A genetically engineered Pichia pastoris expressing human lysozyme and its application
By constructing the Pichia genetically engineered strain Δ0823-CH2, using codon optimization, signal peptide optimization, ARTP mutagenesis and gene knockout strategies, the expression efficiency of human lysozyme was significantly improved, and the problems of low human lysozyme yield and enzyme activity in Pichia host were solved, achieving high efficiency and high yield.
Patent Information
- Application Number
- CN202311600553.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-28
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2043-11-28
AI Technical Summary
In the prior art, the heterologous expression of Pichia cerevisiae as the host has low yield and enzyme activity, which limits the industrial production of human lysozyme.
Through codon optimization, signal peptide optimization, overexpression of PDI1 gene and atmospheric room temperature plasma mutagenesis (ARTP) combined with gene knockout of PAS_chr3_0823 gene, the Pichia genomic engineering strain Δ0823-CH2 was constructed to improve the expression efficiency of human lysozyme.
Under the fermentation conditions of shake flask, the enzyme activity of the fermentation supernatant reached 43,910±806U/mL, the enzyme activity in the 5L fermentation tank reached 1,032,667±11,719U/mL, and the total protein concentration reached 4.10±0.01g/L, which significantly improved the expression level of human lysozyme.
Smart Images

Figure HDA0004573966320000011 
Figure HDA0004573966320000012 
Figure HDA0004573966320000021
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of bioengineering, and in particular to a genetically engineered Pichia pastoris expressing human lysozyme and an application thereof. Background Art
[0002] Lysozyme (LYZ), also known as N-acetylmuramic acid polysaccharide hydrolase or muramidase, was first discovered in human nasal mucus by British scientist Fleming in 1992. It is a single-peptide protein. Lysozymes are widely distributed in bacteriophages, microorganisms, plants, and animals. Animal lysozymes can be further divided into c-type (chicken-type), g-type (goose-type), and i-type (invertebrate-type) based on their primary structure. Although the structural characteristics and chemical properties of different types of lysozymes vary, they all have a widely recognized biological function: catalyzing the hydrolysis of the β-1,4-glycosidic bond between N-acetylglucosamine and N-acetylmuramic acid in the peptidoglycan layer of bacterial cell walls, thereby dissolving the cell wall and inhibiting bacterial growth or even killing it under low osmotic pressure. Therefore, as a protein with antibacterial and anti-inflammatory properties, lysozyme is widely used in food, medicine, animal husbandry, and other fields, and has broad industrial application prospects.
[0003] Human lysozyme (hLYZ) is a 130-amino acid alkaline protein with four disulfide bonds and two structural domains. It belongs to the c-type lysozyme and is widely distributed in human body fluids, cells, and tissues. Compared with chicken lysozyme, the most thoroughly studied c-type, hLYZ has higher enzymatic activity and better stability, and has the potential to become an antibiotic alternative. Natural human lysozyme is mainly extracted from human milk or placenta, but it faces problems such as limited sources, difficult extraction, difficulty in ensuring activity, and high cost. Currently, various strategies have been developed to efficiently express recombinant human lysozyme using engineered strains, but yield and enzyme activity remain key factors limiting the industrial production of human lysozyme. Summary of the Invention
[0004] The object of the present invention is to provide a genetically engineered Pichia pastoris expressing human lysozyme, wherein the genetically engineered Pichia pastoris is the genetically engineered Pichia pastoris Δ0823-CH2, which is classified as Komagataella phaffii and deposited in the China General Microbiological Culture Collection Center (CGMCC) on October 11, 2023, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit number of CGMCC NO.28602.
