Application of programmed death factor 4 in the preparation of preparations for regulating pig resistance to blue ear disease virus

Abstract

The present invention discloses the application of programmed death factor 4 in the preparation of a preparation for regulating pig resistance to blue ear disease virus. The present invention finds that the expression level of programmed death factor 4 in pigs will significantly decrease after infection with blue ear disease virus, and overexpression of programmed death factor 4 can effectively inhibit the infection of blue ear disease virus, thereby improving the pig's resistance to blue ear disease virus and achieving the effect of anti-blue ear disease. Therefore, programmed death factor 4 can be used to cultivate pig breeds resistant to blue ear disease. The expression level of programmed death factor 4 in pigs can also be detected to assist in detecting whether the pig is infected with blue ear disease virus. Reagents that promote the expression of programmed death factor 4 can also be used to prepare preparations that improve pig resistance to blue ear disease. The present invention provides a new path for the prevention and treatment of blue ear disease in pigs and is also conducive to the breeding of excellent pig strains.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology and more specifically relates to the use of programmed death factor 4 in the preparation of a preparation for regulating pig resistance to blue ear disease virus. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS) is an epidemic disease caused by porcine reproductive and respiratory syndrome virus (PRRSV), with the main symptoms being reproductive disorders in sows, respiratory diseases in growing pigs and secondary infections in infected pigs. It is commonly known as blue ear disease.

[0003] Due to PRRSV's strong transmission ability, rapid mutation rate, antibody dependency, and immunosuppression, the prevention and control of blue ear disease is difficult. Even with the implementation of control strategies such as biosecurity, vaccination, herd isolation, and pig domestication, PRRSV remains a significant threat to the pig farming industry, causing significant economic losses. The prevention and control of blue ear disease remains a global challenge.

[0004] Genetic background is closely linked to an organism's disease resistance. Research examining the genetics of PRRSV hosts (pigs) and using genetic methods to screen or breed pigs resistant to blue ear disease (PRRS) offers significant advantages for the prevention and control of the disease. However, the key and challenge of this approach lies in identifying genes associated with host resistance or susceptibility to PRRSV. Summary of the Invention

[0005] In response to the problems existing in the above-mentioned prior art, the present invention provides a protein for regulating pig resistance to blue ear disease virus, namely programmed cell death 4 (PDCD4), and also provides its application in breeding blue ear disease-resistant pig breeds.

[0006] The first object of the present invention is to provide an application of programmed death factor 4 in the preparation of a preparation for regulating pig resistance to blue ear disease virus.

[0007] The second object of the present invention is to provide the application of programmed death factor 4 in breeding pig breeds resistant to blue ear disease.

[0008] The third object of the present invention is to provide a method for breeding a pig breed resistant to blue ear disease.

[0009] The fourth object of the present invention is to provide the use of an agent that promotes the expression of programmed death factor 4 in the preparation of a preparation for improving pigs' resistance to blue ear disease virus.

[0010] The fifth object of the present invention is to provide a reagent for promoting the expression of programmed cell death factor 4 for use in the preparation of drugs for treating blue ear disease.

[0011] The sixth object of the present invention is to provide the use of an agent that promotes the expression of programmed death factor 4 in the preparation of drugs against blue ear disease virus.

[0012] The seventh object of the present invention is to provide a reagent for detecting the expression level of programmed cell death factor 4 and its use in the preparation of a product for detecting porcine blue ear disease.

[0013] The eighth object of the present invention is to provide a reagent for detecting the expression level of programmed death factor 4 and its use in preparing a product for detecting whether pigs are infected with blue ear disease virus.

[0014] The ninth object of the present invention is to provide a reagent for detecting the expression level of programmed cell death factor 4 and its use in preparing a product for screening drugs for treating blue ear disease.

[0015] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0016] The present invention uses PRRSV to infect Marc-145 cells, PAMs cells and pigs respectively, and then detects the expression level of their PDCD4. It is found that PRRSV infection will lead to a decrease in the expression level of PDCD4, and the expression level of PDCD4 is closely related to the infection of PRRSV. The expression level of PDCD4 decreases significantly with the increase of PRRSV infection time. On this basis, the present invention uses small interfering RNA (siRNA) to knock down the expression of PDCD4 protein and finds that inhibiting the expression of PDCD4 promotes the infection of PRRSV virus to the host. By constructing a PDCD4 overexpression vector to overexpress PDCD4, it was found that the overexpression of PDCD4 inhibited the infection of PRRSV to the host, that is, PDCD4 can regulate the host's resistance to PRRSV.

