A non-toxic aflatoxin Aspergillus flavus strain APqn-2, its preparation and its application in inhibiting toxin-producing fungi

Abstract

The invention discloses a non-toxic Aspergillus flavus APqn-2, a preparation thereof and an application thereof in inhibiting toxic fungi, and belongs to the field of microbial technology. The strain is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration Committee, and the deposit number is CGMCC No.40536. The non-toxic Aspergillus flavus APqn-2 provided by the invention has a significant inhibitory effect on the growth and toxin production of toxin-producing Aspergillus flavus, Aspergillus ochraceus, Fusarium graminearum and Fusarium moniliforme, is beneficial to the planting and storage of crops such as peanuts and corn, and has broad application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a non-toxigenic aflatoxin Aspergillus flavus APqn-2, a preparation thereof and an application thereof in inhibiting toxigenic fungi. Background Art

[0002] Food crops (such as peanuts and corn) are very susceptible to mold contamination during growth, harvesting, storage, transportation and processing, which seriously threatens the health of humans and animals. The main toxic fungi in peanuts are Aspergillus flavus, and the toxic fungi in corn are mainly Aspergillus flavus, Aspergillus ochraceus, Fusarium graminearum and Fusarium moniliforme, which can produce a variety of toxic secondary metabolites, such as aflatoxins, zearalenone, ochratoxins and fumonisins. These fungal toxins have harmful effects such as teratogenicity, carcinogenesis and nephrotoxicity. Crops are also prone to diseases during their growth under natural conditions, and these diseases often cause huge losses to the agricultural economy. Ordinary chemical drugs have been widely used for many years due to their quick effect and good results. However, a series of disadvantages such as environmental pollution, destruction of ecological balance, impact on agricultural product quality, and harm to human and animal health caused by the long-term and large-scale use of chemical drugs have also emerged.

[0003] Using biology to control diseases can not only avoid the drawbacks of chemical control, but also maintain ecological balance, save energy, reduce costs, and its control effect is more stable and lasting, which has gradually attracted people's attention. Biological control refers to the method of using organisms in nature or their metabolites to control plant diseases. The use of microbial control is to achieve the purpose of one or a class of microorganisms or their products inhibiting another or another class of harmful organisms through certain biological characteristics and ecological phenomena of microorganisms and various organisms.

[0004] Non-toxic Aspergillus flavus cannot produce toxins because of the lack of one or some key genes in its aflatoxin synthesis gene cluster, which makes it a prerequisite for competing with toxin-producing fungi and inhibiting toxin production. Non-toxic Aspergillus flavus is applied in the field to regulate the microbial flora in the soil, gradually replacing the original toxin-producing strains in the soil during the growth of crops, thereby reducing the possibility of agricultural products being infected by Aspergillus flavus, which is very effective for pre-production prevention and control of fungal toxin contamination of crops. Currently, most of the non-toxic Aspergillus flavus isolated from the soil have only been studied in the laboratory to inhibit the growth of toxin-producing Aspergillus flavus. It has weak field adaptability and no growth advantage in the field, and cannot inhibit the toxin-producing Aspergillus flavus. At the same time, it does not have a good inhibitory effect on other toxin-producing fungi. Therefore, it is very important to provide a native Aspergillus flavus that does not secrete aflatoxin, which can inhibit the production of multiple mycotoxins in crops, and prepare it into a biological preparation that adapts to complex environments, which is very important for the biological control of toxin-producing Aspergillus flavus and the prevention of aflatoxin contamination of agricultural products. Summary of the invention

[0005] The invention provides a non-toxigenic Aspergillus flavus APqn-2 strain, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration with a deposit number of CGMCC No.40536.

[0006] The non-toxigenic Aspergillus flavus APqn-2 has a significant inhibitory effect on the growth and toxin production of toxigenic Aspergillus flavus, Aspergillus ochraceus, Fusarium graminearum and Fusarium moniliforme.

