Pharmaceutical use of substances that inhibit LAPTM5 in AML

Abstract

The present invention discloses the pharmaceutical use of substances that inhibit LAPTM5 in AML, relating to the field of biotechnology. The present invention provides the application of substances that inhibit LAPTM5 in the preparation of drugs for treating, adjuvantly treating, and / or preventing leukemia. The present invention also provides the application of substances that inhibit LAPTM5 in enhancing the sensitivity of cells to drugs for treating leukemia. The present invention discovers that LAPTM5 is a key gene for AML resistance to AraC, targeting LAPTM5 can significantly reduce the resistance of AML cells to AraC, there is a synthetic lethal effect between LAPTM5 and cytarabine in AML, and LAPTM5 is expected to become a new target for treating drug resistance by combining with cytarabine in AML.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the pharmaceutical use of substances that inhibit LAPTM5 in AML. Background Art

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous hematological malignancy, mainly characterized by the clonal proliferation and infiltration of a large number of abnormally differentiated myeloid progenitor cells in the bone marrow, blood or tissues. The vast majority of patients have an acute and severe condition and a dangerous course. If no timely treatment intervention is carried out, the survival period after diagnosis is less than 1 year.

[0003] The treatment of AML includes induction chemotherapy and intensive consolidation. Middle- and high-risk patients with poor prognosis need to undergo hematopoietic stem cell transplantation. Cytarabine (AraC) is widely used in the treatment of AML. Currently, the first-line clinical therapy is still the "7 + 3" induction therapy mainly based on cytarabine and daunorubicin: combining the administration of cytarabine for 7 days with anthracycline drugs such as daunorubicin for 3 days can efficiently kill leukemia cells in AML. The cytotoxicity of these two drugs to leukemia cells mainly depends on mechanisms such as inhibiting DNA synthesis and inducing DNA double-strand breakage. 60% of patients have a good response to the drug, and the complete remission rate (CR) of induction remission treatment reaches 80%. However, the long-term treatment effect is still not ideal. Only 35% - 40% of patients under 60 years old and 5% - 15% of patients over 60 years old can survive in the long term. Most of the remaining patients eventually die from AML due to chemotherapy resistance, with the disease persisting or recurring. Chemotherapy drug resistance is the main cause of poor prognosis in AML. Therefore, exploring the drug resistance mechanism of AML to AraC and finding the key drug resistance targets are the key research directions in this field.

[0004] Lysosome-associated protein transmembrane 5 (LAPTM5) is a transmembrane protein located in late endosomes and lysosomes, and its encoding gene is located on chromosome 1p34. The molecular weight of LAPTM5 protein is 29 kDa, including 5 transmembrane regions. Its N-terminus is located inside the lysosome, and its C-terminus is located inside the cytoplasm, containing 3 polyproline tyrosine motifs (L / PPxY) and one ubiquitin interaction motif (UIM). LAPTM5 is involved in the transport of proteins from the Golgi apparatus to lysosomes, and affects the sorting of lysosomes and plasma membranes by interacting with the E3 ubiquitin ligase - Nedd4. In the study of liver cancer, LAPTM5 can mediate chemoresistance to chemotherapeutic drugs by regulating autophagy, and the expression level of LAPTM5 in liver cancer tissues can effectively predict the sensitivity of liver cancer patients to lenvatinib. In another cancer-related study, it was found that LAPTM5 mediates the lung-specific metastasis of renal cancer and can enhance the self-renewal ability of renal cancer cells by blocking the function of lung-derived bone morphogenetic protein (BMP). In the study of lysosome-dependent cell death pathways, it was found that the lysosome cell death regulator (LCDR) gene can improve the stability of LAPTM5, thereby maintaining the stability of the lysosome membrane, inhibiting lysosome-dependent cell death, and promoting the survival of tumor cells, suggesting that LAPTM5 may be a potential therapeutic target in cancer research. However, the role of LAPTM5 in the resistance of AML to AraC has not been reported. The present invention first discovers that LAPTM5 is a key gene for the resistance of AML to AraC. Targeting LAPTM5 can significantly reduce the resistance of AML cells to AraC, suggesting that there is a synthetic lethal effect between LAPTM5 and cytarabine in AML. LAPTM5 is expected to become a new target for combined cytarabine treatment of drug resistance in AML. Summary of the Invention

[0005] Terms and Statements of the Present Invention:

[0006] In the present invention, the articles "a", "an" and "the": unless otherwise explicitly limited to one (kind) of object, include plural objects.

[0007] In the present invention, the term "protein" refers to at least two covalently linked amino acids, which includes proteins, polypeptides, oligopeptides and peptides. This term also includes post-expression modifications of proteins, such as glycosylation, acetylation, phosphorylation, etc. This term also includes variants obtained by modifying the amino acid sequence of natural proteins or polypeptides, such as deletions, substitutions, insertions.