[0005] The present invention provides a method for constructing a genetically engineered Pichia pastoris, which is achieved by the following steps:
[0006] (1) Construction of the starting strain: Using Pichia pastoris GS115 as the base strain, the starting strain Pichia pastoris LYZ-C1 was constructed by knocking out the ADE2 gene, optimizing the human lysozyme codon, optimizing the signal peptide, and overexpressing the PDI1 gene on the basis of the base strain;
[0007] (2) Mutagenesis: The starting strain Pichia pastoris LYZ-C1 cultured to the logarithmic phase was placed in an atmospheric and room temperature plasma (ARTP) mutagenesis breeding instrument for 120 s;
[0008] (3) Screening: The induced bacterial suspension was diluted and spread on a plate containing Micrococcus lysodeikticus for primary screening; using the size of the inhibition zone on the plate as an indicator, single colonies with larger inhibition zones were selected and fermented in a 48-deep-well plate. After 72 hours of induction, the enzyme activity of the fermentation supernatant was measured for primary screening; using the enzyme activity size as an indicator, strains with higher enzyme activity were selected and placed in a 250 mL shake flask. After 96 hours of induction, the enzyme activity was measured for secondary screening. After two rounds of mutagenesis, a Pichia pastoris mutant with higher enzyme activity was obtained and named CH2;
[0009] (4) Gene Knockout: The PAS_chr3_0823 gene was knocked out based on the high-yielding mutant CH2. The resulting Pichia pastoris engineered strain, named Δ0823-CH2, further improved the expression efficiency of human lysozyme. The engineered Pichia pastoris strain Δ0823-CH2 was designated Komagataella phaffii and has a CGMCC accession number of 28602.
[0010] The gene sequence of the human lysozyme and signal peptide in step (1) is SEQ ID NO: 1.
[0011] Another object of the present invention is to provide the use of the genetically engineered Pichia pastoris Δ0823-CH2 in increasing the production of human lysozyme. The genetically engineered Pichia pastoris Δ0823-CH2 can improve the expression efficiency of human lysozyme, and the high-yield human lysozyme can be widely used in the fields of food, feed, medicine, etc.
[0012] The application of the present invention is to use the genetically engineered Pichia pastoris Δ0823-CH2 as a host to ferment and highly express human lysozyme, which is achieved by the following steps:
[0013] (1) Resuscitation of seed solution: Pick a single colony activated on a YPD plate and transfer it to YPD liquid medium. Culture overnight at 30°C for 12-16 hours.
[0014] (2) Shake flask culture: 1% of the seed solution was inoculated into a 250 mL shake flask containing 40 mL of BMGY medium. After overnight culture at 30°C and 250 rpm, the cells were resuspended in BMMY medium by centrifugation until the OD 600 =2, 1% methanol was added every 12 h for a total of 96 h;
[0015] (3) Fermentation culture: 1% of the seed solution was inoculated into a 1 L shake flask containing 200 mL of YPG medium and cultured at 30°C and 250 rpm until the OD 600 = 6-8. The above bacterial liquid was inoculated into a 5-L fermentor containing 2 L of BSM medium. The glycerol growth phase was set at 30°C, pH 5.5, and a rotation speed of 500-900 rpm. When the initial induction cell wet weight reached 200 g / L, glycerol feeding was stopped and the cells were starved for half an hour before entering the methanol induction phase. The temperature was set at 30°C, and the methanol feed rate was controlled based on a dissolved oxygen content above 20%. Induction was continued for a total of 120 hours.
[0016] The culture medium formula used in the present invention is as follows:
[0017] (1) YPD medium: 1% yeast extract, 2% peptone, 2% glucose. For solid medium, add 2% agar.
[0018] (2) YPM medium: 1% yeast extract, 2% peptone, 1% methanol, 1.5% agar;
[0019] (3) YPDS+Zeocin medium: 1% yeast extract, 2% peptone, 2% glucose, 1 mol / L sorbitol, 2% agar, and containing Zeocin at a final concentration of 100 μg / mL;
[0020] (4) YPG medium: 1% yeast extract, 2% peptone, 2% glycerol;
[0021] (5) BMGY medium: 1% yeast extract, 2% peptone, 100 mmol / L potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;
[0022] (6) BMMY medium: 1% yeast extract, 2% peptone, 100 mmol / L potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;
[0023] (7) BSM medium: 0.93 g / L CaSO4, 18.2 g / L K2SO4, 14.9 g / LMgSO4·7H2O, 4.13 g / L KOH, 26.7 mL / L H3PO4 (85%), 40.0 g / L glycerol;
[0024] (8) PTM1 trace elements: 6.0 g / L CuSO4·5H2O, 0.08 g / L NaI, 3.0 g / L MnSO4·H2O, 0.2 g / LNa2MoO4·2H2O, 0.02 g / L H3BO3, 0.5 g / L CoCl2, 20.0 g / L ZnCl2, 65.0 g / L FeSO4·7H2O, 0.2 g / L biotin, 5 mL / L H2SO4.