[0017] Therefore, the present invention claims protection for the use of programmed death factor 4 in regulating pigs' resistance to blue ear disease virus.

[0018] Specifically, the protein sequence of the programmed death factor 4 of the present invention is shown in SEQ ID NO.1.

[0019] Specifically, the gene sequence of programmed death factor 4 is shown as SEQ ID NO.2.

[0020] The present invention also seeks to protect the use of programmed death factor 4 in the preparation of a preparation for regulating pig resistance to blue ear disease virus.

[0021] The present invention also seeks to protect the use of a reagent for regulating the expression of programmed death factor 4 in the preparation of a preparation for regulating pig resistance to blue ear disease virus.

[0022] The present invention also seeks to protect the use of programmed death factor 4 in breeding pig breeds resistant to blue ear disease.

[0023] The present invention also provides a method for breeding a pig breed resistant to blue ear disease, which comprises overexpressing porcine programmed death factor 4.

[0024] Since overexpression of PDCD4 can inhibit PRRSV infection of the host, the present invention also seeks to protect the use of an agent that promotes the expression of programmed death factor 4 in the preparation of a preparation for improving pigs' resistance to blue ear virus.

[0025] The present invention also seeks to protect the use of a reagent that promotes the expression of programmed death factor 4 in the preparation of a drug for treating blue ear disease.

[0026] The present invention also seeks to protect the use of a reagent that promotes the expression of programmed death factor 4 in the preparation of drugs against blue ear disease virus.

[0027] As an optional embodiment, the reagent is an overexpression vector that overexpresses programmed cell death factor 4.

[0028] Specifically, the overexpression vector contains a gene sequence encoding the protein sequence shown in SEQ ID NO.1.

[0029] Optionally, the gene sequence encoding the protein sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.2.

[0030] Given that PRRSV reduces the expression of programmed death factor 4 after infecting the host, detecting whether the expression of programmed death factor 4 in pigs is downregulated can assist in detecting whether the pigs are infected with PRRSV and whether they have blue ear disease.

[0031] Therefore, the present invention seeks to protect the use of a reagent for detecting the expression level of programmed death factor 4 in the preparation of a product for detecting porcine blue ear disease.

[0032] The present invention also seeks to protect the use of a reagent for detecting the expression level of programmed death factor 4 in the preparation of a product for detecting whether pigs are infected with blue ear disease virus.

[0033] The present invention also seeks to protect the use of a reagent for detecting the expression level of programmed cell death factor 4 in the preparation of a product for screening drugs for treating blue ear disease.

[0034] Specifically, the reagents for detecting the expression of programmed death factor 4 include fluorescent quantitative PCR primers and reagents required for PCR reaction for detecting the expression of programmed death factor 4 mRNA, and also include reagents required for detecting the expression of programmed death factor 4 protein by western blot.

[0035] The present invention has the following beneficial effects:

[0036] The present invention shows that the expression level of porcine programmed death factor 4 will significantly decrease after infection with the blue ear disease virus, and overexpression of programmed death factor 4 can effectively inhibit the infection of the blue ear disease virus, thereby improving the pig's resistance to the blue ear disease virus and achieving the effect of anti-blue ear disease. Therefore, programmed death factor 4 can be used to cultivate pig breeds resistant to blue ear disease. By detecting the expression level of porcine programmed death factor 4, it is also possible to assist in detecting whether the pig is infected with the blue ear disease virus. Reagents that promote the expression of programmed death factor 4 can also be used to prepare preparations that improve pig resistance to blue ear disease. The present invention not only provides a new path for the prevention and treatment of blue ear disease in pigs, but also is conducive to the cultivation of excellent strains of pigs, which is of great significance for combating blue ear disease in pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The figures show the expression of PDCD4 protein and PRRSV-N protein in Marc-145 cells and PAMs cells at different time points after PRRSV infection; Figure A shows the expression of PDCD4 protein and PRRSV-N protein in Marc-145 cells at 0, 12, 18, 24, and 36 hours after PRRSV infection; Figure B shows the expression of PDCD4 protein and PRRSV-N protein in PAMs cells at 0, 6, 12, 18, and 24 hours after PRRSV infection.

