A molecular marker combination associated with lignin content in rapeseed straw and its application

Abstract

The present invention belongs to the technical field of plant genetic breeding, and provides a combination of molecular markers associated with the lignin content of rapeseed straw and its application. The present invention provides QTL regions located in two regions on the C9 chromosome of rapeseed, and the AA or AG genotype of SNP6020 under the QTL site qBnADL.C09.1 and the AA or AC genotype of SNP54552 under qBnADL.C09.2 have significantly higher lignin content than other genotypes. By performing haplotype identification on these QTL regions, the lignin level of rapeseed straw can be predicted. Therefore, based on the haplotype of the rapeseed variety (line), a suitable molecular genotype or transgenic method is selected to improve the lignin content in the rapeseed straw, thereby improving the current situation of rapeseed lodging in the field, enhancing the disease resistance of rapeseed, and further increasing the yield of rapeseed.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic breeding, and in particular relates to a molecular marker combination associated with the lignin content of rapeseed straw and an application thereof. Technical Background

[0002] Rapeseed is an important oil crop, which is widely planted around the world. The lodging of rapeseed will greatly reduce the yield and oil content of rapeseed, and the lodging of rapeseed during the flowering period will cause a more serious yield reduction, which can reach 46%. The higher the degree of lodging, the greater the impact on yield and oil content, and the lodging of straw causes more yield reduction than the root. At present, the lodging of rapeseed in the field has become an important factor in the reduction of rapeseed yield. Several studies have confirmed that the content of lignin in the stem part of crops is correlated with the lodging of crops. In the study of crops such as wheat, soybeans, and oats, the content of lignin in the stem has a significant positive correlation with the lodging resistance of crops. Lignin, hemicellulose, and cellulose are the main components of cell walls. These fiber components have different effects at different stages of crop growth and different positions of crops. Lignin is a high polymer of cinnamyl alcohol, coniferyl alcohol, and sinapyl alcohol monomers. It can be deposited in the cell wall of plant tissues to enhance the stem strength of plants. The strength of the stem is an important indicator of plant resistance to lodging. Lignification is one of the important means for plants to adapt to terrestrial survival. Although the characteristics of wall polymers in plants are roughly the same, the ratio of different lignin monomers will also change the lodging resistance of crops. By applying organic carbon and silicon to increase the activity of lignin-related synthases, the lignin content increases, which enhances the lodging resistance of rapeseed. Therefore, studying the genes that can regulate the synthesis of lignin in rapeseed straw is of great significance to the study of rapeseed's lodging resistance.

[0003] The negative effects of lignin in bioenergy production are mainly reflected in the following aspects: 1. Hindering the saccharification process: Lignin can hinder the saccharification process of biomass, making it difficult to extract fermentable sugars from biomass. This is because lignin will wrap around cellulose and hemicellulose, preventing the action of enzymes. 2. Reduce calorific value: The presence of lignin will reduce the calorific value of biomass, because the calorific value of lignin is usually lower than that of cellulose and hemicellulose. 3. Increase pretreatment costs: In order to overcome the problems caused by lignin, pretreatment steps such as steam explosion, acid treatment or alkali treatment are required, which will increase the cost of bioenergy production. 4. Environmental issues: The decomposition of lignin may produce some harmful substances, such as phenolic compounds, which may have an impact on the environment. Therefore, reducing the lignin content in rapeseed straw can be beneficial to the degradation of rapeseed straw and its use as biomass.

[0004] In recent years, with the rapid development of rapeseed molecular biology, many QTLs controlling rapeseed yield traits have been located, but the genetic basis of rapeseed straw utilization and its biomass composition is almost blank, and there are even fewer studies on corresponding genetic improvement through single ploid selection of rapeseed. By studying the genes that affect the lignin content of rapeseed straw, it is possible to regulate the lignin content in rapeseed straw, thereby improving the lodging resistance of rapeseed or improving the conversion efficiency of biomass in straw. Screening genes that affect rapeseed straw lignin provides new ideas for improving rapeseed traits. Summary of the invention

[0005] The object of the present invention is to provide an application of a reagent for detecting base 54552506 of chromosome C09 of the reference genome of Brassica napus ZS11.V0 in the breeding of Brassica napus straw lignin content.