[0025] The current technical problem to be solved is the low yield and low enzyme activity of human lysozyme heterologously expressed in Pichia pastoris. Therefore, the present invention first constructs a starting strain expressing human lysozyme using a combination of strategies, including codon optimization, signal peptide optimization, and overexpression of the PDI1 gene. Furthermore, high-yielding mutants are generated through ARTP mutagenesis. The mutants are then genetically modified using genetic techniques to further improve expression efficiency, and human lysozyme expression levels are then tested using high-density fermentation.
[0026] The beneficial effects of the present invention are as follows:
[0027] (1) The genetically engineered Pichia pastoris Δ0823-CH2 obtained by the present invention can significantly improve the efficiency of expressing human lysozyme. After 96 hours of induction under shake flask fermentation conditions, the fermentation supernatant enzyme activity of Δ0823-CH2 reached 43,910±806 U / mL, a 36.8% increase compared to CH2. After 120 hours of induction in a 5L fermentor, the fermentation supernatant human lysozyme activity reached 1,032,667±11,719 U / mL, and the total protein concentration reached 4.10±0.01 g / L, the highest level to date.
[0028] (2) The present invention improves the expression efficiency of human lysozyme in Pichia pastoris through a combination of strategies such as codon optimization, signal peptide optimization, co-expression of the PDI1 gene, ARTP mutagenesis and knockout of the PAS_chr3_0823 gene;
[0029] (3) The Pichia pastoris genetically engineered bacteria with high production of human lysozyme of the present invention has broad application prospects in the fields of food, feed, medicine, etc. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 This is the plasmid map of pPinkHC-hLYZ.
[0031] Figure 2This is the plasmid map of pPIC9K-PDI1.
[0032] Figure 3 The enzyme activities of strains LYZ-C1 and CH2 after 96 hours of fermentation.
[0033] Figure 4 The enzyme activities of the fermentation supernatants of strains CH2 and Δ0823-CH2 at different time periods.
[0034] Figure 5 This is the result of high-density fermentation of strain Δ0823-CH2. DETAILED DESCRIPTION
[0035] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it.
[0036] Strains and vectors: Escherichia coli DH5α was purchased from TOLOBIO, Micrococcus Lysodeikticus AS1.634 was purchased from the Institute of Microbiology, Chinese Academy of Sciences, Pichia pastoris GS115, pPink-HC and pPIC9K were all purchased from Invitrogen, and the pZ-panARS-hCas9-sgRNA (ADE2) vector was from the College of Chemical Engineering and Bioengineering, Zhejiang University (Gu Y, et al. Construction of a series of episomal plasmids and their application in the development of an efficient CRISPR / Cas9 system in Pichia pastoris [J]. World Journal of Microbiology and Biotechnology, 2019, 35(6). DOI: 10.1007 / s11274-019-2654-5.).
[0037] Unless otherwise specified, other materials and reagents used in the following examples can be obtained from commercial sources.
[0038] Example 1: ARTP-induced mutagenesis to select high-yielding recombinant human lysozyme mutants
[0039] 1. Construction of starting strain
[0040] Pichia pastoris expressing hLYZ was constructed by codon optimization, signal peptide Ost-pro optimization, and co-expression of PDI1 (GenBank: AOA70013.1).