[0038] Figure 2 The expression of pig PDCD4 protein and viral PRRSV-N protein 7 and 14 days after PRRSV infection.

[0039] Figure 3 These are the interference efficiency test results of three designed siRNAs (si-1, si-2, and si-3) targeting the PDCD4 gene.

[0040] Figure 4 This is the change in PRRSV infection rate after interfering with PDCD4 expression in Marc-145 cells.

[0041] Figure 5The mRNA expression levels of PRRSV-N protein at different time points after interfering with PDCD4 expression in PRRSV-infected cells; Figure A shows the mRNA expression level of PRRSV-N protein after PRRSV infection of Marc-145; Figure B shows the mRNA expression level of PRRSV-N protein after PRRSV infection of PAMs.

[0042] Figure 6 The expression levels of PRRSV-N protein at different time points after PRRSV infection of cells were interfered with PDCD4 expression; Figure A shows the expression level of PRRSV-N protein after PRRSV infection of Marc-145; Figure B shows the expression level of PRRSV-N protein after PRRSV infection of PAMs.

[0043] Figure 7 The expression levels of PDCD4 and PRRSV-N proteins at different time points after PRRSV infection of Marc-145 cells after overexpression of PDCD4.

[0044] Figure 8 The mRNA expression levels of PRRSV-N protein at different time points after PRRSV infection in Marc-145 cells overexpressed PDCD4.

[0045] Figure 9 Figure 3 shows the changes in infection rate of PRRSV-infected cells after overexpression of PDCD4 in Marc-145 cells.

[0046] In the figures, *P<0.05; **P<0.01; ***P<0.001. DETAILED DESCRIPTION

[0047] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0048] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0049] The porcine reproductive and respiratory syndrome virus (PRRSV) used in the present invention includes the CH-1a strain and the GDBY1 strain, the PRRSV virus-susceptible cells used are Marc-145 (African green monkey embryonic kidney cells), and the in vivo infection target cells used are PAMs (porcine alveolar macrophages). The above materials are all preserved in the Animal Genetics and Breeding Laboratory of the School of Life Sciences of Sun Yat-sen University.

[0050] The Lipofectamine™ RNAiMAX transfection reagent used was a product of Thermo Fisher Scientific, and the PDCD4 anti-rabbit monoclonal antibody was a product of Abcam.

[0051] Example 1 Effect of PRRSV infection on cell PDCD4 expression

[0052] 1. Experimental methods

[0053] (1) Cell culture and PRRSV infection

[0054] Marc-145 cells were cultured in DMEM culture medium containing 10% fetal bovine serum to a proliferation density of 60% to 70%, the culture medium was discarded, the cells were washed three times with PBS, and DMEM culture medium containing 2% serum was added. PRRSV was inoculated at an MOI of 0.1 and continued to be cultured in DMEM culture medium containing 2% fetal bovine serum at 37°C. Cells were collected at different time points of 0, 12, 18, 24, and 36 h (0 h indicates no virus infection), and the expression of cell PDCD4 protein and PRRSV virus nucleocapsid protein (PRRSV-N) was detected by western blot.

[0055] PAMs cells were removed from liquid nitrogen and revived with RPMI-1640 medium containing 10% serum. After 6 hours, the medium was changed and cultured until the proliferation density reached 60% to 70%. The culture medium was discarded, and the cells were washed three times with PBS. RPMI-1640 culture medium containing 2% serum was added, and PRRSV was inoculated at an MOI of 0.1. The cells were further cultured in RPMI-1640 culture medium containing 2% fetal bovine serum at 37°C for 0, 6, 12, 18, and 24 hours. The cells were collected and the expression of cellular PDCD4 protein and PRRSV nucleocapsid protein (PRRSV-N) was detected by western blot.