[0008] In the present invention, the term "AraC" refers to cytarabine, a pyrimidine antimetabolite chemotherapy drug. AraC is cell cycle-specific and is more sensitive to the S phase of the cell cycle, i.e., the DNA synthesis phase. After entering the human body and being phosphorylated by kinases, it is converted into cytarabine triphosphate and cytarabine diphosphate, which can inhibit cell DNA synthesis and interfere with cell proliferation, thereby achieving the therapeutic purpose. AraC is mainly used for the treatment of acute leukemia.

[0009] In the present invention, the term "drug resistance", also known as resistance, refers to the tolerance of tumor cells to the action of chemotherapy drugs. Once drug resistance occurs, the chemotherapy effect of the drug is significantly reduced.

[0010] In the present invention, the term "therapeutically effective amount" refers to the amount of at least one agent or compound that, when administered, is sufficient to relieve to some extent one or more symptoms of the disease or disorder being treated. The result can be the reduction and / or alleviation of signs, symptoms, or causes, or any other desired change in a biological system. Techniques such as dose escalation trials can be used to determine the effective amount suitable for any individual case.

[0011] In the present invention, the term "pharmaceutically acceptable" means that a carrier, vehicle, diluent, excipient, and / or the salt formed is generally chemically or physically compatible with the other components constituting a pharmaceutical dosage form and is physiologically compatible with the receptor.

[0012] The technical solution of the present invention is as follows:

[0013] On the one hand, the present invention provides the use of a substance that inhibits LAPTM5 in the preparation of a drug for treating, adjuvantly treating, and / or preventing leukemia.

[0014] Specifically, the substance that inhibits LAPTM5 is capable of reducing at least one of the expression level, content, and specific activity of LAPTM5 protein.

[0015] Further, the substance that inhibits LAPTM5 is selected from one or more of siRNA targeting LAPTM5, an expression plasmid inserted with a fragment encoding shRNA targeting LAPTM5, and a gene editing vector inserted with a fragment encoding gRNA targeting LAPTM5.

[0016] Specifically, the leukemia includes acute leukemia and chronic leukemia.

[0017] Further, the acute leukemia includes acute myeloid leukemia and acute lymphoblastic leukemia.

[0018] Further, the chronic leukemia includes but is not limited to chronic myeloid leukemia, chronic lymphocytic leukemia, and chronic myelomonocytic leukemia.

[0019] Furthermore, the leukemia is acute myeloid leukemia.

[0020] Still further, the acute myeloid leukemia includes, but is not limited to, acute granulocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and acute megakaryocytic leukemia.

[0021] Still further, the acute lymphoblastic leukemia includes, but is not limited to, acute B-lymphoblastic leukemia and acute T-lymphoblastic leukemia.

[0022] Preferably, the effect of the drug is at least one of the following:

[0023] (a) Increasing the sensitivity of cells to drugs for treating leukemia;

[0024] (b) Reducing the drug resistance to drugs for treating leukemia;

[0025] (c) Reducing apoptosis of cells induced by drugs for treating leukemia.

[0026] Preferably, the substance that inhibits LAPTM5 of the present invention can be used in combination with other drugs for treating leukemia.

[0027] On the other hand, the present invention provides the use of a substance that inhibits LAPTM5 in increasing the sensitivity of cells to drugs for treating leukemia.

[0028] Further, the cells are leukemia cells.

[0029] Still further, the leukemia cells are AML cells.

[0030] Further, the drugs for treating leukemia include, but are not limited to, cytarabine, daunorubicin, mitoxantrone, vincristine, doxorubicin, asparaginase, and methotrexate.

[0031] Still further, the drug for treating leukemia is cytarabine.

[0032] Specifically, the substance that inhibits LAPTM5 increases the sensitivity of cells to drugs for treating leukemia through lipid metabolism.

[0033] On the other hand, the present invention provides a drug for treating, adjuvant treating, and / or preventing leukemia, and the drug contains a therapeutically effective amount of a substance that inhibits LAPTM5.

[0034] Specifically, the leukemia includes acute leukemia and chronic leukemia.

[0035] Further, the acute leukemia includes acute myeloid leukemia and acute lymphoblastic leukemia.

[0036] Further, the chronic leukemia includes, but is not limited to, chronic myelogenous leukemia, chronic lymphocytic leukemia, and chronic myelomonocytic leukemia.

[0037] Even further, the leukemia is acute myeloid leukemia.

[0038] Preferably, the drug further includes a pharmaceutically acceptable carrier, and the pharmaceutically acceptable carrier is selected from at least one of diluents, binders, surfactants, lubricants, fillers, disintegrants, and stabilizers.