[0041] The gene sequence and signal peptide sequence from human lysozyme were commissioned to Hangzhou Qingke Biotechnology Co., Ltd. for codon optimization and gene synthesis. Using hLYZ-F / hLYZ-R (gene sequences are shown in SEQ ID NO: 1 and NO: 2) as primers, the Ost1-pro-hLYZ fragment (gene sequence is shown in SEQ ID NO: 3) was amplified from the synthetic DNA fragment and ligated with EcoRI / KpnI-digested pPink-HC to generate the plasmid pPinkHC-hLYZ. The plasmid map is shown in Figure 1 As shown. Using PDI1-F / PDI1-R (gene sequence as shown in SEQ ID NO: 4 and NO: 5) as primers, the PDI1 fragment was amplified from GS115 genomic DNA and ligated with BamHI / NotI-digested pPIC9k to obtain plasmid pPIC9K-PDI1. The plasmid map is shown in Figure 2 To facilitate the screening of positive clones, the ADE2 (GenBank: AOA68457.1) gene was knocked out in Pichia pastoris GS115 using CRISPR / Cas9 technology to construct the strain GS115-Δade2 (Δhis4 - The plasmid pPinkHC-hLYZ linearized with BcuI and the plasmid pPIC9K-PDI1 linearized with SadI were electroporated into the strain GS115-Δade2 to complete the construction of the starting strain, which was named LYZ-C1.
[0042] 2. Expression of human lysozyme in shake flasks
[0043] Pichia pastoris and its mutants were cultured in liquid or solid YPD medium at 250 rpm in a 30°C incubator or at a constant temperature. When heterologously expressing the human lysozyme gene in a shake flask, 1% of the seed solution cultured in YPD was inoculated into 40 mL of BMGY medium and cultured overnight at 30°C and 250 rpm. The cells were collected by centrifugation, washed with sterile water, and resuspended in 40 mL of BMMY medium to obtain an initial induction culture OD of 0. 600 The concentration of Methanol was controlled at around 2.0, and methanol was added every 12 hours to a final concentration of 1% (v / v). The bacterial solution was collected for detection every 24 hours, and the expression was induced for a total of 96 hours.
[0044] 3. Activity analysis of human lysozyme
[0045] With reference to GB / T 30990-2014, the activity of human lysozyme in the fermentation supernatant was determined by turbidimetry using Micrococcus lysodeikticus as the reaction substrate. The Micrococcus lysodeikticus was diluted with phosphate buffer (0.1 mol / L, pH 6.2) to an OD 450For a bacterial suspension with an OD of about 1.3, take 2.5 mL of bacterial suspension and 0.5 mL of diluted fermentation supernatant, mix them in a cuvette, and measure the OD within 1 minute. 450 One unit of enzyme activity is defined as the amount of enzyme activity required to make a suspension of Micrococcus lysodeikticus A 450 nm The amount of enzyme required decreases by 0.001 per minute.
[0046] 4. ARTP mutagenesis and breeding
[0047] Pichia pastoris LYZ-C1 was used as the starting strain and mutagenesis treatment was carried out using the ARTP mutagenesis breeding instrument (ARTP-M) produced by Wuxi Yuanqing Tianmu Biotechnology Co., Ltd.
[0048] Pick up the activated Pichia pastoris LYZ-C1 single clone and culture it in YPD medium overnight. Centrifuge and collect the bacterial solution cultured to the logarithmic phase, wash the cells twice with sterile water, and calculate the OD 600 Dilute to 0.6-0.8 and evenly distribute 10 μL of the bacterial suspension onto a sterilized slide. Place the slide in an ARTP mutagenesis instrument and treat in a plasma jet for 120 seconds, achieving a lethality of 97%. Place the treated bacterial suspension along with the slide into a centrifuge tube containing 1 mL of sterile water. Vortex the bacterial suspension to elute it from the slide, then dilute it with sterile water to an appropriate multiple and spread it onto a YPD plate. Once colonies are formed, use a sterile toothpick to spot the colonies onto a YPM plate coated with Micrococcus lysodeikticus. Initial screening is performed based on the size of the inhibition zone of the single colony.