[0007] The present invention provides application of the non-toxic aflatoxin fungus APqn-2 in preventing and controlling crop disease fungi.

[0008] The present invention provides the use of the non-toxigenic aflatoxin APqn-2 in inhibiting toxin production by crop disease fungi.

[0009] The present invention provides the use of the non-toxigenic Aspergillus flavus APqn-2 in the preparation of a preparation for preventing and controlling crop disease fungi or inhibiting the toxin production of crop disease fungi.

[0010] The invention provides a crop disease fungus inhibitor, which contains the non-toxic aflatoxin Aspergillus flavus APqn-2.

[0011] In a specific embodiment, the crop disease fungal inhibitor of the present invention is prepared by the following method:

[0012] The strain APqn-2 is inoculated on an MEA medium and cultured at 30°C for 3-5 days until yellow-green spores are produced; field soil is collected, impurities such as stones and dead grass are removed, soil, wheat and distilled water are mixed in a mass ratio of 1-2:0.02-0.05:1, and sterilized at 121°C for 20 minutes to prepare a culture medium; the activated strain APqn-2 is inoculated on the soil culture medium, cultured at 30°C for 5-8 days, and shaken once a day to allow the strain APqn-2 to grow evenly on the culture medium; after the culture is completed, water 5 times the mass of the culture medium is added to the soil culture medium, and the culture is statically cultured at 30°C for 3-5 days. After the culture is completed, the soil culture medium is placed in a 45°C oven for drying to prepare a crop disease fungal inhibitor.

[0013] In the above soil culture medium, the mass ratio of soil, wheat and distilled water is selected from 1.5:0.03:1.

[0014] The present invention provides a method for preventing and controlling crop disease fungi, which comprises the following steps: uniformly spreading the crop disease fungi inhibitor in the crop field, and evenly dispersing the inhibitor in the soil by ploughing and hoeing the soil, so as to prevent and control the crop disease fungi.

[0015] In the above control method, the usage amount of the crop disease fungus inhibitor is selected from 10 to 50 kg / mu, preferably 30 kg / mu.

[0016] In the present invention, the crops include but are not limited to peanuts and corn; the pathogenic fungi include but are not limited to toxigenic Aspergillus flavus, Aspergillus ochraceus, Fusarium graminearum and Fusarium moniliforme.

[0017] The beneficial effects of the present invention are:

[0018] The invention provides a non-toxin-producing Aspergillus flavus APqn-2, which can significantly inhibit the growth and toxin production of toxin-producing Aspergillus flavus, Aspergillus ochraceus, Fusarium graminearum and Fusarium moniliforme, is beneficial to the planting and storage of crops such as peanuts and corn, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The growth morphology of soil bacteria suspension on modified red Bengal medium;

[0020] Figure 2 The morphology of strain APqn-2 grown on modified red Bengal medium;

[0021] Figure 3 The morphology of strain APqn-2 in malt extract agar medium (MEA medium);

[0022] Figure 4 The morphology of strain APqn-2 in chloranil 18% glycerol medium (DG18 medium);

[0023] Figure 5 The morphology of strain APqn-2 in aspergillus agar basal medium (AFPA medium);

[0024] Figure 6 To determine the aflatoxin content in the fermentation broth of strain APqn-2. DETAILED DESCRIPTION

[0025] The culture medium adopted in the present invention is as follows:

[0026] (1) Improved Red Bengal Medium

[0027] Basic formula of culture medium:

[0028] 3g sucrose, 3g sodium nitrate, 0.3g potassium dihydrogen phosphate, 0.7g potassium hydrogen phosphate, 0.5g magnesium sulfate heptahydrate, 0.5g potassium chloride, 10g sodium chloride, 20g agar powder, 50mg chloramphenicol, trace nutrients, antibiotics.

[0029] Among them, trace nutrients ( / L): 0.7 mg borax, 0.5 mg ammonium molybdate, 10 mg iron sulfate, 0.3 mg copper sulfate pentahydrate, 0.11 mg manganese sulfate monohydrate, 17.5 mg zinc sulfate heptahydrate. The trace nutrients are dissolved at pH 2.0 (adjusted with HCl). Before sterilization, 1 mL of trace nutrient solution is added to 1 L of culture medium.