[0006] Another object of the present invention is to provide a reagent for detecting bases 6020367 and 54552506 of chromosome C09 of the reference genome of Brassica napus ZS11.V0 and its application in the breeding of lignin content in straw of Brassica napus.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] The applicant conducted association analysis through natural populations of 124 rapeseed lines, using the selected SNP and INDEL loci as genotype data, using the straw lignin content under three environments to calculate their breeding value BLUP as their phenotypic data, using the Q+K mixed linear model for genome-wide association analysis, using -log10P>6 as the threshold, and identified two QTL loci, named qBnADL.C09.1 and qBnADL.C09.2, with effect values ​​of 6.73 and 6.96, respectively. For these two loci, two SNP molecular markers SNP6020 and SNP54552 were found by comparison, among which SNP6020 is located at base 6020367 of chromosome C09 of the reference genome of Brassica napus ZS11.V0, and SNP54552 is located at base 54552506 of chromosome C09 of the reference genome of Brassica napus ZS11.V0.

[0009] The protection scope of the present invention includes:

[0010] Application of a reagent for detecting base 54552506 of chromosome C09 of the reference genome ZS11.V0 of Brassica napus in the breeding of lignin content in straw of Brassica napus;

[0011] In the above-mentioned application, preferably, the reagent is a primer, and detection primers can be designed for the base using conventional techniques in the art.

[0012] Preferably, the KASP primers designed for the SNP54552 molecular marker are:

[0013] The KASP upstream primer HEX2 sequence is 5'- GAAGGTGACCAAGTTCATGCTCCAAACAACGAACAAATG CTG -3';

[0014] The sequence of the KASP upstream primer FAM2 is 5'- GAAGGTCGGAGTCAACGGATTACCAAACAACGAACAAAT GCTT -3';

[0015] The sequence of the KASP marker downstream primer R2 was 5′-TGGTAATAATCCTTATATAGTTATGGTTGA-3′.

[0016] Application of reagents for detecting bases 6020367 and 54552506 of chromosome C09 of the reference genome ZS11.V0 of Brassica napus in the breeding of lignin content in straw of Brassica napus;

[0017] In the above-mentioned application, preferably, the reagent is a primer, and detection primers can be designed for the base using conventional techniques in the art.

[0018] Preferably, the KASP primers designed for the SNP54552 molecular marker in the present invention are the same as those described above;

[0019] Preferably, the KASP primers designed for the SNP6020 molecular marker are:

[0020] The sequence of the KASP tag upstream primer HEX1 was 5′-GAAGGTGACCAAGTTCATGCTACTACAGTGCGCTAGTCAAACGA-3′;

[0021] The sequence of the upstream primer FAM1 of KASP labeling is 5'- GAAGGTCGGAGTCAACGGATTAGTGCGCTAGTCGGACGG -3';

[0022] The sequence of the KASP marker downstream primer R1 was 5′-TTTTTGGTAAATCGCTAGGCTC-3′.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] (1) The present invention provides a combination of two SNP loci for selecting high and low levels of lignin content in rapeseed straw, which can be used to selectively select rapeseed resources or lines with high or low levels of straw lignin content. Rapeseed breeders compared varieties or lines with high or low straw lignin content and found that rapeseed with high straw lignin content had good lodging resistance and significantly improved disease resistance. The present invention aims to use the rapeseed straw lignin content level as a measurement and measurement indicator to provide technical support for the selection of varieties or lines with high straw lignin content, provide methods for studying the ideal plant type of rapeseed, and ultimately increase the economic yield of rapeseed.

[0025] (2) The present invention utilizes the preferred markers to identify rapeseed germplasm that meets the breeding goals in the early growth stage of rapeseed, which is of great significance for the early prediction and screening of the lignin content of rapeseed straw, and is also beneficial to improving breeding efficiency and accelerating the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the distribution diagram of straw lignin content of natural population materials in Example 1 of the present invention under three environments.

