidence of root rot in different types of soils has decreased significantly, with a decrease of 8.41% in dry slopes, 5.69% in depressions, 5.19% in sandy loam plains, 8.62% in rice fields, and 6.42% in saline-alkali land.

[0127] Example 7 Application of biological agents containing strain APqn-3 in the prevention and treatment of peanut fruit rot

[0128] The biological agent and organic fertilizer prepared in Example 3 were evenly spread on the peanut field that was not sown in spring. The amount of biological agent used was 30 kg / mu. The field was plowed and swamped to make the biological agent and organic fertilizer evenly dispersed in the peanut soil. The peanut fields were selected from five different types of common peanut planting soil types, namely dry slope land, depression land, rice field, sandy loam land and saline-alkali land; the control group was blank; other daily management test groups were the same as the control group.

[0129] Pick peanuts grown on dry slopes, depressions, rice fields, sandy loam and saline-alkali land, randomly select 100 peanut plants, pick the peanuts from the 100 plants, count the number of pods from the 100 plants, select the rotten fruits, count the number of rotten fruits, and calculate the rotten fruit rate according to the following formula:

[0130] Rotten fruit rate (%) = number of rotten fruits / number of pods*100.

[0131] Three replicates were performed for each soil type and the results are shown in Table 4:

[0132] Table 4 Effects of biological agents on peanut fruit rot

[0133] Dry slope depression Sandy plain Rice fields Salt-alkali land Control rotten fruit rate % 21.69±0.54 31.45±0.34 26.23±0.28 34.24±0.969 33.42±0.45 Fruit rot rate of fungus agent % 18.21±0.24 27.54±0.35 21.64±0.62 29.46±0.73 31.37±0.67

[0134] Table 4 shows that the addition of the biological agent prepared in Example 3 can reduce the rotten fruit of peanuts. The rotten fruit rate of different types of soil has been significantly reduced, with a decrease of 3.48% in dry slopes, 3.91% in depressions, 4.59% in sandy loam plains, 4.78% in rice fields, and 2.05% in saline-alkali land.

[0135] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A non-toxic aflatoxin strain, characterized in that: The Aspergillus flavus is Aspergillus flavus ( Aspergillus flavus ) APqn-3 strain, the deposit number is CGMCC NO.40537.

2. The use of the non-toxigenic Aspergillus flavus according to claim 1 in the biological control of Aspergillus flavus and the prevention and control of peanut diseases, characterized in that: The peanut disease is at least one of fruit rot and root rot.

3. The use of the non-toxigenic Aspergillus flavus according to claim 1 in the preparation of a preparation for biological control of Aspergillus flavus and peanut disease control, characterized in that: The peanut disease is at least one of fruit rot and root rot.

4. A biological bacterial agent, characterized in that: The active ingredient is the APqn-3 strain with a deposit number of CGMCC NO.40537.

5. The biological agent according to claim 4, characterized in that: The number of Aspergillus flavus spores in the biological agent is ≥ 10 8 Pieces / g.

6. The biological agent according to claim 5, characterized in that: The preparation method is as follows: (1) Preparation of inoculant culture medium: collect soil from peanut fields, remove stones and dead grass, mix soil and distilled water in a mass ratio of 2:1-1:1, and sterilize at 121°C for 20 min; (2) Inoculate the activated non-toxic Aspergillus flavus strain APqn-3 onto the sterilized soil and culture it at 30°C for 5-8 days, shaking it once a day to allow the Aspergillus flavus to grow evenly on the culture medium; after the culture is completed, dry the soil culture medium at 45°C; (3) adding sterilized distilled water to the soil culture medium dried in step (2) at a mass ratio of 2:1 to 1:1 between soil and distilled water, and then inoculating the activated non-toxic Aspergillus flavus strain APqn-3 onto the dried culture medium, culturing again at 30° C. for 8-10 days, and drying at 45° C.; (4) Add sterile distilled water to the soil culture medium dried in step (3) at a mass ratio of 2:1 to 1:1 between soil and distilled water, and then inoculate the activated non-toxic Aspergillus flavus strain APqn-3 onto the dried culture medium, culture again at 30°C for 10-12 days, and dry at 45°C.

7. Use of the biological agent according to any one of claims 4 to 6 in the biological control of Aspergillus flavus and the control of peanut diseases, characterized in that: The peanut disease is at least one of fruit rot and root rot.

8. A method for biological control of Aspergillus flavus and peanut diseases, characterized in that: Before sowing peanuts, the biological agent and organic fertilizer described in any one of claims 4 to 6 are evenly spread in the peanut field, and the field is plowed and swollen to evenly disperse the biological agent and organic fertilizer in the peanut soil; the peanut disease is at least one of fruit rot and root rot.

9. The method for biological control of Aspergillus flavus and peanut diseases according to claim 8, characterized in that: The usage of biological agent is 30kg / mu.

Images