[0039] Even more preferably, the diluents include, but are not limited to, starch, lactose, glucose, sodium chloride, and urea.

[0040] Even more preferably, the binders include, but are not limited to, dextrin, sucrose, gum arabic, ethyl cellulose, polyvinyl alcohol, pregelatinized starch, maltodextrin, polyethylene glycol, carboxymethyl cellulose, polyvinylpyrrolidone, gelatin, hydroxypropyl cellulose, and hydroxypropyl methylcellulose.

[0041] Even more preferably, the surfactants include, but are not limited to, polyoxyethylene sorbitan fatty acid esters, monoglyceride stearate, sodium dodecyl sulfate, and cetyl alcohol.

[0042] Even more preferably, the lubricants include, but are not limited to, glycerol monostearate, talc, zinc stearate, sodium stearyl fumarate, polyethylene glycol, sucrose monolaurate, polyethylene glycol, sodium lauryl sulfate, magnesium lauryl sulfate, polyoxyethylene monostearate, and magnesium dodecyl sulfate.

[0043] Even more preferably, the fillers include, but are not limited to, xylitol, maltose, sorbitol, lactose, sucrose, dextrin, mannitol, glucose, starch, sodium alginate, erythrose, laminarin powder, microcrystalline cellulose, agar powder, calcium carbonate, and sodium bicarbonate.

[0044] Even more preferably, the disintegrants include, but are not limited to, sodium carboxymethyl starch, cross-linked vinylpyrrolidone, low-substituted hydroxypropyl methylcellulose, and cross-linked carboxymethylcellulose sodium.

[0045] Even more preferably, the stabilizers include, but are not limited to, human serum albumin, L-amino acids, sugars, and cellulose derivatives.

[0046] Preferably, the drug can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, or by an implanted reservoir device. The drug of the present invention may contain any conventional non-toxic pharmaceutically acceptable carriers, excipients, or adjuvants.

[0047] Preferably, the dosage forms of the drug include tablets, capsules, granules, pills, dripping pills, syrups, powders, powders for external use, suppositories, drops, aerosols, emulsions, injections, and suspensions.

[0048] Specifically, the present invention provides a method for non-diagnostically or non-therapeutically enhancing the sensitivity of leukemia cells to leukemia drugs in vitro, and the method is to administer a substance that inhibits LAPTM5 to leukemia cells.

[0049] The beneficial effects of the present invention are as follows:

[0050] The present invention discovers for the first time that LAPTM5 is a key gene for AML resistance to AraC. Targeting LAPTM5 can significantly reduce the resistance of AML cells to AraC, suggesting that there is a synthetic lethal effect between LAPTM5 and cytarabine in AML. LAPTM5 is expected to become a new target for combination therapy with cytarabine for drug resistance in AML. Description of the Drawings

[0051] Figure 1 For detecting the apoptosis of cells in each group after treatment with AraC by live / dead cell double staining experiment.

[0052] Figure 2 For quantitative statistics of the results of the live / dead cell double staining experiment.

[0053] Figure 3 For detecting the expression levels of CASPASE3 and PARP proteins in cells of each group after treatment with AraC by WB.

[0054] Figure 4 For detecting the IC50 value of cells in each group to AraC by CCK8 method.

[0055] Figure 5 For detecting the relative expression level of LAPTM5 mRNA in cells of each group by qPCR method.

[0056] Figure 6 For detecting the IC50 value of cells in each group to AraC by CCK8 method.

[0057] Figure 7 For detecting the expression levels of CASPASE3 and PARP proteins in cells of each group after treatment with drugs by WB.

[0058] Figure 8 For detecting the relative expression level of LAPTM5 mRNA in cells of each group by qPCR method.

[0059] Figure 9 For detecting the IC50 value of cells in each group to AraC by CCK8 method.

[0060] Figure 10 To detect the expression of CASPASE3 and PARP proteins in each group of cells treated with AraC by WB.

[0061] Figure 11 To detect the proportion of apoptotic cells after AraC treatment by flow cytometry.

[0062] Figure 12 To perform quantitative statistics on the proportion of apoptotic cells detected by flow cytometry.

[0063] Figure 13 To detect the apoptosis of each group of cells after AraC treatment by live / dead cell double staining experiment.

[0064] Figure 14 To perform quantitative statistics on the results of the live / dead cell double staining experiment.

[0065] Figure 15 To show the curve graphs of tumor volume changes in the Scramble group and shLAPTM5 group.

[0066] Figure 16 To show the H&E and KI67 staining result graphs in the Scramble group and shLAPTM5 group.