[0056] (2) Western blot detection

[0057] ① Protein sample preparation: For monolayer adherent cells, wash the cells three times with PBS to remove the culture medium; add 200 μL of lysis buffer to the cell wells, let it stand on ice for 20 minutes, scrape the cells at the bottom of the plate with a cell scraper, transfer the lysate to a 1.5 mL centrifuge tube, and centrifuge at 12,000 × g to obtain the supernatant;

[0058] ② After measuring the protein concentration, add 5× SDS loading buffer; boil the freshly prepared sample at 100°C for 10 minutes to denature the protein, and then load the sample;

[0059] ③ Electrophoresis: Calculate the amount of sample loaded for each sample to ensure consistent protein concentration for each sample; first adjust the voltage to 80V for approximately 30-35 minutes. When the sample reaches the interface between the stacking gel and the separation gel, adjust the voltage to 120V and continue electrophoresis for approximately 1 hour.

[0060] ④ Transfer: Remove the concentrated gel part of the protein gel and put the separation gel part into the transfer solution; cut the filter paper and PVDF membrane into about 5.5×8.5cm 2 Size; Soak the filter paper in the transfer solution, place the PVDF membrane in methanol for 1 minute, and then transfer the membrane into the transfer solution; Use a Bio-Rad transfer instrument to transfer the membrane, adjust the transfer voltage to 25V, and transfer time for 45 minutes;

[0061] ⑤ Blocking: Take out the transferred membrane, place it in TBST containing 3% BAS, and incubate at room temperature for 1 hour;

[0062] ⑥ Primary antibody hybridization: Dilute the antibody to the recommended concentration with TBST containing 3% BAS, cut the membrane containing the target band, place it in the antibody, and shake at 4°C overnight;

[0063] ⑦ Secondary antibody hybridization: Remove the membrane and wash it in TBST 4 times, 5 minutes each time; dilute the secondary antibody according to the recommended concentration in TBST containing 3% BAS, place the membrane in the antibody and incubate at room temperature for 1 hour; remove the membrane and wash it in TBST 4 times, 5 minutes each time;

[0064] ⑧Use ECL color developing solution to take pictures in chemiluminescence imaging system.

[0065] 2. Experimental results

[0066] The expression of PDCD4 protein and PRRSV-N protein in Marc-145 and PAMs cells at different time points after PRRSV infection is shown in Figure 2. Figure 1 As shown; Figure 1 A in the figure shows the expression of PDCD4 protein and PRRSV-N protein in Marc-145 cells at 0, 12, 18, 24, and 36 h after PRRSV infection; Figure 1 B in the figure shows the expression of PDCD4 protein and PRRSV-N protein in PAMs cells at 0, 6, 12, 18, and 24 hours after PRRSV infection. Figure 1 The results showed that after PRRSV infection of Marc-145 or PAMs cells, the expression of PDCD4 protein decreased significantly. As the infection time prolonged, the expression of PRRSV-N protein increased more significantly, indicating that PRRSV infection inhibits the expression of PDCD4.

[0067] Example 2 Effect of PRRSV-challenged pigs on PDCD4 expression

[0068] 1. Experimental methods

[0069] Eighteen 4-week-old PRRSV-negative pigs were randomly divided into two groups: a PRRSV-infected group (n=12) and a mock-infected control group (n=6). Each group of animals was housed in a separate isolation room with appropriate temperature and humidity, independent ventilation, and ad libitum access to water and food. After one week of adaptive breeding, the highly pathogenic PRRSV (HP-RRSV) strain GDBY1 was instilled via nasal cannula (2 mL, 4.4×10 5 TCID50 / mL) and intramuscular injection (2 mL, 4.4×10 5 TCID50 / mL) for virus inoculation; 7 days and 14 days after infection (dpi), two pigs were removed from the control group and three pigs were removed from the GDBY1-infected group. The pigs were euthanized and their lung tissues were obtained. The lung tissues were ground and protein was collected. The expression of PDCD4 protein and PRRSV-N was detected by western blot according to the method described in Example 1.

[0070] 2. Experimental results

[0071] The expression of PDCD4 protein and PRRSV-N protein in pigs 7 and 14 days after PRRSV infection Figure 2 As shown. Figure 2 The results indicate that PDCD4 expression levels in pigs were high before challenge, but decreased significantly after challenge, consistent with the results of cell-based experiments. High PDCD4 expression suggests a certain resistance to PRRSV, while low PDCD4 expression suggests a greater susceptibility to the virus.