[0030] Preparation method of culture medium: Sucrose, inorganic salts and trace nutrients and 5 mL of Bengal red are dissolved in a certain volume of deionized water, the pH value is adjusted to 6.5, agar is added, heated and stirred until dissolved, and then chloramphenicol is added, sterilized at 121°C for 15 minutes, the culture medium is cooled to 50-60°C, and then chloranilamine (10 mg / L) and streptomycin (50 mg / L) are added, and after 5-10 minutes, it is added to the plate (15-20 mL / plate).

[0031] Malt extract agar (MEA medium): 30g malt extract, 3g soy peptone, 15g agar, add distilled water to prepare 1L.

[0032] Chlorhexidine 18% glycerol medium (DG18 medium): 5 g casein peptone, 10 g anhydrous glucose, 1 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate, 0.002 g chlorhexidine, 15 g agar, 0.1 g chloramphenicol, dissolve in 1000 mL of distilled water, add 200 g of glycerol, mix well, and sterilize at 121°C.

[0033] AFPA medium: 10 g peptone, 20 g yeast extract powder, 0.5 g ammonium ferric citrate, 0.002 g ammonium chlornitrate, 0.1 g chloramphenicol, 15 g agar, pH 6.3.

[0034] In the present invention, the toxin-producing Aspergillus flavus, Aspergillus ochraceus, Fusarium graminearum and Fusarium moniliforme are all isolated and obtained by the applicant himself.

[0035] 1. Isolation of bacterial strains

[0036] The sampling site was peanut planting soil in Zhanjiang, Guangdong, and the sampling time was May 2018. Five subsamples (2 cm wide and 5 cm deep soil) were taken diagonally within the range of 10×10m, 100g of each sample, and mixed as one sample. The collected samples were put into plastic bags, pierced with pinholes to facilitate gas exchange, transported to the laboratory, and stored at 4°C for aflatoxin screening. Take 10g of soil sample, add 90mL of 0.1% peptone sterile water (w / v), shake at room temperature for 30min, and make 10 -1 Bacterial suspension; then take 0.5mL 10 -1 Add 4.5 mL of 0.1% peptone sterile water to the bacterial suspension to prepare 10 -2 Dilution of bacterial suspension; prepare 10 -3 Take 0.1 mL of bacterial suspension for each dilution and spread it on a modified red Bengal medium. Culture it in the dark at 30°C for 5 days. Repeat each dilution 3 times. The growth of the strain is as follows: Figure 1 The strain with yellow-green spores was selected and streaked twice on the modified red Bengal medium until a single colony was obtained, as shown in FIG. Figure 2 A single colony of the strain was selected and placed on malt extract agar medium (MEA medium), cultured at 30°C for 3 days and then stored at 4°C. Figure 3 Through the above method, a single mold strain was isolated and obtained, and the strain was numbered as APqn-2.

[0037] 2. Identification of bacterial species

[0038] According to the method described in the Bergey's Manual of Bacterial Identification (8th edition), strain APqn-2 was identified by morphological characteristics and physiological and biochemical characteristics. The specific results are as follows:

[0039] (1) Morphological characteristics

[0040] This strain produces yellow-green spores on modified Bengal red medium, with opaque colonies and white hyphae. It produces yellow spores on DG18 medium, such as Figure 4 As shown. A bright orange color reaction is produced on AFPA medium, such as Figure 5 shown.

[0041] (2) Genetic identification

[0042] The strain APqn-2 was molecularly identified by ITS gene sequencing.

[0043] The primers used for amplification of the ITS of the Aspergillus flavus genome are:

[0044] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' (SEQ ID NO: 1);

[0045] ITS4: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO: 2).