[0027] Figure 2 The Manhattan plot of the associated sites of rape straw lignin content on the genome based on the Tasselv5.0 mixed linear model (MLM) in Example 1 of the present invention, with a threshold of -Log 10 P>6.

[0028] Figure 3 This is a statistical diagram of the allelic variation and phenotypic significance of straw lignin content in Example 1 of the present invention;

[0029] Among them: the box plot of phenotypic association between the two SNP alleles and lignin content is statistically significant; (*: P<0.05; **: P<0.01).

[0030] Figure 4 The KASP marker typing results developed based on two SNPs for 124 materials of the natural population in Example 1 of the present invention;

[0031] In the figure, green and blue represent two alleles, red represents heterozygous genotype, black represents undetected, and gray represents negative control water. DETAILED DESCRIPTION

[0032] The following examples will further illustrate the specific steps and features of the invention, which are for illustrative purposes only and are not intended to limit the invention. The methods used in the present invention are conventional methods in the art unless otherwise specified. The reagents and materials involved in the present invention are commercially available unless otherwise specified. In the embodiments of the present invention, unless otherwise specified, the reference genome is the ZS11.v0 version of the Zhongshuang11 reference genome, https: / / yanglab.hzau.edu.cn / BnIR / germplasm_info? id=ZS11.v0.

[0033] Embodiment 1:

[0034] Discovery of molecular markers associated with lignin content in rapeseed straw:

[0035] 1. Determination of straw lignin

[0036] This experiment used a natural population of 124 rapeseed lines for association analysis. These lines mainly came from varieties and strains in the main rapeseed planting areas in the Yangtze River Basin of China, as well as a small amount of resource materials from Australia and Europe (Table 1). The experimental materials were planted in three environments: Yangluo, Hubei Province, Lu'an, Anhui Province, and Zunyi, Guizhou Province. All experimental planting management was carried out in accordance with local field management and cultivation conditions. Each plot contained three rows, 18 plants per row, and 54 plants in total in each plot. The spacing between rows was 33 cm, the spacing between plants in each row was 11 cm, and the planting density was 270,000 plants per hectare. The determination period of lignin was the maturity of rapeseed. The straw and root neck tissues of rapeseed were taken separately, dried in an oven at 60°C, and then ground into powder. The near-infrared spectral data were collected using the FOSS NIR Systems 2500 near-infrared spectrometer (Chen Xueping, 2018), and the lignin content was determined and analyzed using the established chemical determination-near-infrared model.

[0037] In the present invention, a rape straw lignin content of ≥13% is defined as a high level; a rape straw lignin content of ≤10% is defined as a low level.

[0038] Table 1: Status of 124 rapeseed germplasm materials

[0039]

[0040]

[0041]

[0042] Note: All material information has been published in the form of a paper, see Liu et al., 2016 for details.

[0043] Liu et al., 2016Related information: Liu J#, Wang J#, Wang H, Wang WX, Mei DS, Zhou RJ, Cheng HT, Yang J, Raman H*, Hu Q*. Multigenic control of pod shatteringresistance in Chinese rapeseed ger mplasm revealed by genome-wide association and linkage analyses. Frontiers in Plant Science, 2016,7:1058.

[0044] like Figure 1 As shown in the figure, the change of lignin content in the population is continuous and basically conforms to the normal distribution, indicating that the trait affecting the lignin content of rapeseed may be a quantitative trait. The heritability of the two traits is high, and the genotype effect has a greater impact. The calculation found that the environmental effect under the three environments has a more significant effect on the lignin content. Therefore, we performed the best linear unbiased calculation of the lignin content under the three environments, integrated the traits of multiple environments, removed the environmental effect, and obtained the individual stable genetic phenotype.