[0049] Single colonies with larger inhibition zones were picked and fermented on 48-deep-well plates containing BMGY medium. After 16 hours of culture, the culture medium was centrifuged and washed with sterile water. The culture medium was then replaced with BMMY, and 1% methanol was added every 24 hours. After 72 hours of induction culture, the fermentation supernatant was collected and the enzyme activity was used as an indicator for primary rescreening. The strains with higher enzyme activity obtained in the first round of primary rescreening were collected and transferred to a 48-deep-well plate for a second round of primary rescreening. The selected dominant colonies were then inoculated into 250 mL shake flasks for expansion culture, and the enzyme activity of the supernatant after 96 hours of fermentation was used as an indicator for secondary rescreening.
[0050] Using this method, after two rounds of mutagenesis, a mutant strain with significantly higher expression of human lysozyme than the starting strain was obtained and named CH2. Figure 3 As shown, after 96 h of induction under shake flask fermentation conditions, the enzyme activity of the fermentation supernatant of CH2 was significantly (P < 0.001) higher than that of the starting strain LYZ-C1, increasing by 13.1%.
[0051] Example 2: Knockout of the PAS_chr3_0823 (XM_002493010.1) gene to further increase yield
[0052] 1. Construction of CRISPR / Cas9 plasmid and donor DNA
[0053] Primers sgRNA-0823-F / sgRNA-0823-R (sequences shown in SEQ ID NOs: 6 and 7) were synthesized and annealed to form the sgRNA-0823 sequence. The sgRNA-0823 sequence was inserted into the pZ-panARS-hCas9-sgRNA(ADE2) vector containing a Bsa I site to construct the knockout plasmid pZ-panARS-hCas9-0823. Using the GS115 genome as a template, primers 0823-LF / 0823-LR (sequences shown in SEQ ID NOs: 8 and 9) and 0823-RF / 0823-RR (sequences shown in SEQ ID NOs: 10 and 11) were used to amplify 500 bp fragments of the 5'-upstream and 3'-downstream regions of the target gene, respectively. The two purified homologous fragments were fused by PCR to generate donor DNA-0823.
[0054] 2. Construction of knockout strains
[0055] The Pichia pastoris CH2 competent cells were mixed with donor DNA-0823 and pZ-panARS-hCas9-0823 plasmids, and after electroporation (1500V, 200Ω, 25μF), they were spread on YPDS plates containing 100μg / mL Zeocin and cultured at 30°C for 3-5 days. After a single clone was grown, the primers 0823-test-F / 0823-test-R (gene sequence as shown in SEQ ID NO: 12 and NO: 13) were used to screen the positive clones, and the correct single clones were streaked, purified, and stored as seeds, named Δ0823-CH2. The primers and their sequences used in the present invention are shown in Table 1.
[0056] With CH2 as the control, the knockout strain Δ0823-CH2 was fermented in shake flasks, and samples were taken every 24 hours to determine the enzyme activity of the fermentation supernatant. Figure 4 As shown in the results, the enzyme activity of Δ0823-CH2 was significantly higher than that of strain CH2 after 48h, 72h, and 96h of induction (**, P < 0.001; ***, P < 0.001). The enzyme activity of the fermentation supernatant of Δ0823-CH2 at 96h was as high as 43,910 ± 806 U / mL, which was 36.8% higher than that of CH2.
[0057] It can be seen that the Pichia pastoris strain bred and genetically engineered in the present invention can efficiently express human lysozyme.