[0072] Example 3 Effect of Inhibiting PDCD4 Expression on PRRSV Infection

[0073] The present invention utilizes small interfering RNA (siRNA) technology to inhibit the expression of PDCD4, and tests the PRRSV infection condition after the PDCD4 expression is inhibited.

[0074] The protein sequence of PDCD4 of the present invention is shown as follows (SEQ ID NO. 1):

[0075] MDVESEQILNVNPADPDNLSDCLFSGDEENAGTEEIKNEINGNWISASSINEARINAKAKRRLRKNSSRDSGRGDSVSDNGSDALRSGVTVPTSPKGRLLDRRSRSGKGRGLPKKGGAGGKGVWGTPGQVYDVEEVDVKDPNYDDDQENCVYETVVLPLDERAFEKTLTPIIQEYFEHGDTNEVAEMLRDLNLGEMKSGVPVLAVSLALEGKASHREMTSKLLSDLCGTVMSTSDVEKSFDKLLKDLPELALDTPRAPQLVGQFIARAVGDGILCNTYIDSYKGTVDCVQARAALDKATVLLSMSKGGKRKDSVWGSGGGQQSVNHLVKEIDMLLKEYLLSGDISEAEHCLKELEVPHFHHELVYEAVIMVLESTGESTFKMILDLLKSLWKSSTITVDQMKRGYERIYNEIPDINLDVPHSYSVLEQFVEECFQSGIISKQLRDLCPSRGRKRFVSEGDGGRLKPESY

[0076] The gene sequence of PDCD4 according to the present invention is as shown below (SEQ ID NO.2):

[0077]

[0078] 1. Design of PDCD4 siRNA sequence

[0079] The present invention designed three pairs of PDCD4 siRNA sequences (including sense strands and antisense strands) for PDCD4 and commissioned Shanghai Sangon Biotechnology Co., Ltd. to synthesize them.

[0080] The three pairs of PDCD4 siRNA sequences are as follows:

[0081] si-1sense:GGGAGUGACGCCCUUAGAATT

[0082] si-1antisense:UUCUAAGGGGCGUCACUCCCTT

[0083] si-2sense:GGAGGUAGUAUGUGAAAGAUTT

[0084] si-2antisense:AUCUUUCACAUCUACCUCCTT

[0085] si-3sense:GCUGCUCUGGAUAAGGCUATT

[0086] si-3antisense:UAGCCUUAUCCAGAGCAGCTT

[0087] The present invention also provides a negative control (Negative Control), the sequence of which is as follows:

[0088] Si-NC sense: GGCCCCUUAUGUTTAGCCUAA

[0089] Antisense:GTTAGUUGUCGGAUCCAGACA

[0090] 2. siRNA transfection and interference efficiency detection

[0091] Use Marc-145 cells or revived PAMs cells that are in good growth condition and have a density of 60% to 80% for transfection. Before transfection, prepare a 1.5 mL centrifuge tube and add 125 μL of Opti-MEM (Invitrogen) and 5 μL of Lipo3000 (Invitrogen) to it with a pipette. Mix gently with a pipette and let it stand for 5 minutes. Take another 1.5 mL centrifuge tube and add 125 μL of Opti-MEM and 50 μM of the si-PDCD4 (si-1, si-2, si-3) or si-NC to be transfected. Gently pipette to mix, let it stand for 5 minutes; mix the two premixed solutions, pipette to mix, let it stand for 20 minutes; remove the cell culture dish from the cell culture incubator, remove the culture medium and wash the wall of the dish 2 to 3 times with PBS preheated at 37°C, add a freshly prepared DMEM culture medium containing 10% fetal bovine serum to the cell culture dish, add the above mixture, culture in a 37°C cell culture incubator, replace the culture medium after 6 hours, and continue to culture for 24 hours before collecting the cells to detect the interference effect on PDCD4. At the same time, simulate infection with PRRSV in another six-well plate. After 24 hours of transfection, PRRSV (MOI = 0.1) was added to the culture medium and cultured for 12, 24, and 36 hours. The cells were collected for immunofluorescence to detect the situation of PRRSV-infected cells. Western blot and fluorescence quantitative PCR experiments were used to detect the expression of PRRSV virus nucleocapsid protein (PRRSV-N) and its mRNA (parallel experiment).