[0045] 2. Acquisition of population variation data

[0046] The second-generation sequencing data of 124 strains were mapped to the reference genome to obtain the population variation file. The population variation file was filtered using GATK software, with the parameters set to QD<2.0, FS>50, MQ<20, MQ Ran k Sum>-12.5, and Read Pos Rank Sum>-8.0, and the SNP and INDEL information was extracted and saved as a VCF format file. Plink software was subsequently used for quality control, with the minor allele frequency greater than 0.05 and the missing data less than 10% as the filtering criteria for the population variation data, and 6730436 SNPs and InD el were screened from the variation file for subsequent analysis.

[0047] 3. Genome-wide association analysis

[0048] Use faststrature software to calculate the population structure of the population, try different values ​​of k=1 to 10, and use the shell command line to view the CV error, and select the population structure file with the smallest CV error as the population structure for GWAS analysis. Use emmax to perform mixed linear model (mlm) analysis to evaluate the correlation between SNPs and corresponding traits, use emmax x to generate a kinship matrix, and add the population structure and kinship matrix to the model to eliminate false positives caused by kinship. Use the CMplot package in R3.3.3. to draw Manhattan plots and QQ plots to display the results of GWAS analysis.

[0049] The selected SNP and INDEL loci were used as genotype data, and the BLUP values ​​of the straw lignin content under three environments were used as phenotypic data. The Q+K mixed linear model was used for genome-wide association analysis. The results are shown in the following figure. Figure 2 We used -log10P>6 as the threshold and identified two QTL loci, which were named qBnADL.C09.1 and qBnADL.C09.2 (Table 2, Figure 2 ), where the QTLs located based on straw lignin are qBnADL.C09.1 and qBnADL.C09.2, located on chromosome C09 of rapeseed, with the effect values ​​of the peak sites reaching 6.73 and 6.96, respectively. 10 P>4 determined the range of the effect interval, which was 5926615-6399213 and 54552293-56304260, respectively.

[0050] Table 2: GWAS-localized QTL interval information for rapeseed lignin content

[0051]

[0052] 4. Haplotype analysis

[0053] The double 11 reference genome (ZS11.v0, https: / / yanglab.hzau.edu.cn / BnIR / germplasm_info?id=ZS11.v0) was compared to extract the sequence allele variation of the two peak site SNPs (located at 6020367bp and 54552506bp on the rapeseed genome C9, respectively) (Table 3), and the lignin blup values ​​of the population materials were combined for joint analysis to seek dominant alleles. The information of the two QTL loci related to straw lignin was analyzed. There were three genotypes of SNP6020 at qBnADL.C09.1. After using the T test, it was found that the effects of AA and GG were extremely significant (Table 4,Figure 3 ), the effect between GG and AG is also extremely significant, while the effect between AA and AG is significant. At qBnADL.C09.1, the AA and AG genotypes have higher lignin content and are dominant genotypes (the sequence of the AA genotype is shown in SEQ ID NO.1). At qBnADL.C09.2, SNP54552 has three genotypes, CC, AC and AA. It is found that the effect between CC and AC is extremely significant, the effect between CC and AA is also significant, and the effect between AC and AA is not significant. Among them, the AA and AC genotypes have higher lignin content (the sequence of the AA genotype is shown in SEQ ID NO.4).

[0054] Detect base 6020367 of chromosome C09 of the reference genome of Brassica napus ZS11.V0. If the genotype is AA or AG, it is a genotype with higher lignin content in the stem. If it is GG, it is a material with lower lignin content in the stem. Detect base 54552506 of chromosome C09 of the reference genome of Brassica napus ZS11.V0. If the genotype is AA or AC, it is a material with higher lignin content. If the genotype is CC, it is a material with lower lignin content.

[0055] Table 3: Sequences near candidate sites

[0056]

[0057]

[0058] Table 4: Significance T-test of the peak site variation of the four lignin content effect QTLs

[0059]

[0060] It can also be seen from Table 4 that there are differences in the straw lignin content between different alleles of this site in the validation population, indicating that this site is real and effective and can be used for molecular marker-assisted selection of straw lignin content.