[0058] Table 1 Primers used in the present invention and their sequences
[0059] Primer name Primer sequences hLYZ-F ACGGAATTCAAAACGATGCGCCAAGTATGGTTTAG hLYZ-R GCCGGTACCTCATTAGACTCCACAACCTT PDI1-F ACAACTAATTATTCGAAGGATCCAAACGATGCAATTCAACTGGAATAT PDI1-R AAGGCGAATTAATTCGGCGGCCGCTTAAAGCTCGTCGTGAGCGT sgRNA-0823-F ACGCTTGCACAGAACGCAATTCAG sgRNA-0823-R AAACCTGAATTGCGTTCTGTGCAA 0823-LF GTTAATTAGGACTCTTGCTTTTTGA 0823-LR TTAAATATACCATGTACATATCTTTGTACAAGTCGGCAATG 0823-RF CATTGCCGACTTGTACAAAGATATGTACATGGTATATTTAACGACG 0823-RR TAAAGTTGTTGCAGAACTCTTAGG 0823-test-F CACCAGCTGTCATTGGTAAGGC 0823-test-R GACGATGTCTACTCACTGGCTA
[0060] Example 3: Fermentation of knockout strain Δ0823-CH2
[0061] 1. Cultivation and inoculation of seed solution
[0062] High-density fermentation of the genetically engineered Pichia pastoris Δ0823-CH2 was performed in a 5L fermentor. The seed solution was inoculated from a -80°C freezer into YPD medium and cultured at 30°C for 16 hours to recover. The seed solution was transferred to 200 mL of YPG at a 1% concentration and cultured at 30°C until the OD 600 = 6 to 8. For high-density fermentation, the above bacterial solution was inoculated into a fermenter initially containing 2 L BSM medium and 500 μL defoamer. The temperature was controlled at 30°C, the pH was adjusted to 5.5 with ammonia water, the rotation speed was 500 to 900 rpm, and the dissolved oxygen and speed were linked.
[0063] 2. Fermentation growth stage and induction stage
[0064] Initially, cells were grown using glycerol (containing 1.2% PTM1) as a carbon source. After the initial glycerol supply was depleted, glycerol was fed continuously until the wet weight reached approximately 200 g / L, at which point glycerol feeding was stopped and starvation was continued for half an hour. Later, methanol (containing 1.2% PTM1) was used as a carbon source to induce expression of human lysozyme. The temperature was controlled at 30°C and the pH was 5.5. The DO was maintained above 20% throughout the process, and the methanol feed rate and aeration rate were adjusted accordingly. Fermentation was induced for a total of 120 hours, with samples collected every 12 hours to measure wet weight, supernatant total protein, and enzyme activity.
[0065] 3. Quantitative analysis of expressed proteins
[0066] The total protein content in the fermentation broth supernatant was determined by BradFord method. The gradient dilution of human lysozyme (Sigma, 12671-19-1) was used as the standard solution to determine the total protein content in each tube A. 595nm A protein standard curve was drawn and the total protein concentration in the fermentation broth was calculated based on the curve. Two replicates were performed for each. Figure 5 As shown, the human lysozyme activity of the genetically engineered Pichia pastoris Δ0823-CH2 reached 1,032,667±11,719 U / mL and the total protein concentration reached 4.10±0.01 g / L during high-density fermentation for 120 h.
[0067] In summary, combined with the expression results in shake flasks and fermenters, the genetically engineered Pichia pastoris obtained by selection and genetic engineering technology in the present invention can efficiently express human lysozyme, laying a foundation for the industrialization of human lysozyme and providing a reference for the efficient expression of other eukaryotic proteins.
[0068] The above are preferred embodiments of the present invention. Those skilled in the art may make appropriate improvements without departing from the spirit and principles of the present invention, and these improvements are also included in the scope of protection of the present invention.
Claims
1. A genetically engineered Pichia pastoris △0823 -CH2, characterized in that The Pichia pastoris genetically engineered bacteria △ 0823 -CH2 is classified as: Komagataella phaffii , the deposit number is CGMCC NO. 28602.
2. The genetically engineered Pichia pastoris according to claim 1 △0823 Application of -CH2 in increasing the production of human lysozyme.
3. The use according to claim 2, characterized in that The fermentation culture conditions for improving the expression efficiency of human lysozyme were as follows: glycerol growth period parameters of 30°C, pH 5.5, rotation speed of 500-900 rpm, initial induced bacterial wet weight of 200 g / L, methanol induction period temperature of 30°C, and dissolved oxygen content always maintained above 20%.
Citation Information
Patent Citations
Recombinant pichia pastoris engineering bacterium integrated with high-copy human lysozyme gene and construction method thereof
CN113637598A
Pichia pastoris strain with high yield of lysozyme and application thereof
CN115873733A