[0092] (1) Immunofluorescence

[0093] Cultured Marc-145 cells were fixed with 4% paraformaldehyde for 15 minutes, washed three times with 0.3% Triton x-100 (Beyotime Biotechnology; 9002-93-1) and PBS, and then blocked with PBS containing 1% bovine serum albumin (BSA) for 30 minutes. The cells were incubated with PRRSV-N antibody (1:200 dilution in PBS) at 4°C overnight and then incubated with Alexa Fluor 488-labeled anti-mouse IgG secondary antibody for 2 hours. After the incubation, the cell nuclei were stained with DAPI dye, and the cells were examined using a fluorescence microscope to observe the effect of inhibiting PDCD4 expression on PRRSV infection.

[0094] (2) Fluorescence quantitative PCR

[0095] RNA from infected cells was extracted using the Trizol method. After the concentration of the extracted RNA was determined, it was diluted 100-fold with DEPC water. A template system was prepared by combining 1 μg of template RNA with 0.5 μL each of DEPC water and RNA inhibitor, and the mixture was boiled in a 70°C water bath for 10 min. A reverse transcription system was also prepared by combining 4 μL of MgCl2, 2 μL of reverse transcription buffer, 2 μL of dNTP mix, 0.5 μL of reverse transcriptase, 0.75 μL of oligo dTprime, and 0.25 μL of random primers. The template system and reverse transcription system were mixed and reverse transcription was performed at 42°C for 30 min and 95°C for 5 min. The mRNA expression level of the PRRSV-N protein was detected using qPCR primers NF (AAAACCAGTCCAGAGGCAAG) and NR (CGGATCAGACGCACAGTATG).

[0096] The qPCR reaction system was as follows: 5 μL SYBR Green Master, 2 μL cDNA template, 0.2 μL of each qPCR primer, and ddH2O was added to 10 μL. The reaction was carried out using a Light-Cycler 480 PCR system. The qPCR reaction conditions were as follows: 95°C for 5 min, 95°C for 10 s, 58°C for 30 s, 72°C for 30 s, 72°C for 10 min, and stored at 4°C. 2 -ΔCt The relative amount of mRNA accumulation was assessed by PCR.

[0097] (3) Western blot

[0098] Refer to Example 1.

[0099] 4. Experimental results

[0100] The test results of the interference efficiency of the three siRNAs targeting the PDCD4 gene designed by the present invention are as follows: Figure 3 As shown. Figure 3 It can be seen that after siRNA interference of PDCD4, siRNA significantly inhibited the expression of PDCD4 protein compared with the control group. Among them, si-3 had the best interference effect, and si-3 siRNA primers were subsequently selected to interfere with the expression of PDCD4. After interfering with the expression of PDCD4 in Marc-145 cells, the infection rate of cells infected with PRRSV changed as shown below. Figure 4 As shown. Figure 4 It can be seen that after interfering with PDCD4 expression, the immunofluorescence results showed that the infection rate of PRRSV increased significantly. After interfering with PDCD4 expression in cells, the mRNA and protein expression levels of PRRSV-N protein at different time points in PRRSV-infected cells were as follows: Figure 5 and Figure 6 As shown. Figure 5 and Figure 6 It can be seen that after interfering with PDCD4 expression in Marc-145 cells or primary target cells PAMs and then inoculating with virus, the mRNA level of PRRSV-N protein increased significantly at different infection time points of 12, 24, and 36 hours ( Figure 5 After interfering with the expression of PDCD4 in cells, the expression of PRRSV-N protein also increased significantly ( Figure 6 ).

[0101] The above results indicate that knocking down (inhibiting) the expression of PDCD4 in cells promotes the infection of PRRSV virus to cells.

[0102] Example 4 Effect of Overexpression of PDCD4 on PRRSV Infection

[0103] 1. Construction of PDCD4 overexpression vector

[0104] The present invention amplifies the full-length coding sequence of PDCD4 by PCR and inserts the amplified full-length coding sequence into the pcDNA3.1(+)N-eGFP vector (Invitrogen) by enzyme ligation to construct a PDCD4 overexpression vector named pcDNA3.1-PDCD4-N-eGFP.