[0067] Figure 17 To show the statistical graphs of KI67 staining results in the Scramble group and shLAPTM5 group.

[0068] Figure 18 To show the curve graphs of tumor volume changes in the HL60 Arac-R scramble group and Arac-R shLAPTM5 group.

[0069] Figure 19 To show the H&E and KI67 staining result graphs in the HL60 Arac-R scramble group and Arac-R shLAPTM5 group.

[0070] Figure 20 To show the statistical graphs of H&E and KI67 staining results in the HL60 Arac-R scramble group and Arac-R shLAPTM5 group.

[0071] Figure 21 To show the lipid droplet staining result graphs in the Scramble group, HL60 Arac-R scramble group and Arac-R shLAPTM5 group.

[0072] Figure 22 To show the statistical graphs of lipid droplet staining results in the Scramble group, HL60 Arac-R scramble group and Arac-R shLAPTM5 group.

[0073] Figure 23 Immunofluorescence results of PLIN2 protein in the Scramble group, HL60 Arac-R scramble group, and Arac-R shLAPTM5 group.

[0074] Figure 24 Statistical chart of immunofluorescence results of PLIN2 protein in the Scramble group, HL60 Arac-R scramble group, and Arac-R shLAPTM5 group.

[0075] Group description: Figures 1 - 4 Among them, WT: HL60 sensitive cell line; Arac-R: HL60 cytarabine-resistant cell line.

[0076] Figures 5 - 14 Among them, Scramble: HL60 sensitive cell line infected with empty virus vector; Sh1: HL60 sensitive cell line 1 infected with virus vector for knocking down LAPTM5 gene; Sh2: HL60 sensitive cell line 2 infected with virus vector for knocking down LAPTM5 gene; Sh3: HL60 sensitive cell line 3 infected with virus vector for knocking down LAPTM5 gene; Arac-R scramble: HL60 Arac-R cell line infected with empty virus vector; R-sh1: HL60 Arac-R cell line 1 infected with virus vector for knocking down LAPTM5 gene; R-sh2: HL60 Arac-R cell line 2 infected with virus vector for knocking down LAPTM5 gene; R-sh3: HL60 Arac-R cell line 3 infected with virus vector for knocking down LAPTM5 gene.

[0077] Figures 15 - 20 Among them, Scramble: mice subcutaneously transplanted with Scramble cell line; ShLAPTM5 in the same group as Scramble: mice subcutaneously transplanted with Sh3 cell line; Arac-R scramble: mice subcutaneously transplanted with Arac-R scramble cell line; ShLAPTM5 in the same group as Arac-R scramble: mice subcutaneously transplanted with R-sh1 cell line.

[0078] Figures 21 - 24 Among them, Scramble: HL60 sensitive cell line infected with empty virus vector; Arac-Rscramble: HL60 Arac-R cell line infected with empty virus vector; ShLAPTM5: R-sh1 cell line.

[0079] In the above figures, *p < 0.05; **p < 0.01; ***p < 0.001; ns indicates no significant difference. Detailed implementation mode

[0080] In order to make the technical means, creative features, achieved purposes and effects of the present invention easy to understand, the present invention will be further clarified below in conjunction with specific embodiments. However, the following embodiments are only the preferred embodiments of the present invention, not all of them. Based on the embodiments in the implementation mode, other embodiments obtained by those skilled in the art without creative labor all belong to the protection scope of the present invention. In the following embodiments, unless otherwise specified, the operation methods used are all conventional operation methods, the equipment used is all conventional equipment, and the equipment materials used in each embodiment are the same.

[0081] Example 1: Construction of AML AraC-resistant cell line

[0082] To study whether inhibiting LAPTM5 can affect the sensitivity of tumor-resistant cells to AraC, first, a drug concentration escalation method was used to construct an AraC-resistant cell line of human promyelocytic leukemia cells HL60 (hereinafter referred to as the resistant cell line, HL60 Arac-R) in vitro. The results of Western blot (WB) and CCK8 experiments showed that the resistant cell line was successfully constructed.

[0083] 1. Reagents: AraC (purchased from Selleck Chemicals, S1648), Cell Counting Kit-8 (CCK-8, purchased from APExBIO Technology, K1018), ACTB (P30002), CASP3 (TA7022), PARP (T40050) antibodies were all purchased from Abmart.