[0046] PCR amplification conditions: PCR amplification reaction program: 94℃ pre-denaturation for 5min, 1 cycle; 94℃ denaturation for 30s, 54℃ annealing for 30s, 72℃ extension for 90s, 30 cycles; 72℃ final extension for 7min. After amplification, the product was stored at 4℃. The product was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared on BLAST researches (http: / / www.ncbi.nlm.nih.gov / ).

[0047] Sequencing revealed that the ITS sequence of strain APqn-2 is as follows:

[0048] 5'-GAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGT TTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATC GCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCC CCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGAT CCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA-3'(SEQ ID NO:3)

[0049] ITS sequence comparison showed that the ITS gene sequence of strain APqn-2 was 100% similar to the GrM small subunit ribosomal RNA gene sequence of Aspergillus flavus. Universal primers were used to detect the expression of toxin-producing genes in strain APqn-2. The results showed that 11 key toxin-producing genes, norB-cypA, aflT, pksA, nor-1, aflR, adhA, norA, ver-1, hypC, hypB and moxY, in the toxin-producing gene cluster of strain APqn-2 were not expressed, so the strain did not produce toxins. Based on morphological identification and combined with the results of molecular biological identification, strain APqn-2 was finally identified as a non-aflatoxin-producing Aspergillus flavus.

[0050] The strain was deposited on March 24, 2023 in the General Microbiology Center of China Microorganism Culture Collection (CGMCC for short, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101), with the deposit number CGMCC NO.40536.

[0051] Other materials used in the present invention, if not otherwise stated, can be obtained through commercial channels. Other terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention is further described in detail below in conjunction with specific examples and with reference to data. The following examples are only for illustrating the present invention, and are not intended to limit the scope of the present invention in any way.

[0052] Example 1

[0053] Strain APqn-2 toxin production verification:

[0054] (1) Toxicity culture

[0055] Strain APqn-2 was inoculated on MEA slant test tube culture medium and cultured at 28°C for 3 days to activate it; 4 mL of sterile water was added to the slant test tube culture medium and rinsed to obtain strain APqn-2 suspension. The number of spores was recorded using a hemocytometer under a microscope. 10 mL of toxin-producing culture medium was added to a 50 mL centrifuge tube, and a certain amount of Aspergillus APqn-2 suspension was added to make the final spore concentration 10 5 / mL and cultured at 30°C and 200 rpm for 7 days.

[0056] The composition of the toxin-producing culture medium is: 150g sucrose, 20g yeast extract, 10g soy peptone, 1000mL distilled water, pH 5.9.

[0057] (2) Aflatoxin determination

[0058] The aflatoxin in the fermentation broth was detected by immunoaffinity chromatography purification, liquid chromatography separation, and fluorescence detector detection. The specific operation is as follows: 2 mL of fermentation broth is passed through the immunoaffinity chromatography column at a flow rate of 3 mL per minute, eluted twice with 20 mL of water, the eluent is discarded, air is allowed to enter the column, water is squeezed out of the column, and then eluted with 1.5 mL of methanol in batches, the eluent is collected, concentrated to 0.7 mL, and diluted to 1 mL with water, shaken, loaded, separated by high performance liquid chromatography, and detected by fluorescence detector.

[0059] Chromatographic conditions: the chromatographic column is Venusil MP C18 (5μm, 4.6mm×150mm); the column temperature is 40℃; the mobile phase is methanol:water (V:V=45:55); the flow rate is 1.3mL / min; post-column photochemical derivatization method is adopted: photochemical derivatizer 254nm; detection is carried out with a fluorescence detector, excitation wavelength is 360nm, emission wavelength is 450nm, and injection volume is 20μL.

[0060] The test results are as follows Figure 6 shown.

[0061] No aflatoxin was detected in the toxin-producing fermentation broth of strain APqn-2, further confirming that strain APqn-2 is a non-toxigenic Aspergillus strain.

[0062] Example 2

[0063] Toxigenicity inhibition test:

[0064] (1) Preparation of culture medium

[0065] Select intact corn and peanut kernels without damage, then weigh 10 g of peanuts and corn of uniform size respectively, and sterilize them at 121°C for 15 minutes.