[0061] Based on the above two molecular markers, 6 detection primers were designed for KASP typing:

[0062] Development of KASP marker-specific primers

[0063] For the SNP6020 molecular marker, three primers were designed according to the Seq ID NO.1 and 2 sequences, the upstream primer HEX1 (Seq ID NO.5), the upstream primer FAM1 (Seq ID NO.6) and the downstream primer R1 (Seq ID NO.7), wherein HEX1 and FAM1 contain the HEX and FAM fluorescent linker sequences (underlined), respectively, and the sequences are as follows:

[0064] The sequence of the KASP tag upstream primer HEX1 was 5′-GAAGGTGACCAAGTTCATGCTACTACAGTGCGCTAGTCAAACGA-3′;

[0065] The sequence of the upstream primer FAM1 of KASP labeling is 5'- GAAGGTCGGAGTCAACGGATTAGTGCGCTAGTCGGACGG -3';

[0066] The sequence of the KASP marker downstream primer R1 was 5′-TTTTTGGTAAATCGCTAGGCTC-3′.

[0067] Using this primer, the lignin content of materials with genotypes of AA or AG was high, while the lignin content of materials with genotypes of GG was low ( Figure 4 ).

[0068] For the SNP54552 molecular marker, three primers were designed according to the Seq ID NO.3 and 4 sequences, the upstream primer HEX2 (Seq ID NO.8), the upstream primer FAM2 (Seq ID NO.9) and the downstream primer R2 (Seq ID NO.10), wherein HEX2 and FAM2 contain the HEX and FAM fluorescent linker sequences (underlined), respectively, and the sequences are as follows:

[0069] The KASP upstream primer HEX2 sequence is 5'- GAAGGTGACCAAGTTCATGCTCCAAACAACGAACAAATG CTG -3';

[0070] The sequence of the KASP upstream primer FAM2 is 5'- GAAGGTCGGAGTCAACGGATTACCAAACAACGAACAAAT GCTT -3';

[0071] The sequence of the KASP marker downstream primer R2 was 5′-TGGTAATAATCCTTATATAGTTATGGTTGA-3′.

[0072] Using this primer, the lignin content of materials with genotypes of AA or AC was high, while the lignin content of materials with genotypes of CC was low ( Figure 4 ).

[0073] Embodiment 2:

[0074] Application of molecular marker combination associated with rapeseed straw lignin content in breeding of Brassica napus for lignin content

[0075] This experiment selected another group of rapeseed varieties (lines) for planting (source of materials see reference Xuan et al., 2020. Genome-wide-association study reveals new genes involved in leaftrichome formation in polyploid oilseed rape (Brassica napus). Plant Cell and Environment 43: 675-691), and the planting site was at the Yangluo Experimental Base in Hubei Province in 2020. All experimental planting management was carried out in accordance with local field management and cultivation conditions. Each plot contains three rows, 18 plants per row, and a total of 54 plants in each plot. The spacing between rows is 33 cm, the spacing between plants in each row is 11 cm, and the planting density is 270,000 plants per hectare. The period for the determination of lignin was the rapeseed maturity period. The rapeseed straw was taken and dried in an oven at 60°C. It was then ground into powder and its near-infrared spectral data was collected using a FOSS NIR Systems 2500 near-infrared spectrometer (Chen Xueping, 2018). The lignin content was determined and analyzed using the established chemical determination-near-infrared model.

[0076] The genomic DNA of 289 core rapeseed germplasms at the five-leaf stage was extracted respectively, and the genomic DNA was used as a template and KASP-labeled special primers were used for PCR amplification to obtain PCR amplification products. PCR amplification was carried out in an ABI7500 real-time fluorescence quantitative PCR instrument. After the PCR, the instrument can perform genotyping according to the fluorescence signal. The amplification system is a 10μl reaction system: rapeseed sample DNA template, 60ng / μl, 1μl; 2×KASPMastermix5μl; KASPAssayMix, HEX:FAM:R=2:2:5, 0.14μl; water 4μl. The reaction conditions include 94℃ pre-denaturation for 15min; 94℃ denaturation for 20sec, 61~55℃ annealing for 60sec, reducing 0.6℃ for each cycle, 10 cycles; 94℃ denaturation for 20sec, 55℃ annealing for 60sec, 26 cycles.