[0084] 2. Detect the IC50 (half-inhibitory concentration) value of HL60 cells against AraC: In the IC50 detection experiment, the concentration gradient range of AraC set is: 0 - 20 μM. At the same time, a control group (PBS instead of AraC) and a blank group (cells not plated) are set. Take HL60 cells in good growth state, centrifuge to remove the supernatant, and resuspend them with an appropriate amount of PBS to make a cell suspension, and use a cell counting chamber to count the cells. According to the cell counting results, and after calculating according to the standard of plating 8000 cells in each well of the 96-well plate, make up the volume with the culture medium to obtain a cell suspension containing a specific number of cells. Then add 90 μl of the cell suspension and 10 μl of the drug solution to each well of the 96-well plate, and add 100 μl of PBS to the untreated wells around the 96-well plate to reduce the influence caused by edge solvent evaporation, and place the 96-well plate in the cell culture incubator for culture. After culturing for 48 h, add 10 μl of CCK-8 reagent to each well, incubate at 37 °C in the dark for 1 h, then use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance at a wavelength of 450 nm, and finally use GraphPad Prism to calculate the IC50 value of HL60 cells against AraC.

[0085] 3. Construct drug-resistant cells: Use one percent of the IC50 value of HL60 cells against AraC obtained from the above detection (concentration of 50 nM) as the initial induction concentration. After adding the drug to treat the cells for 24 h, change to fresh culture medium and continue to culture for 24 h, and then, according to the cell state, choose to treat the cells with the same drug concentration or a higher drug concentration.

[0086] 4. Verify the drug-resistant cells:

[0087] Perform an IC50 detection on the induced cells once every two weeks. The standard for cell drug resistance: The IC50 value reaches 10 times the IC50 value of sensitive cells (5 μM).

[0088] When the IC50 value of the induced cells reaches the drug resistance standard, detect the apoptosis level of the cells under drug treatment: Treat HL60 wild-type cells and drug-resistant cells with AraC (5 μM) simultaneously, and use Western blot (WB) to detect the apoptosis indexes: the expression changes of Caspase-3 and PARP proteins. In subsequent cell experiments, 5 μM is also selected as the treatment concentration.

[0089] The specific operation method of WB is as follows: Collect the cells treated with drugs, centrifuge to remove the supernatant, wash the cell pellet once with PBS, add an appropriate amount of RIPA lysis buffer (containing protease inhibitor) according to the cell number, lyse on ice for 30 min, and mix every 10 min. After centrifugation at 12000 rpm at 4 °C for 10 min, transfer the supernatant to a new EP tube. After protein quantification, mix with protein loading buffer to prepare electrophoresis samples. The protein samples are separated by 12% SDS-PAGE and transferred to a 0.2 um PVDF membrane, followed by blocking with 5% skim milk, overnight incubation with primary antibody, and incubation with secondary antibody at room temperature. Collect signals through a chemiluminescence imaging system, and finally perform quantitative analysis on the results using ImagJ and GraphPad Prism software.

[0090] At the same time, the sensitivity of AML cell lines to drugs was detected by live / dead cell double staining experiment. The specific operation method of the double staining experiment is as follows: Take cells in good growth state, centrifuge to remove the supernatant, wash once with PBS, resuspend with PBS and count the cells using a cell counting plate. Cells in different groups need to be plated in a well plate at the same cell density (10000 cells / well), and the same concentration (5 uM) of AraC is added, and the drug treatment time is kept consistent. After 24 h of drug treatment, collect the cells into an EP tube, centrifuge to remove the supernatant, wash the cell pellet once with 1x Assay Buffer, add an appropriate amount of 1x Assay Buffer to resuspend, add 1 ul of Calcein-AM and 3 ul of PI reagent to every 1x10 5 cells, place in a cell culture incubator, incubate in the dark for 20 min, then centrifuge to remove the supernatant, wash once with PBS, resuspend again with PBS, take pictures with a fluorescence microscope, and record the data.

[0091] Experimental results:

[0092] As Figures 1 - 4 shown, in the in vitro culture system, the cells were continuously under drug pressure and gradually showed obvious drug-resistant phenotypes. Specifically, under the treatment with the same concentration of drugs, the levels of apoptotic proteins cleaved caspase3 and cleaved PARP in the Arac-R cell line were significantly reduced compared with those in the sensitive cell line, and the IC50 value of the drug-resistant cells reached 10 times (5 uM) that of the sensitive cells' IC50 value.

[0093] Example 2 Detection of LAPTM5 in AML AraC-resistant cell lines

[0094] 1. Experimental reagents: TRIzol lysis solution (purchased from Vazyme, R401-01), reverse transcription kit, and SYBR Green qPCR SuperMix were all purchased from Beijing TransGen Biotech Co., Ltd., and LAPTM5 antibody (purchased from Abcepta, AP10077a).