[0066] (2) Preparation of bacterial suspension

[0067] Toxin-producing Aspergillus flavus, Aspergillus ochraceus, Fusarium graminearum, and Fusarium moniliforme were inoculated on MEA slant test tube culture medium, cultured at 20°C for 5 days, and then the spores on the culture medium were dipped into sterile water with a cotton swab and vortexed evenly. The spore concentration was then adjusted to 2×10 4 Spores / mL, set aside.

[0068] The spore concentration of strain APqn-2 was adjusted to 2 × 10 using a hemocytometer. 4 spores / mL, and obtain the spore suspension of strain APqn-2 for later use.

[0069] (3) Inhibitory effect test

[0070] Add 1 mL of strain APqn-2 spore suspension and toxin-producing bacteria spore suspension (10 4 :10 4 ) as the experimental group. Then add 1 mL of toxin-producing bacteria (10 4 ) and sterile water in equal volumes as the positive control group, and the bottle was gently shaken to cover the spores on the peanuts and corn. Each group was made in triplicate and cultured at 30°C in the dark for 14 days.

[0071] (4) Determination of mycotoxin content

[0072] The cultured corn and peanut samples were placed in an autoclave and sterilized at 121°C for 30 minutes (to inactivate the mold); the sterilized samples were crushed in a high-speed universal grinder, and then 50 mL of 80% methanol was added to a conical flask, and the samples were shaken at high speed for 30 minutes using an oscillator, and then filtered with sterilized filter paper, and the extract was measured using HPLC.

[0073] The test results are shown in Table 1:

[0074] Table 1

[0075]

[0076]

[0077] As shown in Table 1, strain APqn-2 can inhibit the production of toxins by Aspergillus flavus in peanuts and the production of toxins by four toxin-producing fungi in corn; the efficiency of inhibiting the production of aflatoxin B1 by Aspergillus flavus in peanuts is 92.96±0.94%; in corn, the efficiency of inhibiting the production of zearalenone by Fusarium graminearum is 82.17±0.94%, the efficiency of inhibiting the production of ochratoxin A by Aspergillus ochraceus is 74.36±0.63%, and the efficiency of inhibiting the production of fumonisin b1 by Fusarium moniliforme is 77.31±0.54%. The toxin production inhibition effect is very significant.

[0078] Example 3

[0079] Field application:

[0080] 1. Preparation of inhibitors of toxin-producing fungi

[0081] (1) Inhibitor A

[0082] The strain APqn-2 was inoculated on the MEA medium and cultured at 30°C for 3-5 days until yellow-green spores were produced. Field soil was collected, and impurities such as stones and dead grass were removed. The soil, wheat and distilled water were mixed in a mass ratio of 1.5:0.03:1, and sterilized at 121°C for 20 minutes as a culture medium. The activated strain APqn-2 was inoculated on the above culture medium and cultured at 30°C for 8 days, shaking once a day to allow the strain APqn-2 to grow evenly on the culture medium. After the culture was completed, 5 times the mass of the culture medium was added to the culture medium, and the culture was cultured at 30°C for 5 days. After the culture was completed, the culture medium was placed in a 45°C oven for drying to prepare the toxin-producing fungal inhibitor A, which can be stored at room temperature.

[0083] (2) Inhibitor B

[0084] The strain APqn-2 was inoculated on the MEA medium and cultured at 30°C for 5 days until yellow-green spores were produced. The MEA medium full of spores was dried in an oven at 45°C and crushed to obtain the toxin-producing fungus inhibitor B.