[0077] After the reaction is completed, the Bio-rad CFX96 Touch fluorescent quantitative PCR instrument can directly read the fluorescent data of the PCR reaction products. The results of the fluorescent scan will be automatically converted into a graph, and the two pairs of labeled primers can clearly separate the two genotypes.

[0078] For SNP6020 marker, the green dots close to the Y-axis and away from the X-axis are the A allele variant sites, and the genotype is AA; the blue dots close to the X-axis and away from the Y-axis are the G allele variant sites, and the genotype is GG; the middle red dots are the heterozygous genotype AG; and the gray dots are the control.

[0079] SNP54552 marker, the green dots close to the Y-axis and away from the X-axis are the C allele variant sites, and the genotype is CC; the blue dots close to the X-axis and away from the Y-axis are the A allele variant sites, and the genotype is AA; the middle red dots are the heterozygous genotype AC; the gray dots are the control.

[0080] 2. Another set of rapeseed resequencing genome raw data has been publicly available online and can be downloaded from the GSA (https: / / ngdc.cnc b.ac.cn / gsa / ) website. The project number is PRJNA476657. The second-generation sequencing data is mapped to the reference genome to obtain the population variation file. The population variation detection process is exactly the same as the content of part 2 in Example 1.

[0081] The results are as follows: The varieties (lines) were identified based on the high-content haplotype results qBnADL.C09.1 (A / A or A / G) and qBnADL.C09.2 (A / A or A / C) of two loci SNP6020 and SNP54552 (Table 5). The lignin content was also higher than that of the varieties (lines) with low-content haplotypes qBnADL.C09.1 (G / G) and qBnADL.C09.2 (C / C).

[0082] Table 5: Varieties (lines) with different straw lignin content identified by genotypes of associated loci (results of some extreme materials are shown)

[0083]

[0084] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of a reagent for detecting base 54552506 of chromosome C09 of the reference genome of Brassica napus ZS11.V0 in breeding for lignin content in Brassica napus straw, wherein the reagent is a KASP primer, which is: Upstream primer HEX2: 5′-GAAGGTGACCAAGTTCATGCTCCAAACAACGAACAAATGCTG-3′; Upstream primer FAM2: 5′-GAAGGTCGGAGTCAACGGATTACCAAACAACGAACAAATGCTT-3′; Downstream primer R2: 5′-TGGTAATAATCCTTATATAGTTATGGTTGA-3′; The base 54552506 of chromosome C09 of the Brassica napus ZS11.V0 reference genome was detected. If the genotype was AA or AC, it was a material with a higher lignin content. If the genotype was CC, it was a material with a lower lignin content.

2. Application of a reagent for detecting bases 6020367 and 54552506 of chromosome C09 of the reference genome of Brassica napus ZS11.V0 in breeding for lignin content in straw of Brassica napus, wherein the reagent is a KASP primer, which is: Upstream primer HEX1: 5'-GAAGGTGACCAAGTTCATGCTACTACAGTGCGCTAGTCAAACGA-3', Upstream primer FAM1: 5'-GAAGGTCGGAGTCAACGGATTAGTGCGCTAGTCGGACGG-3', Downstream primer R1: 5′-TTTTTGGTAAATCGCTAGGCTC-3′; and Upstream primer HEX2: 5'-GAAGGTGACCAAGTTCATGCTCCAAACAACGAACAAATGCTG-3', Upstream primer FAM2: 5'-GAAGGTCGGAGTCAACGGATTACCAAACAACGAACAAATGCTT-3', Downstream primer R2: 5′-TGGTAATAATCCTTATATAGTTATGGTTGA-3′; By testing base 6020367 of chromosome C09 of the reference genome of Brassica napus ZS11.V0, if the genotype is AA or AG, it is a genotype with higher lignin content in the stems; if it is GG, it is a material with lower lignin content in the stems; by testing base 54552506 of chromosome C09 of the reference genome of Brassica napus ZS11.V0, if the genotype is AA or AC, it is a material with higher lignin content; if the genotype is CC, it is a material with lower lignin content.

Images