[0095] 2. Detecting the LAPTM5 mRNA level in drug-resistant cells includes the following steps: Collect cells, add 1 ml of TRIzol lysis solution to fully lyse the cells. Add 200 μl of chloroform, mix well and let stand for 5 min, then set the rotation speed at 12,000 rpm and centrifuge for 15 min. Transfer the uppermost clear liquid to a new EP tube. After adding an equal volume of isopropanol and mixing well, let stand on ice for 5 min, then set the rotation speed at 12,000 rpm and centrifuge for 10 min. Discard the supernatant, and wash the precipitate twice with 75% ethanol. Dissolve the obtained RNA precipitate with an appropriate amount of DEPC water and measure the RNA concentration. Use the reverse transcription kit to reverse transcribe RNA into cDNA. Subsequently, perform qPCR using the SYBR system. The primer sequences are as follows:

[0096] Human-ACTIN:

[0097] Forward primer: CATGTACGTTGCTATCCAGGC (SEQ ID NO:1)

[0098] Reverse primer: CTCCTTAATGTCACGCACGAT (SEQ ID NO:2)

[0099] Human-LAPTM5:

[0100] Forward primer: GCGTCTTGTTGTTCATCGAGC (SEQ ID NO:3)

[0101] Reverse primer: CGATCCTGAGGTAGCCCAT (SEQ ID NO:4)

[0102] The reaction system for qPCR is 20 μl; the proportion of the reaction system: DEPC water: forward primer: reverse primer: cDNA to be tested = 10:7:1:1.

[0103] Reaction procedure: 94°C for 30 seconds, 94°C for 5 seconds, 60°C for 15 seconds, 72°C for 10 seconds, set for 40 cycles.

[0104] 3. Detecting the LAPTM5 protein level in drug-resistant cells: The method for preparing protein samples is the same as in Example 1. Use 10% SDS-PAGE to separate protein samples in WB, and the remaining experimental operations are the same as in Example 1.

[0105] Test results:

[0106] As Figure 3 shown, compared with sensitive strain cells, the drug-resistant cell line highly expressed LAPTM5, indicating that LAPTM5 may be related to the resistance of AML cells to AraC.

[0107] Example 3 Construction of AML LAPTM5 Knockdown Stable Cell Line

[0108] 1. Reagents: Polybrene (Sigma-Aldrich, MFCD00133397), pLV3-U6-Laptm5 (human)-shRNA-GFP-Puro and pLV3-U6-GFP-Puro plasmids were all purchased from Miaoling Biotechnology Co., Ltd. The primer sequences of the LAPTM5 knockdown plasmid are as follows:

[0109] shRNA1-F:

[0110] GGTGCTACAGATTGATCAAGTTTCAAGAGAACTTGATCAATCTGTAGCACC (SEQ ID NO:5).

[0111] shRNA1-R:

[0112] GGTGCTACAGATTGATCAAGTTCTCTTGAAACTTGATCAATCTGTAGCACC (SEQ ID NO:6).

[0113] shRNA2-F:

[0114] GCCATCTACCATGTGATCATGTTCAAGAGACATGATCACATGGTAGATGGC (SEQ ID NO:7).

[0115] shRNA2-R:

[0116] GCCATCTACCATGTGATCATGTCTCTTGAACATGATCACATGGTAGATGGC (SEQ ID NO:8).

[0117] shRNA3-F:

[0118] GCCTTCATCACTGTCCTTATCTTCAAGAGAGATAAGGACAGTGATGAAGGC (SEQ ID NO:9).

[0119] shRNA3-R:

[0120] GCCTTCATCACTGTCCTTATCTCTCTTGAAGATAAGGACAGTGATGAAGGC (SEQ ID NO:10). The plasmids used for knocking down LAPTM5 in sensitive cell lines and drug-resistant cell lines are the same.

[0121] 2. Obtaining the target plasmid virus solution: HEK 293T cells are plated at an appropriate cell density. When the cell density reaches 60 - 70%, the serum-free medium is replaced. At the same time, according to the lentivirus packaging instructions (the rapid lentivirus packaging kit is purchased from Shanghai Yaen Biotechnology Co., Ltd., product number GY101), the target plasmid, virus-related plasmids, and transfection reagent are added to the HEK 293T cell culture system together. After transfection for 6 hours, the medium containing 20% serum is replaced and the cells are cultured for another 48 hours.

[0122] 3. Infecting the target cells: HL60 cells are plated in a 6-well plate at a density of 40 - 50% in advance. The supernatant of HEK 293T cells is collected, filtered through a 0.45um filter membrane, and then added to HL60 cells. At the same time, Polybrene (8ug / ml) is added to improve the infection efficiency. After the target cells are infected with the virus for 12 hours, the supernatant is removed by centrifugation, and the fresh medium containing 10% serum is replaced. After continuing to culture for 24 hours, 0.1ug / ml puromycin is added for resistance screening.

[0123] 4. Verifying the stable cell line: For the cells screened by puromycin, the expression levels of LAPTM5 gene and protein are detected by qPCR and WB, and the detection methods are the same as those in Example 2.