[0105] 2. Transfection of PDCD4 overexpression vector and its effect on PRRSV replication

[0106] The transfection and detection of the PDCD4 overexpression vector were performed according to the method described in 3 of Example 1.

[0107] Prepare transfection using Marc-145 cells that are in good growth condition and have a density of 60% to 80%. Use a pipette to add 125 μL of Opti-MEM and 5 μL of Lipo3000 to a 1.5 mL centrifuge tube, pipet and mix, and let it stand for 5 minutes; take another 1.5 mL centrifuge tube, add 125 μL of Opti-MEM and 2 μg of the overexpression vector to be transfected (pcDNA3.1-PDCD4-N-eGFP) thereto, let it stand for 5 minutes; mix the above two premixed solutions, pipet and mix, and let it stand for 20 minutes; remove the cell culture dish from the cell culture incubator, aspirate the culture medium and wash the wall of the dish 2 to 3 times with preheated PBS, add freshly prepared culture medium containing 10% serum, add the above mixture, culture in a 37°C cell culture incubator, and change the medium after 6 hours; 24 hours after transfection, add PRRSV to the culture medium, culture for another 12, 24, and 36 hours, and collect cells to detect the effect of PDCD4 overexpression on PRRSV replication.

[0108] 3. Experimental results

[0109] After overexpression of PDCD4 in Marc-145 cells, the expression levels of PDCD4 and PRRSV-N proteins at different time points in PRRSV-infected cells were as follows: Figure 7 As shown. Figure 7 It can be seen that after transfection of PDCD4 overexpression vector, the expression level of PDCD4 protein in cells increased significantly, while the expression level of PRRSV-N protein decreased significantly. After overexpression of PDCD4 in Marc-145 cells, the mRNA expression level of PRRSV-N protein at different time points of PRRSV-infected cells was as follows Figure 8 As shown. Figure 8 It can be seen that after overexpression of PDCD4, the expression level of PRRSV-N mRNA in cells decreased significantly. After overexpression of PDCD4 in Marc-145 cells, the infection rate of PRRSV-infected cells changed as shown in the following figure: Figure 9 As shown. Figure 9 It can be seen that overexpression of PDCD4 reduces the cell infection rate of PRRSV.

[0110] The above results showed that overexpression of PDCD4 inhibited PRRSV infection.

[0111] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Use of programmed death factor 4 in the preparation of a preparation for inhibiting porcine reproductive and respiratory syndrome virus, characterized in that: The protein sequence of the programmed death factor 4 is shown in SEQ ID NO.

1.

2. The application of programmed death factor 4 in breeding pig breeds resistant to blue ear disease, characterized in that: The protein sequence of the programmed death factor 4 is shown in SEQ ID NO.

1.

3. A method for breeding a pig breed resistant to blue ear disease, characterized in that: Overexpression of porcine programmed death factor 4; the protein sequence of the programmed death factor 4 is shown in SEQ ID NO.

1.

4. Use of a programmed death factor 4 overexpression vector in the preparation of a preparation for improving pig resistance to blue ear disease virus, characterized in that: The protein sequence of the programmed death factor 4 is shown in SEQ ID NO.

1.

5. Use of a programmed cell death factor 4 overexpression vector in the preparation of a drug for treating blue ear disease, characterized in that: The protein sequence of the programmed death factor 4 is shown in SEQ ID NO.

1.

6. Use of a programmed death factor 4 overexpression vector in the preparation of a drug against blue ear disease virus, characterized in that: The protein sequence of the programmed death factor 4 is shown in SEQ ID NO.

1.

7. Use of a reagent for detecting programmed cell death factor 4 expression in the preparation of a product for detecting blue ear disease in pigs, characterized in that: The protein sequence of the programmed death factor 4 is shown in SEQ ID NO.

1.

8. Use of a reagent for detecting the expression level of programmed death factor 4 in the preparation of a product for detecting whether pigs are infected with blue ear disease virus, characterized in that: The protein sequence of the programmed death factor 4 is shown in SEQ ID NO.

1.

9. Use of a reagent for detecting the expression level of programmed cell death factor 4 in the preparation of a product for screening drugs for treating blue ear disease, characterized in that: The protein sequence of the programmed death factor 4 is shown in SEQ ID NO.1.

Images