[0085] (3) Inhibitor C

[0086] The strain APqn-2 was inoculated on the MEA medium and cultured at 30°C for 5 days until yellow-green spores were produced. Field soil was collected, and impurities such as stones and dead grass were removed. The soil, wheat and distilled water were mixed in a mass ratio of 1.5:0.03:1, and sterilized at 121°C for 20 minutes to serve as the culture medium. The activated strain APqn-2 was inoculated on the above culture medium and cultured at 30°C for 8 days, shaking once a day to allow the strain APqn-2 to grow evenly on the culture medium. After the culture was completed, the culture medium was dried in an oven at 45°C to obtain the toxin-producing fungal inhibitor C.

[0087] 2. Field application method

[0088] The inhibitor and organic fertilizer were evenly spread in the peanut field and corn field that were not sown in spring. The amount of inhibitor used was 30kg / mu. The fields were plowed and swirled to evenly disperse the inhibitor and organic fertilizer in the soil, which was used as the test group. The group without the inhibitor was the blank group; other daily management of the test group and the control group was the same. Soil samples were taken before the application of the inhibitor and at the time of harvest after the application of the fungus, and the number of bacteria in the soil samples was detected and the Aspergillus flavus was isolated and identified. The changes in the number of toxic fungi in the soil samples before and after the application of the inhibitor were compared.

[0089] The test results are shown in Table 2:

[0090] Table 2 Inhibitory effect of antagonists on soil bacteria

[0091]

[0092] As shown in Table 2, after the application of strain APqn-2, the number of toxic fungi in the soil of each group was significantly inhibited. At the same time, the inhibitor A had the most significant antibacterial effect. It can be seen that different preparation methods of inhibitors have an important influence on the inhibition of toxic fungi. The inhibitor (inhibitor B) prepared with microbial conventional agar medium (MEA) as the culture medium has a significantly lower inhibitory effect on toxic Aspergillus flavus in peanut planting areas and toxic Aspergillus flavus, Fusarium graminearum, Aspergillus ochraceus and Fusarium moniliforme in corn planting areas than the other two inhibitors prepared with soil as the culture medium. The reason may be that the inhibitor has increased its survival ability in the soil after liquid-solid co-culture, thereby increasing its inhibitory ability to toxic fungi. This shows that the preparation of inhibitors with soil as the culture medium is more suitable for field application and improves the survival ability of strain APqn-2 in the field. From the comparison between inhibitor A and inhibitor C, in the process of preparing inhibitors, solid-liquid combined culture can better improve the inhibitory ability of the bacterial agent against toxic fungi than solid culture alone; the reason may be that non-toxic fungi use low-nutrient soil as a culture medium, after solid culture, drying, and then liquid culture and drying, can better adapt to various environments in the soil and enhance stress resistance.

[0093] 3. Storage and toxin determination of corn and peanuts

[0094] Each sub-sample of corn and peanuts harvested in the above experiment was dried and weighed separately, and then placed in seed bags and stored in a dry and cool place. The mycotoxin content in corn and peanuts stored for 0, 1, 2, 3, 4, 5, 6, 7, and 8 months was determined, and the ability of inhibitor A to inhibit the production of mycotoxins was calculated compared with the control group.

[0095] The test results are shown in Table 3 and Table 4:

[0096] Table 3 Changes of aflatoxin content in peanuts during storage

[0097]

[0098] As shown in Table 3, the peanuts planted in the control group (without inhibitors) were detected with aflatoxin B1 after 1 month of storage as the storage time increased. As the storage time increased, the aflatoxin B1 content continued to increase. After 7 months of storage, the aflatoxin content was 20.3±0.6μg / kg, exceeding the national limit of 20μg / kg. The aflatoxin exceeded the standard and could not be eaten. After the inhibitor was applied, no aflatoxin was detected within 7 months of storage, indicating that applying the inhibitor to the peanut planting area can significantly reduce the risk of peanut infection with Aspergillus flavus. The reason may be that after the non-toxic Aspergillus flavus is applied to the peanut planting area, it can form a dominant strain in the peanut planting area, inhibiting the growth and reproduction of toxic Aspergillus flavus in the peanut field, thereby reducing the infection of toxic fungi in peanuts.