[0124] Test results:

[0125] As Figures 5 - 10 shown, a stable cell line with knocked-down AML LAPTM5 was successfully constructed.

[0126] Example 4 Inhibiting LAPTM5 increases the sensitivity of AML cells to AraC

[0127] 1. Reagents: The Calcein-AM / PI live / dead cell double staining kit is purchased from Solarbio Company, and the Annexin V-APC / DAPI Apoptosis Kit is purchased from Elabscience Company.

[0128] 2. Detecting the drug sensitivity of AML cell lines through the live / dead cell double staining experiment. The operation of the double staining experiment is the same as that in Example 1.

[0129] 3. Detecting the IC50 of AML cell lines: Detect the IC50 of AML LAPTM5 knockdown cells, and the IC50 detection method is the same as that in Example 1.

[0130] 4. Detect the apoptosis level of AML cell lines by WB: Detect the apoptosis level of AML LAPTM5-knockdown cells. The WB experimental operation is the same as that in Example 1.

[0131] 5. Detect the apoptosis level of AML cell lines by flow cytometry: Take cells in good growth state, centrifuge to remove the supernatant, wash once with PBS, resuspend with PBS and count the cells using a cell counting chamber. Cells in different groups need to be seeded in a well plate at the same cell density (10,000 cells / well), and the same concentration (5 μM) of AraC is added, and the drug-induced apoptosis time is kept consistent. After 12 h of induction treatment, collect the cells into an EP tube, centrifuge to remove the supernatant, resuspend with PBS and count the cells. For each group, 1 x 10 5 resuspended cells are taken, the supernatant is removed by centrifugation, 100 μl of 1x Annexin V Binding Buffer is added to resuspend the cells, and then 2.5 μl of Annexin V-APC and 2.5 μl of DAPI reagent are added, and the cells are incubated at room temperature in the dark for 15 min. After staining, 400 μl of 1x Annexin V Binding Buffer is added to dilute the sample, and the sample is detected by flow cytometry.

[0132] Test results:

[0133] The results are as Figures 5 - 14 shown. Inhibiting LAPTM5 in both wild-type cell lines and drug-resistant cell lines can promote AraC-induced apoptosis, and inhibiting LAPTM5 increases the sensitivity of AML cell lines to cytarabine. More notably, after inhibiting LAPTM5 in the drug-resistant cell line, the apoptosis effect induced by cytarabine is stronger than that of inhibiting LAPTM5 in the wild-type cell line. This suggests that there is a synthetic lethal effect between LAPTM5 and cytarabine in AML.

[0134] Example 5 Verification of the inhibitory effect of inhibiting LAPTM5 on the progression of AML by subcutaneous xenograft experiment in SCID mice

[0135] All animal experiments were approved by the Experimental Animal Ethics Committee of Sun Yat-sen University and were conducted according to the guiding methods approved by the committee. Ethical approval number: SYSU-IACUC-2023-001717.

[0136] 1. Experimental grouping and subcutaneous tumor implantation plan: 24 4-week-old male SCID mice were randomly divided into 4 groups, and each group was divided into two cages for feeding. Clean drinking water, feed and bedding were changed daily. The specific operations are as follows:

[0137] Group 1 - HL60 Scramble group: A total of 7 mice. Subcutaneous tumor implantation: First, fix the mice, and use a special animal hair clipper to remove the hair on the right dorsal part of each mouse. Disinfect the skin with an alcohol cotton ball, and use a 1 ml syringe to inoculate HL60 Scramble cells at a volume of 0.1 ml and 1×10 6 cells / mouse into the right wing of the back of the mouse. During the feeding period, observe and record the body weight, body surface, body temperature, diet, water intake, and tumor volume changes of the mice every day, and take pictures of the back of the mice at appropriate time points.

[0138] Group 2 - HL60 shLAPTM5 group: A total of 7 mice. The operation steps of subcutaneous tumor implantation and the method of observing and recording animals are the same as those in Group 1. The cell type implanted subcutaneously in this group is the gene knockout cell of the HL60 target gene.

[0139] Group 3 - HL60 Arac-R scramble group: A total of 5 mice. The operation steps of subcutaneous tumor implantation and the method of observing and recording animals are the same as those in Group 1. The cell type implanted subcutaneously in this group is the drug-resistant cell of HL60.

[0140] Group 4 - HL60 Arac-R shLAPTM5 group: A total of 5 mice. The operation steps of subcutaneous tumor implantation and the method of observing and recording animals are the same as those in Group 1. The cell type implanted subcutaneously in this group is the gene knockout cell of the HL60 target gene after drug resistance.

[0141] 2. Drug administration plan: Cytarabine was prepared in advance with injectable normal saline, freshly prepared before use, and sterilized through a 0.22 μm filter membrane. When the subcutaneous tumors of the mice in Group 3 and Group 4 grew to be palpable, cytarabine was administered via the tail vein at a dose of 12 mg / kg once a day for 7 consecutive days. During the drug administration period, observe and record the body weight, body surface, body temperature, diet, water intake, and tumor growth of the mice every day.

[0142] 3. Processing of tumor tissues: When the tumors in Group 1 and Group 2 grew to the 30th day, and after 1 week of drug treatment in the drug administration group, the tumor tissues on the backs of the mice were sampled and photographed. After the tumor tissues were soaked in 4% paraformaldehyde solution, paraffin-embedded, sectioned, etc., subsequent hematoxylin-eosin and immunohistochemical staining were performed using the conventional operation methods in this field.

[0143] Test results:

[0144] The results are as Figures 15 - 20 shown. In the in vivo experiment, the tumorigenicity rate of the knockdown cell line decreased significantly, the tumor growth was slow, and the tumor proliferation markers were significantly reduced. The mouse xenograft experiment of the drug-resistant cell line showed that the combination of cytarabine treatment while inhibiting LAPTM5 further inhibited the progression of AML. This further suggests that LAPTM5 can be used as a new target for the treatment of drug resistance in combination with cytarabine.

[0145] Example 6 LAPTM5 may regulate the resistance of AML cells to AraC through lipid droplet metabolism

[0146] 1. Reagents: The AIE lipid droplet yellow probe kit was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0147] 2. Detect the lipid droplet level of the AML cell line: First, prepare the dye working solution: Add 1 μl of the AIE Lipid droplets Yellow Probe stock solution to 1 ml of PBS buffer to obtain an AIE Lipid droplets Yellow Probe working solution with a final concentration of 10 μM. Collect the cells, add an appropriate amount of the working solution, incubate in a cell culture incubator for 30 min, wash 3 times with PBS, and observe using a confocal fluorescence microscope with an excitation wavelength set at 488 nm; collect signals at a wavelength of 550 - 650 nm.

[0148] 3. Detect the expression level of the lipid droplet marker - PLIN2 protein in the AML cell line by immunofluorescent (IF) assay: Collect the cells and wash them once with PBS. Use a cytospin centrifuge to fix the suspended cells on a glass slide. Discard the supernatant, add 4% paraformaldehyde, fix at room temperature for 15 min, then aspirate the paraformaldehyde and wash 3 times with PBS, 5 min each time. Add 0.5% Triton X-100 to the glass slide, incubate at room temperature for 10 min, discard the supernatant, wash 3 times with PBS, 5 min each time, then add 10% goat serum and block at room temperature for 45 min. Aspirate the blocking solution, wash once with PBST, add the PLIN2 primary antibody, and incubate overnight on a shaker at 4 °C. Aspirate the primary antibody, wash 3 times with PBST solution, 5 min each wash, add the fluorescent secondary antibody, and incubate in the dark at room temperature for 1 h. Finally, carefully add the anti-fluorescence quenching mounting medium and observe under the microscope as soon as possible.

[0149] Test results:

[0150] The results are as Figures 21 - 24 shown. Compared with wild-type cells, the lipid droplet level of drug-resistant cells was significantly increased. After drug treatment, the lipid droplet level of drug-resistant cells decreased significantly. When LAPTM5 was inhibited, it was shown that the drug-resistant phenotype of LAPTM5-knockdown cells was weakened and the level of the lipid droplet protein PLIN2 did not change significantly, suggesting that LAPTM5 may regulate the resistance of AML cells to Arac through lipid droplet metabolism.

[0151] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of a substance that inhibits LAPTM5 in combination with cytarabine in the preparation of a medicament for treating, adjuvant treating, and / or preventing acute myeloid leukemia, characterized in that, the substance that inhibits LAPTM5 is pLV3-U6-Laptm5(human)-shRNA-GFP-Puro, and the acute myeloid leukemia is acute promyelocytic leukemia.

2. Use of a substance that inhibits LAPTM5 in the preparation of a product for enhancing the sensitivity of acute myeloid leukemia cells to a medicament for treating acute myeloid leukemia, characterized in that, the substance that inhibits LAPTM5 is pLV3-U6-Laptm5(human)-shRNA-GFP-Puro, the medicament for treating acute myeloid leukemia is cytarabine, and the acute myeloid leukemia is acute promyelocytic leukemia.

3. The use according to claim 2, characterized in that, the pLV3-U6-Laptm5(human)-shRNA-GFP-Puro enhances the sensitivity of cells to the medicament for treating leukemia through lipid metabolism.

Images