[0099] Table 4 Changes in mycotoxin content in corn during storage

[0100]

[0101]

[0102] As shown in Table 4, the corn planted in the control group (without inhibitors) detected aflatoxin B1 and zearalenone after 1 month of storage, and ochratoxin A and fumonisin B1 after 2 months of storage. The content of each fungal toxin increased with the extension of storage time. After 8 months of storage, the content of aflatoxin B1, zearalenone and fumonisin B1 was 25.3±0.4μg / kg, 75.4±0.3μg / kg and 4005.4±7.5μg / kg, respectively, exceeding the respective national limit standards of 20μg / kg, 60μg / kg and 4000μg / kg; after 6 months of storage, the content of ochratoxin A was 6.3±0.2μg / kg, exceeding the national limit standard of 5μg / kg. After the inhibitor was applied, the above toxins were not detected within 7 months of storage, indicating that applying the inhibitor to corn fields can significantly reduce the risk of corn being infected by the above molds. The reason may be that after the non-toxic Aspergillus flavus is applied to corn fields, it can form a dominant strain in the corn fields, inhibiting the growth and reproduction of various toxic fungi in the corn fields, thereby reducing the infection of toxic fungi in corn.

[0103] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A strain of non-toxic aflatoxin ( Aspergillus flavus )APqn-2, characterized in that, The strain is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration with the deposit number CGMCC No. 40536.

2. The use of the non-toxic Aspergillus flavus APqn-2 according to claim 1 in preventing and controlling fungi causing crop diseases; the crop is peanut or corn; the fungus is toxic Aspergillus flavus ( Aspergillus flavus ), Aspergillus ochraceus ( Aspergillus ochraceus graminearum ( Fusarium graminearum ) or Fusarium moniliforme ( Fusarium moniliforme ).

3. Use of the non-toxigenic Aspergillus flavus APqn-2 according to claim 1 in the preparation of a preparation for preventing and controlling crop disease fungi; the crop is peanut or corn; the fungus is toxigenic Aspergillus flavus, Aspergillus ochraceus, Fusarium graminearum or Fusarium moniliforme.

4. A crop disease fungus inhibitor, characterized in that: Contains the non-toxic aflatoxin Aspergillus flavus APqn-2 described in claim 1.

5. The crop disease fungus inhibitor according to claim 4, characterized in that: The preparation method of the crop disease fungus inhibitor is as follows: The strain APqn-2 is inoculated on an MEA medium and cultured at 30°C for 3-5 days until yellow-green spores are produced; field soil is collected, stones and dead grass are removed, soil, wheat and distilled water are mixed in a mass ratio of 1-2:0.02-0.05:1, and sterilized at 121°C for 20 minutes to use as a culture medium; the activated strain APqn-2 is inoculated on the soil culture medium, cultured at 30°C for 5-8 days, and shaken once a day to allow the strain APqn-2 to grow evenly on the culture medium; after the culture is completed, water 5 times the mass of the culture medium is added to the soil culture medium, and the culture is statically cultured at 30°C for 3-5 days. After the culture is completed, the soil culture medium is placed in a 45°C oven for drying to prepare a crop disease fungal inhibitor.

6. The crop disease fungus inhibitor according to claim 5, characterized in that: In the soil culture medium, the mass ratio of soil, wheat and distilled water is selected from 1.5:0.03:

1.

7. A method for preventing and controlling crop disease fungi, characterized in that: The steps are as follows: evenly spreading the crop disease fungus inhibitor according to claim 4 in the crop field, and evenly dispersing the inhibitor in the soil by plowing and hoeing the soil, so as to achieve the purpose of preventing and controlling crop disease fungi; The crop is peanut or corn; the fungus is toxigenic Aspergillus flavus, Aspergillus ochraceus, Fusarium graminearum or Fusarium moniliforme.

8. The method according to claim 7, characterized in that The usage amount of the crop disease fungus inhibitor is selected from 10 to 50 kg / mu.

9. The method according to claim 8, characterized in that The dosage of crop disease fungal inhibitor is 30kg / mu.

Images